CN114350631B - Glufosinate dehydrogenase mutant, engineering bacteria, immobilized cells and application - Google Patents

Abstract

The invention discloses a glufosinate dehydrogenase mutant, engineering bacteria, immobilized cells and application, wherein the mutant is obtained by single mutation or multiple mutation of 145 th, 384 th, 348 th, 292 nd, 202 nd, 70 th and 78 th of an amino acid sequence of the glufosinate dehydrogenase shown in SEQ ID No. 2. According to the immobilized cell of the co-expression engineering bacterium of the glufosinate dehydrogenase mutant and the formate dehydrogenase, the 2-carbonyl-4- (hydroxymethyl phosphono) -butyric acid substrate is catalyzed and reduced to be L-glufosinate, so that the L-glufosinate is asymmetrically synthesized, expensive chemical resolution reagents are not needed, the thermal stability and the operation stability of the immobilized cell are improved, and the immobilized cell is reused. The immobilized cell enzyme activity is 162.5U/g, the enzyme activity recovery rate is 78.1%, the immobilized cell enzyme can be recovered through filtration, and the immobilized cell enzyme can be reused for more than 20 batches to maintain 100% conversion rate, so that the production cost is greatly reduced.

Description

Glufosinate dehydrogenase mutant, engineering bacteria, immobilized cells and application

Field of the art

The invention relates to an NADH dependent glufosinate dehydrogenase mutant, engineering bacteria, immobilized cells and application thereof.

(II) background art

Glufosinate (also known as PPT), which is a 2-amino-4- [ hydroxy (methyl) phosphono ] -butyric acid, is the second largest transgenic crop tolerant herbicide in the world, developed and produced by the company helter (several co-mingled and now belonging to bayer), is also known as glufosinate ammonium, basta, buster, etc., and belongs to the class of phosphonic herbicides, and the non-selective (biocidal) contact herbicide is a glutamine synthetase inhibitor.

There are two optical isomers of glufosinate, L-glufosinate and D-glufosinate. However, only the L-type has physiological activity, is easy to decompose in soil, has small toxicity to human beings and animals, has wide weeding spectrum and has small damage to the environment.

Currently, glufosinate is commercially available as a racemic mixture. If the glufosinate-ammonium product can be used in the form of pure optical isomer with L-configuration, the use amount of the glufosinate-ammonium can be obviously reduced, which has important significance for improving the atom economy, reducing the use cost and relieving the environmental pressure.

The preparation method of chiral pure L-glufosinate mainly comprises three steps: chiral resolution, chemical synthesis and biocatalysis. The biocatalytic method for producing glufosinate has the advantages of strict stereoselectivity, mild reaction condition, high yield and the like, and is an advantageous method for producing L-glufosinate. Mainly comprises the following three types:

1) The L-glufosinate derivative is used as a substrate, and is obtained by direct enzymatic hydrolysis, so that the method has the advantages of high conversion rate, higher e.e. value of the product, high cost and no contribution to industrial production, and expensive and difficult-to-obtain chiral raw materials are required as precursors. For example, the simplest method for preparing L-glufosinate by biological methods is to hydrolyze bialaphos directly using proteases. Bialaphos is a natural tripeptide compound, and under the catalysis of protease, 2 molecules of L-alanine are removed from the bialaphos to generate L-glufosinate.

2) The method takes a precursor of racemic glufosinate-ammonium as a substrate and is obtained through selective resolution of enzyme. The main advantages are relatively easy obtaining of raw materials and high activity of catalyst, but its theoretical yield can only reach 50%, which can result in waste of raw materials. For example, cao et al (Cao C-H, cheng F, xue Y-P, zheng Y-G (2020) Efficient synthPseis of L-phosphinothricin using a novel aminoacylase mined from Stenotrophomonas maltophila. Enzyme and Microbial Technology 135doi:10.1016/j. Enzmictec. 2019.109493) chiral split N-acetyl-PPT using a novel aminoacylase derived from Stenotrophomonas maltophilia to give L-glufosinate. Catalysis with whole cells gave an optically pure L-PPT (> 99.9% e.e.) with a conversion of >49% in 4 hours.

3) 2-carbonyl-4- (hydroxy methyl phosphonic group) -butyric acid (PPO) is taken as a substrate, and is introduced intoThe enzymes involved mainly are aminotransferase and glufosinate dehydrogenase, obtained by asymmetric synthesis of the perases. Bartsch (Bartsch K (2005) ProcPsPse for the preparation of L-phosphinothrcine by enzymatic transamination with aspartate. US Patent No. US6936444B 1) and the like utilize PPO as a substrate, L-aspartic acid as an amino donor, and transaminases which are screened and separated from soil microorganisms and have specific enzyme activities on PPO and L-aspartic acid are used for catalysis, when the substrate concentration is 552mM, the reaction is carried out for 4 hours at a very high temperature (80 ℃), the conversion rate still reaches 52 percent, and the space-time yield is 4.5g L-PPT/g.L ^-1 ·d ^-1 . However, the preparation of L-glufosinate-ammonium by using aminotransferase has two defects, namely that the reaction is a reversible reaction, the raw material PPO cannot be completely converted into L-PPT, and the conversion rate cannot reach 100%; secondly, in order to carry out the reversible reaction in the direction of L-PPT production, at least 2 times of L-aspartic acid needs to be added as an amino donor, and the excess aspartic acid brings great trouble to the separation of L-PPT.

The chiral resolution method is used for obtaining the L-glufosinate-ammonium, and the theoretical highest yield is only 50%; the asymmetric synthesis of L-glufosinate by chemical methods can break through the limitation, however, the reported chemical synthesis methods have generally poor efficiency and low stereoselectivity. The chiral center is constructed by the ketocarbonyl of the asymmetric ammonio acid intermediate in the enzymatic asymmetric synthesis of the L-glufosinate, and the route is suitable for industrial development and production of the L-glufosinate because the raw materials are low in cost and easy to obtain and the use of extremely toxic cyanide can be avoided. Traditional enzymatic synthesis methods rely on expensive NADP as a coenzyme, which is costly.

