CN110295204B - Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation - Google Patents

Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation Download PDF

Info

Publication number
CN110295204B
CN110295204B CN201910688020.5A CN201910688020A CN110295204B CN 110295204 B CN110295204 B CN 110295204B CN 201910688020 A CN201910688020 A CN 201910688020A CN 110295204 B CN110295204 B CN 110295204B
Authority
CN
China
Prior art keywords
leu
glu
ser
lys
ile
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201910688020.5A
Other languages
Chinese (zh)
Other versions
CN110295204A (en
Inventor
陈守文
占杨杨
王欢
许勇
马昕
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hubei University
Original Assignee
Hubei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hubei University filed Critical Hubei University
Priority to CN201910688020.5A priority Critical patent/CN110295204B/en
Publication of CN110295204A publication Critical patent/CN110295204A/en
Application granted granted Critical
Publication of CN110295204B publication Critical patent/CN110295204B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/22—Preparation of oxygen-containing organic compounds containing a hydroxy group aromatic
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01043—Phenylpyruvate decarboxylase (4.1.1.43)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00—Technologies for the production of fuel of non-fossil origin
    • Y02E50/10—Biofuels, e.g. bio-diesel

Abstract

The invention belongs to the technical field of genetic engineering and enzyme engineering, and discloses a phenylpyruvate decarboxylase mutant F542W in the production of phenethyl alcohol by biological fermentationApplication is carried out. The invention uses the site-directed mutagenesis to derive the gene from lactococcus lactis (A)Lactococcus lactis subsp.LactisThe pyruvate decarboxylase KivD molecular catalytic domain with the preservation number of CICC6246) is mutated into tryptophan at the 542 th phenylalanine position, so that the enzyme activity of the pyruvate decarboxylase is obviously improved, the problem that the catalytic efficiency of the pyruvate decarboxylase is not high at present is solved, the pyruvate decarboxylase is applied to the biological fermentation of the phenethyl alcohol, a new thought is provided for the production of the phenethyl alcohol, and the method is suitable for large-scale popularization.

Description

Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation
Technical Field
The invention belongs to the technical field of enzyme engineering and genetic engineering, and particularly relates to an application of a phenylpyruvate decarboxylase mutant F542W in production of phenethyl alcohol by biological fermentation.
Background
Phenethyl alcohol is aromatic alcohol with elegant, fine and lasting rose fragrance. Due to its peculiar smell, phenethyl alcohol is widely used as a fragrance substance in the perfume, cosmetic and food industries. The phenethyl alcohol can also be used as an insecticide and a novel biofuel. Therefore, the phenethyl alcohol has wide application prospect.
Microorganisms metabolize primarily simple carbon sources via the pyruvate pathway and the Ehrlich pathway to produce phenethyl alcohol. However, only a few microorganisms have the Ehrlich pathway, and thus the synthesis of phenethyl alcohol using microorganisms is greatly limited due to too few species. The ketoacid decarboxylase (EC4.1.1.43) is a key enzyme in the synthetic pathway of the phenethyl alcohol, and complexly catalyzes phenylpyruvic acid to generate phenylpropyl aldehyde, and then further generates final product phenethyl alcohol through oxidation-reduction reaction. Because of the high specificity of its substrate action, phenylpyruvate decarboxylase is the rate-limiting enzyme in the biosynthesis of phenethyl alcohol. At present, studies have been made to increase the expression level of ketoacid decarboxylase mainly by screening and optimizing the expression level. Currently keto acid decarboxylase Aro10 from saccharomyces cerevisiae, keto acid decarboxylase Kdc in pichia, enterobacter keto acid decarboxylase Kdc4427, azospirillon keto acid decarboxylase abddc and zymomonas mobilis decarboxylase PDC and lactococcus lactis, keto acid decarboxylase KivD from saccharomyces species are tested for the synthesis of phenyl ethanol, with keto acid decarboxylase Aro10 from saccharomyces species being the most preferred enzyme. Is widely applied to the synthesis of phenethyl alcohol in escherichia coli and saccharomyces cerevisiae. However, the expression of Aro10 by these strains still has the problems of poor substrate specificity, low catalytic efficiency, and the like, and thus, none of the above-mentioned techniques can be really applied to industrial production.
Ketoacid decarboxylase KivD, derived from lactococcus lactis, is a ketoacid decarboxylase of the type having a broad substrate spectrum capable of simultaneously catalyzing branched ketoacids (3-methyl-2-oxobutanoic acid, 4-methyl-2-oxovaleric acid and 3-methyl-2-oxovaleric acid), aromatic ketoacids (4 hydroxyphenylpyruvic acid, phenylpyruvic acid and benzoylformic acid), and linear ketoacids (2-oxohexanoic acid, 2-oxovaleric acid and pyruvic acid). By enzymatic analysis, the KivD substrate was found to be the most suitable 3-methyl-2-oxobutanoic acid in a branched-chain keto acid for the production of isobutanol. The structure of the KivD protein of lactococcus lactis has been resolved, and researchers found that valine at position 461, serine at position 268, phenylalanine at position 381, methionine at position 538 and phenylalanine at position 542 near the catalytic active center play important roles in substrate catalysis. These 5 amino acids become key targets for protein engineering in order to obtain the corresponding products. In order to improve the yield of isobutanol and improve the catalytic activity of KivD on 3-methyl-2-oxobutanoic acid, Peter Lindblad et al constructed V461I (VI), V461L (VL), V461F (VF), V461A (VA), M538W (MW), S286T (ST), S286Y (SY), S286A (SA), F542L (FL) and F542W (FW) mutants by carrying out series of mutations at four sites. Among a plurality of mutants, only the isobutanol yield of ST and VI is greatly improved, and the catalytic activity of 3-methyl-2-oxobutanoic acid is improved. The James C.Liao topic group aims at improving the synthesis of 3-methyl-1-pentanol, double-site overlapping mutation is carried out on KivD, four mutant strains are constructed, namely V461A/M538A, V461A/M538L, V461A/F381A and V461A/F381L, the yield of the 3-methyl-1-pentanol in the four mutants is improved by 20-50 times compared with that of a control strain, wherein the yield of the 3-methyl-1-pentanol in V461A/F381L is the highest and reaches 384.3 +/-30.3 mg/L. KivD was hardly used for the synthesis of phenethyl alcohol due to its low substrate affinity and catalytic efficiency for phenylpyruvic acid.
Disclosure of Invention
The invention aims to provide application of a phenylpyruvic acid decarboxylase mutant F542W in the production of phenethyl alcohol by biological fermentation, wherein the amino acid sequence of the phenylpyruvic acid decarboxylase mutant F542W is shown in SEQ ID NO. 3.
In order to achieve the purpose, the invention adopts the following technical measures:
the application of the phenylpyruvic acid decarboxylase mutant F542W in the production of the phenethyl alcohol by biological fermentation comprises the step of utilizing the mutant protein to directly act on the phenylpyruvic acid to prepare the phenethyl alcohol; or the gene coding the mutant protein is transformed into bacillus licheniformis to produce phenethyl alcohol through fermentation, and the amino acid sequence of the mutant F542W is shown in SEQ ID NO. 3.
In the above application, preferably, the Bacillus licheniformis is Bacillus licheniformis DW 2.