Amino acid dehydrogenases (EC 1.4.1.X, AADH) are a class of amino acid dehydrogenases capable of reversibly deaminating an amino acid to the corresponding keto acid, which require nucleoside coenzymes (NAD ⁺ ) Is widely applied to the synthesis of natural and unnatural alphA-Amino acids. Substrate specificity is classified into glutamate dehydrogenase, leucine dehydrogenase, alanine dehydrogenase, valine dehydrogenase, and the like. If it exhibits some activity on a glufosinate precursor, it may be referred to as "glufosinate dehydrogenase (PPTDH)".

Formate dehydrogenase (EC 1.1.1.47, FDH) is an important auxiliary enzyme for biocatalysis, for the regeneration cycle of the coenzyme NADH in redox catalytic reactions.

The enzyme activity of the NADPH-dependent glufosinate dehydrogenase is obviously higher than that of the NADH-dependent glufosinate dehydrogenase (more than 50 times), and the price of NADPH is 5 times that of NADH, so that the development of the NADH-dependent high-activity glufosinate dehydrogenase has good application prospect. Because the glufosinate dehydrogenase has poor thermal stability, the reaction rate is reduced due to easy inactivation in practical application, and the stability of the enzyme needs to be improved at the molecular level by a proper method; in addition, the glufosinate dehydrogenase expressed by the E.coli BL21 (DE 3) is an intracellular enzyme, so that the whole cells of the E.coli containing the glufosinate dehydrogenase can be immobilized by utilizing an immobilization cell technology, the thermal stability and the operation stability of the whole cells are further improved, the repeated use is realized, and the production cost is reduced.

(III) summary of the invention

The invention aims to solve the problems of low asymmetric amination and reduction activity and poor stability of the existing glufosinate dehydrogenase on 2-carbonyl-4- (hydroxymethyl phosphono) -butyric acid, provides an NADH dependent glufosinate dehydrogenase mutant, engineering bacteria, immobilized cells and application of the glufosinate dehydrogenase mutant and the engineering bacteria in chiral biosynthesis of L-glufosinate, and solves the problems of high cost and low catalytic efficiency in the preparation of L-glufosinate by asymmetric amination and reduction.

The technical scheme adopted by the invention is as follows:

the invention provides an NADH dependent glufosinate dehydrogenase mutant, which is obtained by single mutation or multiple mutation of 145 th, 384 th, 348 th, 292 nd, 202 rd, 70 th and 78 th of the amino acid sequence of the glufosinate dehydrogenase shown in SEQ ID No. 2. The coded gene KmGDH nucleotide sequence of the glufosinate dehydrogenase is shown as SEQ ID No. 1.

Preferably, the mutant is one in which the amino acid sequence shown in SEQ ID No.2 is mutated to one of the following: (1) Proline at position 145 is mutated to glycine (P145G), or serine at position 348 is mutated to alanine (S348A); (2) Proline at position 145 to glycine, valine at position 384 to phenylalanine and lysine at position 70 to alanine (P145G-V384F-K70A); (3) Proline at position 145 to glycine, valine at position 384 to glutamine and asparagine at position 78 to serine (P145G-V384Q-N78S); (4) Proline at position 145 is mutated to glycine, valine at position 384 is mutated to tyrosine, serine at position 348 is mutated to alanine, alanine at position 292 is mutated to cysteine and alanine at position 202 is mutated to leucine (P145G-V384Y-S348 A-A 292C-A202L).

The invention also relates to the coding gene of the NADH dependent glufosinate dehydrogenase mutant, a recombinant vector constructed by the coding gene, and recombinant genetic engineering bacteria prepared by co-expression and transformation of the recombinant vector and the formate dehydrogenase gene.

The recombinant vector of the invention takes plasmid pETDuet as a basic vector and is cloned to NcoI of MCS1 (multiple cloning site 1) of the plasmid pETDuet.

The recombinant genetically engineered bacterium takes E.coli BL21 (DE 3) as a host bacterium and is prepared according to the following steps: cloning a glufosinate dehydrogenase KmGDH mutant gene to NcoI of MCS1 (multiple cloning site 1) of a plasmid pETDuet, constructing a recombinant expression vector, and retaining His-Tag genes of the plasmid itself; and constructing a formate dehydrogenase gene PseFDH (the nucleotide sequence of which is shown as SEQ ID No. 3) on NdeI of MCS2 (multiple cloning site 2) of a recombinant expression vector through One Step Cloning Kit of Vazyme company to obtain a co-expression vector, and converting the co-expression vector into E.coli BL21 (DE 3) to obtain the recombinant genetically engineered bacterium in which the glufosinate dehydrogenase mutant and the formate dehydrogenase are co-expressed.

The invention also provides an application of the glufosinate dehydrogenase mutant in catalyzing 2-carbonyl-4- (hydroxymethyl phosphono) -butyric acid (PPO) to prepare L-glufosinate, wherein the application method comprises the following steps: immobilized cells prepared from wet thalli or wet thalli obtained by recombinant genetic engineering bacteria induced culture containing glufosinate dehydrogenase mutant genes and formate dehydrogenase genes are used as catalysts, 2-carbonyl-4- (hydroxymethylphosphonyl) -butyric acid is used as a substrate, ammonium formate is used as a coenzyme regeneration substrate, and NAD is exogenously added ⁺ The reaction system is constructed with a phosphate buffer of pH7.4, 100mM as the reaction medium at 20-50℃and preferably 35℃at 200-800 rpm (preferably 600rpm +.Minutes) carrying out conversion reaction, after the reaction is finished, carrying out suction filtration on the reaction solution, recovering a catalyst from a filter cake, and separating and purifying filtrate to obtain the L-glufosinate-ammonium. In the reaction system, the catalyst is used in an amount of 10-50g/L (preferably 10 g/L) based on the volume of the reaction medium, the final concentration of the substrate is 100-400mM (preferably 400 mM), the final concentration of the ammonium formate is 100-800mM (preferably 600 mM), and NAD is calculated ⁺ The final concentration is 0.05-2mM (preferably 0.1 mM).

The wet thalli are prepared according to the following method: recombinant genetically engineered bacteria containing glufosinate dehydrogenase mutant genes and formate dehydrogenase genes are inoculated into LB liquid medium containing 50 mug/mL of ampicillin at a final concentration, cultured for 8 hours at 37 ℃, inoculated into fresh LB liquid medium containing 50 mug/mL of ampicillin at a final concentration of 2% by volume, cultured for 2 hours at 37 ℃ at 180 rpm, and then added with 0.1mM IPTG at a final concentration of 0.1mM, cultured for 14 hours at 18 ℃, and centrifuged for 10 minutes at 8000 rpm at 4 ℃ to obtain corresponding wet bacterial cells.

The recombinant genetically engineered bacterium immobilized cell is prepared according to the following method: adding wet thalli obtained by fermenting and culturing the recombinant genetically engineered bacteria into a phosphate buffer solution (preferably a phosphate buffer solution with pH of 7.5) with pH of 6.0-8.0, adding a carrier, fully stirring for 20-30 min, adding polyethylenimine, fully stirring for 20-30 min, then adding a cross-linking agent, fully stirring for 20-30 min, carrying out vacuum filtration, and washing a filter cake with water to obtain the immobilized cells of the recombinant genetically engineered bacteria; the volume of the phosphate buffer is 5-20mL/g (preferably 10 mL/g) based on the weight of the wet bacteria; the carrier is activated carbon, diatomite, bentonite or montmorillonite (preferably diatomite), and the mass dosage of the carrier is 2-10 percent (preferably 2-3 percent) of the mass of the thalli; the molecular weight of the polyethyleneimine is 600-70000 (preferably 10000), and the dosage is 1-10 mL/100g (preferably 3mL/100 g) based on the mass of the thallus; the cross-linking agent is glutaraldehyde, glyoxal or dialdehyde starch, and the dosage is 1-10 mL/100g (preferably 3mL/100 g) based on the mass of the thallus.

Compared with the prior art, the invention has the beneficial effects that:

(1) The glufosinate dehydrogenase mutant with improved heat stability is obtained through screening, wherein the half-life of the mutant KmGDH-P145G-V384Y-S348A-A292C-A202L at 35 ℃ and 50 ℃ is respectively improved from 18.4h to 294.7h, 11.2h to 143.0h and 6.9h to 25.7h before mutation, and the heat stability is obviously improved. Meanwhile, when the glufosinate dehydrogenase mutant is used for preparing L-glufosinate by catalyzing and reducing 2-carbonyl-4- (hydroxymethyl phosphono) -butyric acid, NADH with low price is used as coenzyme to replace NADPH coenzyme with high price, so that the cost is obviously reduced.

(2) The glufosinate dehydrogenase mutant and formate dehydrogenase co-express the immobilized cells of the engineering bacteria, which are prepared by the method, further improve the thermal stability and the operation stability of the immobilized cells and realize the repeated use. The immobilized cell enzyme activity is 162.5U/g, the enzyme activity recovery rate is 78.1%, the immobilized cell enzyme can be recovered through filtration, and the immobilized cell enzyme can be reused for more than 20 batches to maintain 100% conversion rate, so that the production cost is greatly reduced.

(3) According to the invention, by utilizing the glufosinate dehydrogenase mutant and a coenzyme circulation system, 2-carbonyl-4- (hydroxy methyl phosphono) -butyric acid substrate is directly catalyzed and reduced into L-glufosinate, so that asymmetric synthesis of L-glufosinate is realized, expensive chemical resolution reagents are not needed, and glufosinate derivatives are not needed to be synthesized. Compared with a wild type female parent, the glufosinate dehydrogenase mutant has better catalytic efficiency and higher stability, the enzyme activity is improved to 3856%, the half life at 35 ℃ is prolonged to 294.7h from 18.4h, when the 2-carbonyl-4- (hydroxy methylphosphonyl) -butyric acid is used as a substrate for catalytic reaction, the conversion rate is far higher than that of the wild type enzyme, and the glufosinate yield is also greatly improved.

(IV) description of the drawings

FIG. 1 is a schematic illustration of the reaction of a glufosinate dehydrogenase mutant coupled with a formate dehydrogenase to produce L-glufosinate by asymmetric amination reduction of 2-carbonyl-4- (hydroxymethylphosphono) -butyric acid.

FIG. 2 is a double enzyme-coupled SDS-PAGE of KmGDH and PseFDH of example 2. Wherein lane M: standard protein molecular weight; lane 1: the cell of the strain is co-expressed by the parent glufosinate dehydrogenase and the formate dehydrogenase. Lane 2: glufosinate dehydrogenase female parent engineering bacteria cells.

FIG. 3 is a standard curve of 2-carbonyl-4- (hydroxymethylphosphinyl) -butyric acid in example 3.

FIG. 4 is a standard curve of L-glufosinate in example 3.

FIG. 5 is a half-life curve of the parent pure enzyme of glufosinate dehydrogenase at 35, 50, 65℃in example 7.

FIG. 6 is a half-life curve of the glufosinate dehydrogenase mutant KmGDH-P145G-V384Y-S348A-A292C-A202L pure enzyme at 35℃at 50℃at 65℃in example 7.

FIG. 7 is a graph showing the conversion rate of 400mM PPO catalyzed by engineering bacteria E.coli BL21 (DE 3) -KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH immobilized cells in example 9.

FIG. 8 is a bar graph showing the conversion rate of the reaction batches of engineering bacteria E.coli BL21 (DE 3) -KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH free cells and immobilized cells in example 9.