Compared with the prior art, the invention has the following advantages:
according to the invention, through a site-directed mutagenesis mode, 461 th valine near a phenylpyruvic acid decarboxylase molecular catalytic structure domain is mutated into isoleucine (named as a mutant V461I), 538 th methionine is mutated into alanine (named as a mutant M538A) and 542 th phenylalanine is mutated into tryptophan (named as a mutant F542W), so that the enzyme activity of the phenylpyruvic acid decarboxylase is obviously improved, and the problem that the catalytic efficiency of the phenylpyruvic acid decarboxylase on the phenylpyruvic acid is low at present is solved. The enzyme production capacity and the catalytic efficiency of the modified strain are improved, the content of phenethyl alcohol in the mutant is detected by gas chromatography, and the determination result shows that the mutant strains of V461I, M538A and F542W respectively produce 490.62, 318.23 and 243.08mg/L of phenethyl alcohol.
Drawings
FIG. 1 shows the product content of the mutant after catalysis.
FIG. 2 shows the enzyme activities of different mutants.
Detailed Description
The following examples are further illustrative of the present invention and are not intended to be limiting thereof. The technical scheme of the invention is a conventional scheme in the field if not specifically stated; the reagents or materials, if not specifically mentioned, are commercially available.
Test materials and reagents
1. The strain is as follows: lactococcus lactis subsp. lactis was deposited under the number CICC6246, and strain E.coli DH5 a was purchased from Beijing Quantikin Biotechnology, Inc.
2. Enzymes and other biochemical reagents: high fidelity Taq enzyme was purchased from wuhan gumbo biotechnology limited. The bacterial genome DNA extraction kit is purchased from Tiangen company, the phenethyl alcohol is purchased from Sigma company, the Clonexpress II one-step cloning kit is purchased from Nanjing Novozan biotechnology limited, and the others are all domestic reagents (all can be purchased from common biochemical reagents).
3. Culture medium:
(1) the LB culture medium formula is as follows: 10g/L tryptone, 5g/L yeast powder, 10g/L sodium chloride, pH 7.0-7.2, and sterilizing at 121 ℃ for 20 min.
(2) Fermentation medium: 10g/L tryptone, 5g/L yeast powder, 10g/L sodium chloride, 60-100 g/L glucose, 14.136g/L K 2 HPO 4 、5.168g/L KH 2 PO 4 、2.86mg/L H 3 BO 3 ,1.81mg/L MnCl 2 ·4H 2 O,0.222mg/L ZnSO 4 ·7H 2 O,0.39mg/L Na 2 MoO 4 ·2H 2 O,79μg/L CuSO 4 ·5H 2 O, and 49.4. mu.g/L Co (NO) 3 ) 2 ·6H 2 O, pH 7.0.0-7.2, sterilizing at 115 deg.C for 20 min.
Example 1:
construction of recombinant plasmid pHY-P43-kivD:
an alpha-keto acid decarboxylase kivD gene was cloned from Lactococcus lactis subsp.lactis, CICC6246 using KivD-F and KivD-R. Amplifying by taking Bacillus subtilis 168 genome as a template and P43-F and P43-R as primers to obtain a P43 promoter; and taking TamyL-F and TamyL-R as primers for amplification to obtain an amylase terminator TamyL. The P43-F and TamyL-R are used as primers to carry out SOE-PCR on three fragments of P43, kivD and TamyL to obtain a fusion fragment P43-kivD-TamyL. Plasmid pHY300PLK is used as a template, pHY-T5-F and pHY-T5-R are used as primers to carry out whole plasmid PCR amplification, and a linearized pHY300PLK vector is obtained. And (3) after the amplification products are subjected to electrophoresis detection, purifying and recovering the PCR products by using a gel recovery kit. The fusion fragment was fused with the linearized vector pHY300PLK by the Clonexpress II one-step cloning kit to obtain the recombinant plasmid pHY-P43-kivD.
P43-F:TTTTTATAACAGGAATTCTGATAGGTGGTATGTTTTCG
P43-R:TAATCTCCTACTGTATACATTGATCCTTCCTCCTTTAGA
kivD-F:CTAAAGGAGGAAGGATCAATGTATACAGTAGGAGATTA
kivD-R:TCCGTCCTCTCTGCTCTT TTATGATTTATTTTGTTCAG
TamyL-F:CTGAACAAAATAAATCATAAAAGAGCAGAGAGGACGGATT
TamyL-R:AAGCTTCTAGAAGCTTCTAGCGCAATAATGCCGTCGCACT
pHY-T5-F:GAATTCCTGTTATAAAAAAAGGATC
pHY-T5-R:TCTAGAAGCTTGGGCAAAGCGTTTT
The fused recombinant plasmid pHY-P43-kivD was transformed into competent E.coli DH 5. alpha. and positive colonies were screened with ampicillin-containing LB plates. After overnight shake culture at 37 ℃ the plasmid pHY-P43-kivD was extracted and verified by sequencing.
Example 2:
preparation of wild bacteria (WT) of phenylpyruvate decarboxylase and enzyme activity determination:
the correctly sequenced plasmid pHY-P43-kivD from example 1 was transformed into Bacillus licheniformis DW 2. Selecting transformants, verifying the transformants to be correct, inoculating the transformants into an LB culture medium, and culturing for 14h at 37 ℃; the cells were transferred to a fermentation medium with an inoculum size of 3%, cultured at 37 ℃ for 24 hours, harvested by centrifugation, washed twice with PBS, and finally resuspended in 1ml of 50mM potassium phosphate buffer (pH 6.8). Cell disruption was performed using an ultrasonograph, which was set up: 150W, 20kHz, 2s of work; closing for 2s, taking 8 minutes totally, centrifuging at 4 ℃ and collecting supernatant fluid to obtain crude enzyme liquid.