(fifth) detailed description of the invention

The invention will be further described with reference to the following specific examples, but the scope of the invention is not limited thereto:

in the following examples, diatomaceous earth has the formula SiO ₂ Molecular weight 60.08, median particle size 19.6 μm, available from alaa Ding Gongsi. Bentonite molecular formula is Al ₂ O ₃ ·4(SiO ₂ )·H ₂ O, molecular weight 360.31, purchased from ala Ding Gongsi. Activated carbon has a molecular formula of C and a molecular weight of 12.01 and is available from Aba Ding Gongsi. The montmorillonite component is Al ₂ O ₃ 16.54％、MgO ₄ 65％、SiO ₂ 50.95% from Ara Ding Gongsi. The polyethyleneimine molecular weights were 700, 1800, 10000, 70000, respectively, purchased from ala Ding Gongsi.

Example 1: construction and screening of glufosinate dehydrogenase mutant library

1. Glufosinate dehydrogenase female parent engineering bacteria

The wild type glufosinate dehydrogenase KmGDH nucleotide sequence (NCBI accession number WP_ 010290083.1) from Ma Saiku terylella (Kurthia massiliensis) is subjected to codon optimization, gene synthesis is carried out by the Qingzhou department biotechnology limited company, the obtained KmGDH gene (the nucleotide sequence is shown as SEQ ID No.1, the amino acid sequence of the coded protein is shown as SEQ ID No. 2) is cloned to NcoI of MCS1 (multiple cloning site 1) of plasmid pETDuet, a recombinant expression vector pETDuet-KmGDH is constructed, the His-Tag gene of the plasmid itself is reserved, and the recombinant expression vector is transformed into E.coli BL21 (DE 3) and sent to Hangzhou department biotechnology limited company to synthesize glufosinate dehydrogenase female engineering bacteria E.coli BL21 (DE 3)/pETDuet-KmGDH.

SEQ ID NO.1

atggcagaaaacctgaacttatttacgagcacccaggcgattattaaagaagcgctgcagaaactgggctacgatgaggcgatgtatgacttactgaaagaaccgctgcgtatgctgcaggttagaatcccggtccgtatggacgacggcaccgttaccgttttcacaggttatcgtgcccaacataatgatgcagttggcccgaccaagggtggcgtacgttttcatccgaatgttagtgaagaagaagttaaagcactgagcatgtggatgaccctgaaagcaggtattgttgatttaccatatgggggtggtaaaggcggcgtgatttgtgatcctcgtcagatgagcatgggtgaactggaaagattaagccgtggatatgttcgggcaacctcgcagattgttggtccgaccaaagatattccggcaccggatgtttttaccaatgcacaaattatggcatggatgatggatgaatatagccgtatggatgaatttaatagcccgggctttataacgggtaaacctattgtgttaggtggtagtcaggggcgtgatcgtgccacagcccagggcgtaacgattgttatagaacaggcagcaaaacggcggaatctgcaaatcgaaggtgcaagagtggtgattcagggatttggaaatgcaggtagctttctggctaaattcatgaatgatctgggcgcgaaagtggtgggtattagtgacgcaaatggcgcactgtacgatccggaaggactggatattgattatctgttagaccgtcgtgatagttttggtaccgttactaatctgtttgaaaataccattaccaacgaagaacttttagaattagagtgtgatatcctggttccggctgccattgaaaaccaaattacagcagaaaatgcacataatatcaaggccaacattgttgtggaagcagcaaacggaccgaccacccaggaagccacaaaaatactgaccgagcgtggagttctgctggtgccggacgttttagcaagcgcaggtggcgttacagtaagctactttgaatgggttcagaataatcagggctattactggagtgaagaagaggttaatgataaattatacaagaagatggtggaggcgtttgataatatttataatgtggcagaagcccgcaaaatagatatgagactggcggcatatatggtgggcgttagaaaaacagcagaagcaagccggtttagaggctgggtt。

SEQ ID NO.2

MAENLNLFTSTQAIIKEALQKLGYDEAMYDLLKEPLRMLQVRIPVRMDDGTVTVFTGYRAQHNDAVGPTKGGVRFHPNVSEEEVKALSMWMTLKAGIVDLPYGGGKGGVICDPRQMSMGELERLSRGYVRATSQIVGPTKDIPAPDVFTNAQIMAWMMDEYSRMDEFNSPGFITGKPIVLGGSQGRDRATAQGVTIVIEQAAKRRNLQIEGARVVIQGFGNAGSFLAKFMNDLGAKVVGISDANGALYDPEGLDIDYLLDRRDSFGTVTNLFENTITNEELLELECDILVPAAIENQITAENAHNIKANIVVEAANGPTTQEATKILTERGVLLVPDVLASAGGVTVSYFEWVQNNQGYYWSEEEVNDKLYKKMVEAFDNIYNVAEARKIDMRLAAYMVGVRKTAEASRFRGWV。

2. Starting co-expression strains

Then synthesizing a formate dehydrogenase gene PseFDH (PDB accession number is shown as 2GUG_A, the nucleotide sequence is shown as SEQ ID No. 3) derived from Pseudomonas aeruginosa (Pseudomonas sp.), constructing on an NdeI of MCS2 (multiple cloning site 2) of a recombinant expression vector pETDuet-KmGDH through One Step Cloning Kit of Vazyme company to obtain a co-expression vector pETDuet-KmGDH-PseFDH, converting to E.coli BL21 (DE 3), and obtaining a co-expression strain E.coli BL21 (DE 3)/pETDuet-KmGDH-PseFDH starting from the glufosinate dehydrogenase parent and the formate dehydrogenase.