The supernatant was subjected to enzyme activity assay according to the following system, enzymatic reaction system (200. mu.L): 50mM potassium phosphate buffer (pH 6.8), 1mM magnesium sulfate heptahydrate, 0.5mM thiamine pyrophosphate, 5mM sodium propiophenonate and 10. mu.L of the crude enzyme solution were reacted at 30 ℃. Measuring the absorbance at 320nm by using a microplate reader to measure the activity of the phenylpyruvate decarboxylase, and defining the enzyme quantity required by consuming 1 micromole of the substrate phenylpyruvate per minute as one enzyme activity unit (U). The enzyme activity measurement result shows that the enzyme activity (enzyme concentration) of the wild KivD is 290.05U/mL (figure 2).
Example 3:
preparation of pyruvate decarboxylase mutant
The constructed pHY-P43-kivD is used as a template, a primer is designed to carry out whole plasmid PCR amplification, and a linearized pHY300PLK vector with a P43 promoter and an amylase TamyL terminator is obtained. Site-directed mutagenesis is carried out on the kivD catalytic active site, and the mutation is replaced to a gene sequence in a primer mode, specifically comprising the following steps:
1) mutating valine at position 461 of a phenylpyruvate decarboxylase molecular catalytic domain into isoleucine, splitting a base GTC which codes amino acid 461 of kivD into two parts, primers V461I-AR and V461I-BF, and amplifying upper and lower sections of a kivD mutant sequence by using the plasmid in the embodiment 1 as a template; then, two sections are subjected to SOE-PCR amplification by taking kivD-F and kivD-R as primers to obtain a kivD mutant sequence V461I;
2) the 538 th methionine is mutated into alanine, the base GCG of the 538 th amino acid of the coded kivD is split into two parts, primers M538A-AR and M538A-BF, and the upper and lower sections of the kivD mutant sequence are amplified by using the plasmid of the embodiment 1 as a template; then, two sections are subjected to SOE-PCR by taking kivD-F and kivD-R as primers to amplify a kivD mutant sequence M538A;
3) the 542 th phenylalanine is mutated into tryptophan, the base TGG of the 542 th amino acid coding kivD is split into two parts, primers F542W-AR and F542W-BF, and the upper and lower sections of the kivD mutant sequence are amplified by using the plasmid in example 1 as a template; two sections were subjected to SOE-PCR using kivD-F and kivD-R as primers to amplify the kivD mutant sequence F542W.
And purifying and recovering the PCR product by using a gel recovery kit, and carrying out electrophoresis detection on the recovered product. And fusing the fused mutant fragment with a linearized vector pHY300PLK with a P43 promoter and an amylase Tamyl terminator, converting the product into E.coli DH5 alpha to obtain recombinant plasmids which are respectively named as pHY-V461I, pHY-M538A and pHY-F542W, and carrying out sequencing verification.
V461I–AR:GTCCATGAATTTCTCTTTCGATTGTATAACCATCATTATTG
V461I–BF:AATAATGATGGTTATACAATCGAAAGAGAAATTCATGGAC
M538A-AR:TCAGCAAATAGTTTGCCCGCTTTTTTCAGTACTTTTGGTG
M538A-BF:CCAAAAGTACTGAAAAAAGCGGGCAAACTATTTGCTGA
F542W-AR:GATTTATTTTGTTCAGCCCATAGTTTGCCCATTTTTTTC
F542W-BF:GAAAAAAATGGGCAAACTATGGGCTGAACAAAATAAATC。
By the way, four phenylpyruvate decarboxylase mutants are obtained and named as V461I (shown in SEQ ID NO. 1), M538A (shown in SEQ ID NO. 2) and F542W (shown in SEQ ID NO. 3).
Example 4:
preparation and enzyme activity determination of the phenylpyruvate decarboxylase mutant strain:
the correctly sequenced mutant plasmids from example 3 were each transformed into Bacillus licheniformis DW 2. Selecting transformants, verifying the transformants to be correct, inoculating the transformants into an LB culture medium, and culturing for 14h at 37 ℃; transferring into a fermentation medium with the inoculum size of 3%, and culturing at 37 deg.C for 24 h. The enzyme activity of the recombinant strain was examined according to the method in example 3;
the experimental result shows that compared with the WT strain, the enzyme activity is improved, and the enzyme activities (enzyme concentrations) of WT, V461I, M538A and F542W are 290.05U/mL, 2028.51U/mL, 1408.99U/mL and 1195.18U/mL respectively (figure 2), wherein V461I, M538A and F542W are 6.99 times, 4.86 times and 4.12 times of the enzyme activity of the WT strain.
Example 5:
analysis of fermentation products
The recombinant strains obtained in examples 2 and 4 were inoculated into LB medium and cultured at 37 ℃ for 14 hours; transferring the strain into a fermentation medium with the inoculum size of 3%, culturing at 37 ℃ for 72h, collecting fermentation liquor, and analyzing the fermentation product by using a gas chromatograph.
The fermentation product determination method comprises the following steps: centrifuging the fermentation liquor at 12000rpm for 10min to obtain 400 mu L of fermentation supernatant; adding 1.2mL ethyl acetate containing 1g/L internal standard for extraction, oscillating and mixing uniformly for 5min, and centrifuging at 10000rpm for 2 min; taking 800 μ L of the upper organic phase, mixing in a centrifuge tube containing 0.2g anhydrous sodium sulfate, standing at room temperature for 30 min; the supernatant was centrifuged and the concentration of the fermentation product was measured by gas chromatography. The fermentation product is measured by Agilent 7890B gas chromatograph (equipped with FID detector), the sample volume is 1 μ L, no shunt sample injection is carried out, and the carrier gas is hydrogen (1 ml/min). The column temperature procedure was: equilibrating at 50 deg.C for 2min, heating to 160 deg.C at 10 deg.C/min, heating to 220 deg.C at 20 deg.C/min, and holding for 3 min.