SEQ ID NO.3

atggccaaagttctgtgtgtactgtatgacgacccggttgatggttaccctaaaacttacgcacgtgacgatctgccgaaaatcgaccactacccgggcggccagaccctgccgacgccgaaagcgatcgatttcactccgggccaactgctgggttctgtttctggtgaactgggcctgcgtaaatatctggaatccaacggccacaccctggtggtgaccagcgacaaagatggtccggactccgtgttcgaacgtgaactggttgatgctgacgttgtcattagccagccgttctggccggcgtatctgaccccggaacgcatcgccaaagctaaaaacctgaaactggcactgaccgcaggtattggttctgaccacgttgatctgcagtccgccatcgatcgtaacgttaccgttgccgaagtaacctactgtaactctatctccgtggctgaacatgtggttatgatgatcctgtctctggttcgcaactatctgccgtctcatgaatgggcgcgtaaaggcggctggaacatcgctgattgtgtcagccatgcgtatgacctggaagcaatgcatgtgggcactgttgcagctggtcgcatcggcctggctgtcctgcgtcgcctggcaccattcgacgtacacctgcactacactgaccgtcaccgtctgccagaaagcgtggagaaagaactgaacctgacctggcatgctactcgcgaagacatgtacccggtgtgcgacgttgttaccctgaactgtccactgcacccggagaccgaacacatgattaacgatgaaaccctgaagctgttcaaacgtggcgcgtacatcgtaaacacggctcgtggtaagctgtgcgatcgtgacgctgtggcacgtgcgctggaatctggtcgcctggccggttacgctggtgatgtatggtttccacagccggctccgaaagaccacccgtggcgcaccatgccttacaatggtatgaccccgcacatttctggtaccactctgaccgcacaggcgcgttacgcagcgggtacccgtgaaattctggagtgcttctttgaaggtcgcccgatccgtgatgaatacctgatcgttcagggtggtgcgctggctggcactggtgctcattcctactctaaaggtaacgcgaccggtggttctgaagaggcggcgaaattcaaaaaggccgtt。

3. Library of glufosinate dehydrogenase mutants

The preparation of the glufosinate dehydrogenase mutant library is realized through 7 rounds of site-directed saturation mutation, and the primer design is shown in table 1, and the specific operation is as follows:

(1) Carrying out PCR site-directed saturation mutation by taking a vector pETDuet-KmGDH-PseFDH as a template and a sequence (P145) in table 1 as a primer, carrying out positive verification of DNA agarose gel electrophoresis on a PCR result, adding DpnI enzyme into a positive PCR product for digestion of the template, reacting at 37 ℃ for 1 hour at 220 r/min, and inactivating at 65 ℃ for 1 min to obtain a digested PCR product. The digested PCR product is transformed into E.coli BL21 (DE 3) competent cells by heat shock, the competent cells are placed at 37 ℃ and activated for 1 hour at 220 r/min, the culture is coated on LB plates containing 50 mug/mL of ampicillin resistance, and the culture is inverted and cultured overnight at 37 ℃ to obtain positive clones of saturation mutation of P145 site (mutation of 145 th amino acid sequence shown in SEQ ID No.2 into other 19 amino acids).

(2) The primers in the step (1) are respectively replaced by those shown in table 1, the step (1) is repeated to carry out site-directed saturation mutation, and the following clones are respectively obtained: mutants S348 (serine at position 348 of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), V384 (valine at position 384 of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), K70 (lysine at position 70 of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), A292 (alanine at position 292 of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), A202 (alanine at position 202 of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), N78 (asparagine at position 78 of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), Q134 (glutamine at position 134 of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), D146 (aspartic acid at position 146 of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), R74 (arginine at position 74 of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), K106 (amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids).

(3) Multiple mutations

And (3) continuing to carry out second round, third round and fourth round site-directed saturation mutation by using the single mutant plasmid obtained in the step (2) as a template and using other primers shown in the table 1 to obtain a mutation library. Specifically, taking the P145 mutant as a template, and carrying out second-round mutation by using an S348 primer to obtain a double-site saturated mutation of P145-S348; taking the P145 mutant as a template, carrying out second-round mutation by using a V384 primer, and carrying out third-round mutation by using a K70 primer to obtain a saturated mutation of three sites of P145-V384-K70; taking the P145 mutant as a template, carrying out second-round mutation by using a V384 primer, and carrying out third-round mutation by using an N78 primer to obtain a saturated mutation of three sites P145-V384-N70; taking the P145 mutant as a template, carrying out second-round mutation by using a V384 primer, carrying out third-round mutation by using a K70 primer, and carrying out fourth-round mutation by using an A292 primer to obtain four-site saturation mutation of P145-V384-K70-A292; taking the P145 mutant as a template, carrying out second-round mutation by using a V384 primer, carrying out third-round mutation by using an S348 primer, carrying out fourth-round mutation by using an A292 primer, and carrying out fifth-round mutation by using an A202 primer to obtain the saturation mutation of five sites of P145-V384-S348-A292-A202.

The mutant PCR system (100. Mu.L) was: 2 times of Phanta Max buffer 25. Mu.L, dNTPs 1. Mu.L, mutation upper and lower primers 1. Mu.L each, template 1. Mu.L, phanta Super-Fidelity DNA polymerase 0.5. Mu.L, and ddH ₂ O to 50. Mu.L. The PCR conditions were: pre-denatured at 95 ℃ for 5min, over 30 cycles: 90℃for 30 seconds, 62℃for 30 seconds, 72℃for 7 minutes, and finally 72℃for 5 minutes.

Inducing the mutant co-expression strains constructed in the steps (1), (2) and (3) to express according to the method of the embodiment 2, screening dominant mutants according to the method of the embodiment 3, and sending the obtained dominant strains to the Hangzhou qing department biotechnology limited company for sequencing and confirmation, and storing.

TABLE 1 design of primers for site-directed saturation mutagenesis of glufosinate dehydrogenase

In Table 1, N represents any one of A, T, G, C four bases, K represents any one of G, T two bases, and a codon formed by NNK combination can cover all 20 amino acids.

Example 2: inducible expression of glufosinate dehydrogenase mutant engineering bacteria

The glufosinate dehydrogenase mother engineering bacteria, the glufosinate dehydrogenase mother and formate dehydrogenase starting co-expression strains and the glufosinate dehydrogenase mutant and formate dehydrogenase co-expression strains in example 1 are respectively inoculated into LB liquid medium containing 50 mug/mL of ampicillin at the final concentration, cultured for 8 hours at 37 ℃, inoculated into fresh LB liquid medium containing 50 mug/mL of ampicillin at the final concentration by an inoculum size of 2% of volume, cultured for 2 hours at 37 ℃ at 180 rpm, and then added into the culture solution to be cultured for 14 hours at 18 ℃ at the final concentration of 0.1mM IPTG, and centrifuged for 10 minutes at 8000 rpm at 4 ℃ to obtain corresponding wet thalli. LB liquid medium composition: 10g/L peptone, 5g/L yeast powder and 10g/L sodium chloride, wherein the solvent is water, and the pH value is natural.

SDS-PAGE detection is carried out on wet thalli of a glufosinate dehydrogenase mother engineering bacterium (lane 2), a glufosinate dehydrogenase mother and a formate dehydrogenase starting co-expression strain (lane 1), and the results are shown in figure 2.

The obtained cells produce corresponding proteins, and can be used for preparing protein pure enzyme liquid and immobilized cells.

Example 3: mutant library screening

The wet thalli are co-expressed by the glufosinate dehydrogenase mother engineering bacteria, the glufosinate dehydrogenase mother and the formate dehydrogenase prepared by the method of example 2, or the wet thalli are co-expressed by the glufosinate dehydrogenase mutant and the formate dehydrogenase, the 2-carbonyl-4- (hydroxymethylphosphonyl) -butyric acid is used as a substrate, the ammonium formate is used as a coenzyme regeneration substrate, and a trace amount of NAD is exogenously added ⁺ A1 mL reaction system was constructed with a pH of 7.4 and 100mM phosphate buffer as the reaction medium, the catalyst was used in an amount of 10g/L based on the weight of wet bacteria, 100mM substrate, 125mM ammonium formate, NAD ⁺ The final concentration was 1mM, and the reaction was carried out at 35℃and 600rpm for 5min. Adding 5 μl of hydrochloric acid (6 mol/L) into 50 μl of the reaction solution to terminate the reaction, diluting the reaction solution with distilled water for 100 times, adding 200 μl of diluted reaction solution and 400 μl of derivatization reagent (boric acid buffer solution containing 15mM phthalaldehyde and 15mM N-acetyl-L-cysteine and having pH of 9.8) at 30deg.C for derivatization for 5min, adding 400 μl of ultrapure water to make up 1ml, centrifuging at 12000 rpmTaking the supernatant, passing through a 0.22 mu M microfiltration membrane, collecting filtrate as a liquid phase sample, detecting peak areas of 2-carbonyl-4- (hydroxy methyl phosphono) -butyric acid, L-glufosinate and D-glufosinate by adopting high performance liquid chromatography, obtaining respective contents according to respective standard curves, and calculating an e.e. value. Dominant mutants were selected using the products L-glufosinate and e.e. as indicators, and the experimental results are shown in table 2.

2-carbonyl-4- (hydroxymethyl-phosphono) -butyric acid liquid phase detection conditions: chromatographic columnC18 (4.6X250 mm, acchrom, china) column, mobile phase acetonitrile: the volume ratio of 50mM ammonium dihydrogen phosphate solution (pH 3.8, containing 10% tetrabutylammonium hydroxide) was 12:88. The flow rate is 1mL/min, the detection wavelength is 232nm, the sample injection amount is 10 mu L, the column temperature is 30 ℃, and the retention time of 2-carbonyl-4- (hydroxy methyl phosphonic group) -butyric acid is as follows: 9.7 minutes.

Liquid phase detection conditions of glufosinate: chromatographic columnC18 (4.6X250 mm, acchrom, china) column, mobile phase methanol: 0.05M ammonium acetate (pH 5.7) volume ratio of 10:90, flow rate of 1.0mL/min, detection wavelength Ex=340 nm, em=450 nm, sample injection amount of 10 μl, column temperature of 35 ℃. The retention times of the L-glufosinate and the D-glufosinate are respectively as follows: 10.6 minutes, 12.6 minutes.

Concentration-peak area standard curves (fig. 3 and 4, respectively) were drawn using 2-carbonyl-4- (hydroxymethylphosphinyl) -butyric acid and glufosinate standard, sample concentrations were calculated using the standard curves, and cell viability was calculated from the product yields.

TABLE 2 Wet cell catalytic Properties and stereoselectivity comprising KmGDH and dominant mutants

Mutation bitPoint(s)	L-glufosinate (mM)	e.e(％)
			Wild type enzyme-PseFDH	0.325	99.9
P145G-PseFDH	14.221	99.9
			S348A-PseFDH	9.237	99.9
R74A-PseFDH	1.215	99.9
			K106A-PseFDH	2.023	99.9
P145G-V384Q-N78S-PseFDH	20.265	99.9
			D134G-V384Q-A292C-PseFDH	5.256	99.9
P145G-V384F-K70A-PseFDH	25.268	99.9
			D146A-V384Q-K70A-PseFDH	4.025	99.9
P145G-D134G-N78S-PseFDH	1.599	99.9
			P145G-V384Y-S348A-A292C-A202L-PseFDH	38.259	99.9

Note that: P145G-V384Q-N78S represents a mutation of proline at position 145 of KmGDH to glycine, valine at position 384 to glutamine, and asparagine at position 78 to serine.