As shown in FIG. 1, the recombinant Bacillus licheniformis DW2 strain containing the phenylpyruvate decarboxylase mutant of the invention can produce phenylethanol with high yield, wherein the phenylethanol yield of the V461I, M538A and F542W mutants is 490.62, 318.23 and 243.08mg/L respectively, which are 6.45, 4.18 and 3.19 times of that of the WT strain 76.04 mg/L.
Example 6:
comparative example:
pHY-P43-kivD was used as a template, and the method of example 3 was used to mutate phenylalanine 382 to leucine and valine 461 to aspartic acid, respectively, in phenylpyruvic acid decarboxylase; the mutant primers were as follows.
The finally obtained phenylpyruvate decarboxylase mutants are named F382L (SEQ ID NO.4) and V461D (SEQ ID NO.5), respectively.
The transformants were sequenced by Biotechnology engineering (Shanghai) Co., Ltd and named pHY-F382L and pHY-V461H, and Bacillus licheniformis DW2 was transformed, respectively. The enzyme activity of the F382L mutant strain was reduced to 230.26U/mL compared with that of the WT strain, while the V461D mutant strain had almost no detectable enzyme activity (FIG. 2).
F382L-AR:AAAATTGATGAAGCGCCAAGGAATGATGTCCCTTGTTCA
F382L-BF:TGAACAAGGGACATCATTCCTTGGCGCTTCATCAATTTTC
V461D-AR:TCCATGAATTTCTCTTTCATCTGTATAACCATCATTATTGA
V461D-BF:CAATAATGATGGTTATACAGATGAAAGAGAAATTCATGGA。
Sequence listing
<110> Hubei university
Application of <120> phenylpyruvate decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation
<160> 23
<170> SIPOSequenceListing 1.0
<210> 1
<211> 548
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 1
Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly
1 5 10 15
Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu
20 25 30
Asp Gln Ile Ile Ser Arg Lys Asp Met Lys Trp Val Gly Asn Ala Asn
35 40 45
Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys
50 55 60
Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val
65 70 75 80
Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile
85 90 95
Val Gly Ser Pro Thr Ser Lys Val Gln Asn Glu Gly Lys Phe Val His
100 105 110
His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu
115 120 125
Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val
130 135 140
Glu Ile Asp Arg Val Leu Ser Ala Leu Leu Lys Glu Arg Lys Pro Val
145 150 155 160
Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro
165 170 175
Ser Leu Pro Leu Lys Lys Glu Asn Ser Thr Ser Asn Thr Ser Asp Gln
180 185 190
Glu Ile Leu Asn Lys Ile Gln Glu Ser Leu Lys Asn Ala Lys Lys Pro
195 200 205
Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Lys Thr
210 215 220
Val Ser Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn
225 230 235 240
Phe Gly Lys Ser Ser Val Asp Glu Ala Leu Pro Ser Phe Leu Gly Ile
245 250 255
Tyr Asn Gly Lys Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser
260 265 270
Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr
275 280 285
Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn
290 295 300
Ile Asp Glu Gly Lys Ile Phe Asn Glu Ser Ile Gln Asn Phe Asp Phe
305 310 315 320
Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Glu Ile Glu Tyr Lys
325 330 335
Gly Lys Tyr Ile Asp Lys Lys Gln Glu Asp Phe Val Pro Ser Asn Ala
340 345 350
Leu Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Asn Leu Thr Gln
355 360 365
Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala
370 375 380
Ser Ser Ile Phe Leu Lys Pro Lys Ser His Phe Ile Gly Gln Pro Leu
385 390 395 400
Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile
405 410 415
Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu
420 425 430
Gln Leu Thr Val Gln Glu Leu Gly Leu Ala Ile Arg Glu Lys Ile Asn
435 440 445
Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Ile Glu Arg Glu
450 455 460
Ile His Gly Pro Asn Gln Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr
465 470 475 480
Ser Lys Leu Pro Glu Ser Phe Gly Ala Thr Glu Glu Arg Val Val Ser
485 490 495
Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala
500 505 510
Gln Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Leu Ile Leu Ala Lys
515 520 525
Glu Asp Ala Pro Lys Val Leu Lys Lys Met Gly Lys Leu Phe Ala Glu
530 535 540
Gln Asn Lys Ser
545
<210> 2
<211> 548
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 2
Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly
1 5 10 15
Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu
20 25 30
Asp Gln Ile Ile Ser Arg Lys Asp Met Lys Trp Val Gly Asn Ala Asn
35 40 45
Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys
50 55 60
Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val
65 70 75 80
Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile
85 90 95
Val Gly Ser Pro Thr Ser Lys Val Gln Asn Glu Gly Lys Phe Val His
100 105 110
His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu
115 120 125
Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val
130 135 140
Glu Ile Asp Arg Val Leu Ser Ala Leu Leu Lys Glu Arg Lys Pro Val
145 150 155 160
Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro
165 170 175
Ser Leu Pro Leu Lys Lys Glu Asn Ser Thr Ser Asn Thr Ser Asp Gln
180 185 190
Glu Ile Leu Asn Lys Ile Gln Glu Ser Leu Lys Asn Ala Lys Lys Pro
195 200 205
Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Lys Thr
210 215 220
Val Ser Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn
225 230 235 240
Phe Gly Lys Ser Ser Val Asp Glu Ala Leu Pro Ser Phe Leu Gly Ile
245 250 255
Tyr Asn Gly Lys Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser
260 265 270
Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr
275 280 285
Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn
290 295 300
Ile Asp Glu Gly Lys Ile Phe Asn Glu Ser Ile Gln Asn Phe Asp Phe
305 310 315 320
Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Glu Ile Glu Tyr Lys
325 330 335
Gly Lys Tyr Ile Asp Lys Lys Gln Glu Asp Phe Val Pro Ser Asn Ala
340 345 350
Leu Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Asn Leu Thr Gln
355 360 365
Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala
370 375 380
Ser Ser Ile Phe Leu Lys Pro Lys Ser His Phe Ile Gly Gln Pro Leu
385 390 395 400
Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile
405 410 415
Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu
420 425 430
Gln Leu Thr Val Gln Glu Leu Gly Leu Ala Ile Arg Glu Lys Ile Asn
435 440 445
Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu
450 455 460
Ile His Gly Pro Asn Gln Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr
465 470 475 480
Ser Lys Leu Pro Glu Ser Phe Gly Ala Thr Glu Glu Arg Val Val Ser
485 490 495
Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala
500 505 510
Gln Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Leu Ile Leu Ala Lys
515 520 525
Glu Asp Ala Pro Lys Val Leu Lys Lys Ala Gly Lys Leu Phe Ala Glu
530 535 540
Gln Asn Lys Ser
545
<210> 3
<211> 548
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 3
Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly
1 5 10 15
Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu
20 25 30
Asp Gln Ile Ile Ser Arg Lys Asp Met Lys Trp Val Gly Asn Ala Asn
35 40 45
Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys
50 55 60
Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val
65 70 75 80
Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile
85 90 95
Val Gly Ser Pro Thr Ser Lys Val Gln Asn Glu Gly Lys Phe Val His
100 105 110
His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu
115 120 125
Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val
130 135 140
Glu Ile Asp Arg Val Leu Ser Ala Leu Leu Lys Glu Arg Lys Pro Val
145 150 155 160
Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro
165 170 175
Ser Leu Pro Leu Lys Lys Glu Asn Ser Thr Ser Asn Thr Ser Asp Gln
180 185 190
Glu Ile Leu Asn Lys Ile Gln Glu Ser Leu Lys Asn Ala Lys Lys Pro
195 200 205
Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Lys Thr
210 215 220
Val Ser Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn
225 230 235 240
Phe Gly Lys Ser Ser Val Asp Glu Ala Leu Pro Ser Phe Leu Gly Ile
245 250 255
Tyr Asn Gly Lys Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser
260 265 270
Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr
275 280 285
Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn
290 295 300
Ile Asp Glu Gly Lys Ile Phe Asn Glu Ser Ile Gln Asn Phe Asp Phe
305 310 315 320
Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Glu Ile Glu Tyr Lys
325 330 335
Gly Lys Tyr Ile Asp Lys Lys Gln Glu Asp Phe Val Pro Ser Asn Ala
340 345 350
Leu Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Asn Leu Thr Gln
355 360 365
Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala
370 375 380
Ser Ser Ile Phe Leu Lys Pro Lys Ser His Phe Ile Gly Gln Pro Leu
385 390 395 400
Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile
405 410 415
Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu
420 425 430
Gln Leu Thr Val Gln Glu Leu Gly Leu Ala Ile Arg Glu Lys Ile Asn
435 440 445
Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu
450 455 460
Ile His Gly Pro Asn Gln Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr
465 470 475 480
Ser Lys Leu Pro Glu Ser Phe Gly Ala Thr Glu Glu Arg Val Val Ser
485 490 495
Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala
500 505 510
Gln Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Leu Ile Leu Ala Lys
515 520 525
Glu Asp Ala Pro Lys Val Leu Lys Lys Met Gly Lys Leu Trp Ala Glu
530 535 540
Gln Asn Lys Ser
545
<210> 4
<211> 548
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 4
Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly
1 5 10 15
Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu
20 25 30
Asp Gln Ile Ile Ser Arg Lys Asp Met Lys Trp Val Gly Asn Ala Asn
35 40 45
Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys
50 55 60
Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val
65 70 75 80
Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile
85 90 95
Val Gly Ser Pro Thr Ser Lys Val Gln Asn Glu Gly Lys Phe Val His
100 105 110
His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu
115 120 125
Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val
130 135 140
Glu Ile Asp Arg Val Leu Ser Ala Leu Leu Lys Glu Arg Lys Pro Val
145 150 155 160
Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro
165 170 175
Ser Leu Pro Leu Lys Lys Glu Asn Ser Thr Ser Asn Thr Ser Asp Gln
180 185 190
Glu Ile Leu Asn Lys Ile Gln Glu Ser Leu Lys Asn Ala Lys Lys Pro
195 200 205
Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Lys Thr
210 215 220
Val Ser Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn
225 230 235 240
Phe Gly Lys Ser Ser Val Asp Glu Ala Leu Pro Ser Phe Leu Gly Ile
245 250 255
Tyr Asn Gly Lys Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser
260 265 270
Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr
275 280 285
Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn
290 295 300
Ile Asp Glu Gly Lys Ile Phe Asn Glu Ser Ile Gln Asn Phe Asp Phe
305 310 315 320
Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Glu Ile Glu Tyr Lys
325 330 335
Gly Lys Tyr Ile Asp Lys Lys Gln Glu Asp Phe Val Pro Ser Asn Ala
340 345 350
Leu Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Asn Leu Thr Gln
355 360 365
Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Leu Gly Ala
370 375 380
Ser Ser Ile Phe Leu Lys Pro Lys Ser His Phe Ile Gly Gln Pro Leu
385 390 395 400
Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile
405 410 415
Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu
420 425 430
Gln Leu Thr Val Gln Glu Leu Gly Leu Ala Ile Arg Glu Lys Ile Asn
435 440 445
Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu
450 455 460
Ile His Gly Pro Asn Gln Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr
465 470 475 480
Ser Lys Leu Pro Glu Ser Phe Gly Ala Thr Glu Glu Arg Val Val Ser
485 490 495
Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala
500 505 510
Gln Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Leu Ile Leu Ala Lys
515 520 525
Glu Asp Ala Pro Lys Val Leu Lys Lys Met Gly Lys Leu Phe Ala Glu
530 535 540
Gln Asn Lys Ser
545
<210> 5
<211> 548
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 5
Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly
1 5 10 15
Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu
20 25 30
Asp Gln Ile Ile Ser Arg Lys Asp Met Lys Trp Val Gly Asn Ala Asn
35 40 45
Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys
50 55 60
Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val
65 70 75 80
Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile
85 90 95
Val Gly Ser Pro Thr Ser Lys Val Gln Asn Glu Gly Lys Phe Val His
100 105 110
His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu
115 120 125
Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val
130 135 140
Glu Ile Asp Arg Val Leu Ser Ala Leu Leu Lys Glu Arg Lys Pro Val
145 150 155 160
Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro
165 170 175
Ser Leu Pro Leu Lys Lys Glu Asn Ser Thr Ser Asn Thr Ser Asp Gln
180 185 190
Glu Ile Leu Asn Lys Ile Gln Glu Ser Leu Lys Asn Ala Lys Lys Pro
195 200 205
Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Lys Thr
210 215 220
Val Ser Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn
225 230 235 240
Phe Gly Lys Ser Ser Val Asp Glu Ala Leu Pro Ser Phe Leu Gly Ile
245 250 255
Tyr Asn Gly Lys Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser
260 265 270
Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr
275 280 285
Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn
290 295 300
Ile Asp Glu Gly Lys Ile Phe Asn Glu Ser Ile Gln Asn Phe Asp Phe
305 310 315 320
Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Glu Ile Glu Tyr Lys
325 330 335
Gly Lys Tyr Ile Asp Lys Lys Gln Glu Asp Phe Val Pro Ser Asn Ala
340 345 350
Leu Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Asn Leu Thr Gln
355 360 365
Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala
370 375 380
Ser Ser Ile Phe Leu Lys Pro Lys Ser His Phe Ile Gly Gln Pro Leu
385 390 395 400
Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile
405 410 415
Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu
420 425 430
Gln Leu Thr Val Gln Glu Leu Gly Leu Ala Ile Arg Glu Lys Ile Asn
435 440 445
Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Asp Glu Arg Glu
450 455 460
Ile His Gly Pro Asn Gln Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr
465 470 475 480
Ser Lys Leu Pro Glu Ser Phe Gly Ala Thr Glu Glu Arg Val Val Ser
485 490 495
Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala
500 505 510
Gln Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Leu Ile Leu Ala Lys
515 520 525
Glu Asp Ala Pro Lys Val Leu Lys Lys Met Gly Lys Leu Phe Ala Glu
530 535 540
Gln Asn Lys Ser
545
<210> 6
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tttttataac aggaattctg ataggtggta tgttttcg 38
<210> 7
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
taatctccta ctgtatacat tgatccttcc tcctttaga 39
<210> 8
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ctaaaggagg aaggatcaat gtatacagta ggagatta 38
<210> 9
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
tccgtcctct ctgctctttt atgatttatt ttgttcag 38
<210> 10
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
ctgaacaaaa taaatcataa aagagcagag aggacggatt 40
<210> 11
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
aagcttctag aagcttctag cgcaataatg ccgtcgcact 40
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
gaattcctgt tataaaaaaa ggatc 25
<210> 13
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
tctagaagct tgggcaaagc gtttt 25
<210> 14
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
gtccatgaat ttctctttcg attgtataac catcattatt g 41
<210> 15
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
aataatgatg gttatacaat cgaaagagaa attcatggac 40
<210> 16
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
tcagcaaata gtttgcccgc ttttttcagt acttttggtg 40
<210> 17
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
ccaaaagtac tgaaaaaagc gggcaaacta tttgctga 38
<210> 18
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
gatttatttt gttcagccca tagtttgccc atttttttc 39
<210> 19
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
gaaaaaaatg ggcaaactat gggctgaaca aaataaatc 39
<210> 20
<211> 39
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
aaaattgatg aagcgccaag gaatgatgtc ccttgttca 39
<210> 21
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
tgaacaaggg acatcattcc ttggcgcttc atcaattttc 40
<210> 22
<211> 41
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
tccatgaatt tctctttcat ctgtataacc atcattattg a 41
<210> 23
<211> 40
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
caataatgat ggttatacag atgaaagaga aattcatgga 40