Screening to obtain the co-expression strain E.coli BL21 (DE 3) -KmGDH-P145G,

E.coli BL21(DE3)-KmGDH-S348A、

E.coli BL21(DE3)-KmGDH-P145G-V384Q-N78S-PseFDH、

E.coli BL21(DE3)-KmGDH-P145G-V384F-K70A-PseFDH、

E.coli BL21(DE3)-KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH。

Example 4: purification of glufosinate dehydrogenase female parent and mutant thereof

The engineering bacteria co-expressed by the glufosinate dehydrogenase female parent constructed in example 1 and the dominant mutant screened in example 3 are prepared into corresponding wet thalli according to the method of example 2.

Wet cells of a glufosinate dehydrogenase mother-co-expression engineering bacterium and a glufosinate dehydrogenase mutant-co-expression engineering bacterium were each 0.2g, suspended in 10ml of a binding buffer (pH 7.4 containing 0.3M NaCl, 100mM sodium phosphate buffer), sonicated for 15 minutes (ice bath, power 400W, disruption for 1 second, pause for 5 seconds), centrifuged at 12000 rpm for 20 minutes at 4℃and the supernatant was taken as a sample for loading. Purification using Ni affinity columns (1.6X10 cm, bio-Rad Co., USA) gave the KBGDH monomer proteins, which were prepared as follows: (1) the Ni column was equilibrated with 5 column volumes of binding buffer (pH 7.4 containing 0.3M NaCl, 50mM sodium phosphate buffer) to baseline stability; (2) sample loading, wherein the flow rate is 1mL/min, and the loading amount is 2 times of the column volume so that target protein is adsorbed on the Ni column; (3) the heteroprotein was washed with 6 column volumes of buffer A (pH 7.4 containing 0.3M NaCl, 30mM imidazole, 50mM sodium phosphate buffer) at a flow rate of 1mL/min to baseline stability; (4) the target protein was collected by eluting with 2 column volumes of buffer B (pH 7.4 containing 0.3M NaCl, 500mM imidazole, 50mM sodium phosphate buffer) at a flow rate of 1 mL/min. Dialyzing target protein in phosphate buffer solution with pH of 7.4 and 20mM overnight, and collecting trapped fluid to obtain 10ml of parent pure enzyme of glufosinate dehydrogenase and 10ml of mutant pure enzyme of glufosinate dehydrogenase respectively; (5) the Ni column was washed with 5 column volumes of binding buffer (pH 8.0 containing 0.3M NaCl, 50mM sodium phosphate buffer) until the baseline stabilized, and was preserved with 5 column volumes of ultrapure water containing 20% ethanol.

The protein concentration of the purified enzyme was measured using BCA protein assay kit (south kyoki biotechnology development limited, south kyo) as shown in table 3.

Example 5: glufosinate dehydrogenase female parent and specific enzyme activity determination of mutant thereof

The enzyme activity unit (U) is defined as: the amount of enzyme required per minute to produce 1. Mu. Mol of L-glufosinate at 35℃and pH7.4 was defined as one enzyme activity unit, U. Specific enzyme activity is defined as the number of units of activity, U/mg, per milligram of enzyme protein.

Standard conditions for enzyme activity detection: 100mM 2-carbonyl-4- (hydroxy methyl phosphonic acid) -butyric acid, 50mM NADH was added, a pure enzyme solution (prepared by the method of example 4) containing 200. Mu.g protein was prepared by using pH7.4 and 50mM sodium phosphate buffer as a reaction medium to construct a 1mL reaction system, and the reaction was carried out at 30℃for 10 minutes under the conditions of pH7.4 and 600rpm, and HPLC detection analysis was performed by the method of example 3, and the relative enzyme activities were shown in Table 3.

TABLE 3 specific enzyme activities of glufosinate dehydrogenase female parent and mutants thereof

^a : under standard conditions, the initial enzyme activity of each glufosinate dehydrogenase female parent was designated as 100%.

Example 6: kinetic parameter determination of glufosinate dehydrogenase female parent and mutant thereof

The kinetic parameters of the parent and mutant of glufosinate dehydrogenase were examined, 2-carbonyl-4- (hydroxymethylphosphono) -butyric acid was used as substrate, the concentration was set at 20-200mM (20, 50, 100, 150, 200 mM), sufficient coenzyme was added, and an appropriate amount of pure enzyme solution was added (collected as in example 4).

The reaction system was chosen to be 500 μl: the mother and mutant pure enzyme solutions collected by the method of example 4 were diluted with phosphate buffer solution of pH7.4 and 100 mM. Taking diluted pure enzyme solution, adding a substrate and exogenous coenzyme NADH, taking pH7.4 and 100mM phosphate buffer solution as reaction media to form a 500 mu L reaction system, wherein the adding amount of the pure enzyme is 200mg/L, the adding amount of the substrate is 20-200mM (20, 50, 100, 150 and 200 mM) based on the protein content, the adding concentration of NADH is 50mM, the reaction is carried out at 35 ℃ for 600 revolutions per minute for 10 minutes, and the concentration of L-glufosinate is detected by adopting the method of the example 3.

K can be calculated by double reciprocal mapping _cat 、v _max 、K _m The results are shown in Table 4 by comparing k _cat And K _m It was found that KmGDH had a Km value of 8.56mM for 2-carbonyl-4- (hydroxymethylphosphono) -butyric acid, with the remaining mutants having an increasing tendency to have an affinity for 2-carbonyl-4- (hydroxymethylphosphono) -butyric acid. Catalytic efficiency k of mutant KmGDH-P145G-V384Y-S348A-A292C-A202L on 2-carbonyl-4- (hydroxymethylphosphono) -butyric acid _cat /K _m Reaching 396.8s ^-1 *M ^-1 Female parent (k) _cat /K _m ＝3.2s ^-1 *M ^-1 ) The improvement is 124 times.

TABLE 4 comparison of maternal KmGDH and mutant kinetic parameters thereof

Enzymes	K cat (s -1 )	k m (M)	k cat /k m (s -1 *M -1 )
				KmGDH	1.30±0.1	0.41±0.02	3.2
KmGDH-P145G	54.1±4.2	0.35±0.07	154.6
				KmGDH-S348A	33.6±3.8	0.40±0.03	84.0
KmGDH-P145G-V384Q-N78S	71.4±3.1	0.32±0.01	223.1
				KmGDH-P145G-V384F-K70A	72.4±2.8	0.22±0.05	329.1
KmGDH-P145G-V384Y-S348A-A292C-A202L	75.4±1.2	0.19±0.01	396.8

Example 7: determination of the thermal stability of the parent and mutant of glufosinate dehydrogenase

Considering the thermal stability of the glufosinate dehydrogenase female parent and its mutant co-expressed enzyme, 20ml of the mother and mutant KmGDH-P145G-V384Y-S348A-A292C-A202L pure enzyme solutions collected by the method of example 4 were placed in a water bath at 35℃and 50℃and 65℃respectively, and incubated, and an appropriate amount of enzyme solution was taken out every 4 hours for activity measurement (as in example 5). Half-life was calculated after fitting the data obtained after 24 hours of continuous measurement. The thermal stability of the glufosinate dehydrogenase female parent and the mutant KmGDH-P145G-V384Y-S348A-A292C-A202L is shown in figures 5 and 6 respectively, and after fitting calculation, the half lives of the glufosinate dehydrogenase female parent at 35 ℃, 50 ℃ and 65 ℃ are 18.4h, 11.2h and 6.9h respectively; the half-lives of mutant KmGDH-P145G-V384Y-S348A-A292C-A202L at 35℃and 50℃and 65℃were 294.7h, 143.0h and 25.7h, respectively.

Example 8: preparation of immobilized cells of glufosinate dehydrogenase mutant engineering bacteria

(1) Preparing 100G of wet thalli of mutant coexpression E.coli BL21 (DE 3) -KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH engineering bacteria by the method of example 2, adding 1L of phosphate buffer solution with pH of 7.5 to prepare 100G/L suspension, adding 2.25G of diatomite and fully stirring for 30min;

(2) Adding 3mL of polyethyleneimine (molecular weight 10000) (pH is preset to 7.0 by hydrochloric acid) into the mixed solution in the step (1), and fully stirring for 30min;

(3) Adding 3mL of glutaraldehyde into the mixed solution in the step (2), and continuously and fully stirring for 30min;

(4) And (3) carrying out vacuum filtration to separate solid from liquid, collecting 150g of immobilized cells (the wet cell content is 0.67g/g of immobilized cells), washing 3 times with water, and storing in a refrigerator at 4 ℃.

Example 9: immobilized cell performance determination and application thereof in synthesis of L-glufosinate

1. Enzyme activity

The immobilized cells obtained in example 8 (0.5 g) were taken and added with 100mM of 2-carbonyl-4- (hydroxymethylphosphono) -butyric acid, 150mM of ammonium formate and 1mM of NAD+ in 10mL of phosphate buffer at pH7.5, and reacted at 35℃and 600rpm for 10min, and sampled, and the concentration of the product L-glufosinate was measured by HPLC as described in example 3, and the enzyme activity of the immobilized cells was calculated according to the enzyme activity test method of example 5.

Under the same conditions, the enzyme activity of wet bacterial bodies of mutant coexpression E.coli BL21 (DE 3) -KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH engineering bacteria is detected and is used as free cell enzyme activity.

The immobilized cell enzyme activity is divided by the free cell enzyme activity to calculate the immobilized cell enzyme activity recovery rate.

The result shows that the enzyme activity of the immobilized cells is 162.5U/g, and the recovery rate of the enzyme activity is 78.1%.

2. Repeatedly use

37.5g of the immobilized cells (25 g of wet cells) obtained in example 8 were placed in a 3L mechanically stirred reactor containing 1L of phosphate buffer solution (pH=7.5, 100 mM), and 400mM of 2-carbonyl-4- (hydroxymethylphosphonyl) -butyric acid, 600mM of ammonium formate, NAD was added ⁺ The reaction was carried out at 35℃at 0.1mM and at 600rpm for 8 hours with sampling every 0.5 hour, the concentrations of the substrate and the product L-glufosinate were measured as described in example 3, and the substrate conversion and ee values were calculated as shown in FIG. 7. FIG. 7 shows that complete conversion of 400mM substrate PPO in 4h can be achieved with immobilized cells as catalyst, and the product to ee value is greater than 99.9%.

After the reaction, the reaction solution was subjected to vacuum filtration to perform solid-liquid separation, and the precipitate (i.e., immobilized cells) was washed three times with distilled water, followed by conversion of the next batch, and the conversion rate of each batch was calculated, and the result is shown in FIG. 8. Under the same conditions, the immobilized cells were replaced with wet cells of E.coli BL21 (DE 3) -KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH engineering bacteria.

The results in FIG. 8 show that the immobilized cells can still maintain 100% conversion rate in 22 batches continuously, while the non-immobilized wet cells have significantly reduced conversion rate at the beginning of the second batch under the same reaction conditions, and are completely out of viability after 4 batches are reused.

Example 10: preparation and performance detection of glufosinate dehydrogenase mutant immobilized cells

The preparation method is the same as in example 8, except that the carrier in step (1) is changed to active carbon, the molecular weight of polyethyleneimine in step (2) is 1800, and the crosslinking agent used in step (3) is dialdehyde starch.

The properties of the obtained immobilized cells were determined as follows: the enzyme activity of the immobilized cells is 106.4U/g, and the conversion rate is 68.7% after 20 batches of continuous conversion.

Example 11: preparation and performance detection of glufosinate dehydrogenase mutant immobilized cells

The preparation method is the same as in example 8, except that the carrier in step (1) is changed to bentonite, the molecular weight of polyethyleneimine in step (2) is 700, and the crosslinking agent used in step (3) is glutaraldehyde.

The properties of the obtained immobilized cells were determined as follows: the enzyme activity of the immobilized cells is 154.3U/g, and the conversion rate is 65