Claims (1)

1. Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol by biological fermentationThe amino acid sequence of the mutant F542W is shown in SEQ ID NO.3, and the biological fermentation is by using Bacillus licheniformis (Bacillus licheniformis)Bacillus licheniformis) DW2 fermentation.
CN201910688020.5A 2019-07-29 2019-07-29 Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation Active CN110295204B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910688020.5A CN110295204B (en) 2019-07-29 2019-07-29 Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910688020.5A CN110295204B (en) 2019-07-29 2019-07-29 Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation

Publications (2)

Publication Number Publication Date
CN110295204A CN110295204A (en) 2019-10-01
CN110295204B true CN110295204B (en) 2022-08-23

Family

ID=68032104

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910688020.5A Active CN110295204B (en) 2019-07-29 2019-07-29 Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation

Country Status (1)

Country Link
CN (1) CN110295204B (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150259710A1 (en) * 2011-07-28 2015-09-17 Gevo, Inc. Decarboxylase proteins with high keto-isovalerate decarboxylase activity
CN106754766A (en) * 2016-12-14 2017-05-31 曹书华 A kind of pyruvate carboxylase and its application
CN107312766B (en) * 2017-08-07 2020-02-18 上海凌凯医药科技有限公司 Pyruvate decarboxylase mutant with improved enzyme activity
CN109609396B (en) * 2018-12-29 2020-11-13 波顿（上海）生物技术有限公司 Genetically engineered bacterium and construction method and application thereof

Also Published As

Publication number Publication date
CN110295204A (en) 2019-10-01

Similar Documents

Publication Publication Date Title
CN111269900B (en) Preparation and application of L-amino acid deaminase mutant
CN109609478B (en) α -transaminase and mutant thereof and application thereof in asymmetric synthesis of L-glufosinate-ammonium
CN110331173B (en) Application of phenylpyruvic acid decarboxylase mutant M538A in production of phenethyl alcohol through biological fermentation
CN109609477B (en) Alpha-transaminase mutant and application thereof in asymmetric synthesis of L-glufosinate-ammonium
CN111690624A (en) Method for synthesizing 2-O-alpha-D-glycerol glucoside by using microorganisms
CN111518783A (en) Novel recombinant (R) -omega-transaminase, mutant and application thereof in preparation of sitagliptin
CN105462949A (en) Glutamic acid decarboxylase mutant and preparation method thereof and application
CN109055324B (en) Improved ketoreductase and application thereof
CN112831488B (en) Glutamic acid decarboxylase and gamma-aminobutyric acid high-yield strain
CN103695443B (en) A kind of Novel carbonyl reductase, its gene and application
CN111808829B (en) Gamma-glutamyl methylamine synthetase mutant and application thereof
CN110295204B (en) Application of phenylpyruvic acid decarboxylase mutant F542W in production of phenethyl alcohol through biological fermentation
CN110438055B (en) Whole-cell catalyst containing phenylpyruvate decarboxylase mutant and application of whole-cell catalyst in production of phenethyl alcohol
CN114350631B (en) Glufosinate dehydrogenase mutant, engineering bacteria, immobilized cells and application
CN113621592B (en) Transaminase mutant and coding gene and application thereof
CN108004225A (en) A kind of mutant of the Phenylalanine aminomutase in pantoea agglomerans source
CN113061593B (en) L-malate dehydrogenase mutant and application thereof
CN110846288B (en) Glutathione bifunctional enzyme mutant and application thereof
CN109609476B (en) α -transaminase and mutant and application thereof in asymmetric synthesis of L-glufosinate-ammonium
CN113355366A (en) Method for preparing 2-phenethyl alcohol by multi-enzyme cascade
CN114410599B (en) Carbonyl reductase mutant and application thereof in preparation of rosuvastatin chiral intermediate
CN113444702B (en) Enone reductase mutant and application thereof
CN114891820B (en) Bacillus licheniformis for efficiently synthesizing hydroxytyrosol, construction method and application
CN113512571B (en) Method for synthesizing L-pipecolic acid by ornithine cyclodeaminase catalysis
CN110904086B (en) Tryptophanase mutant and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant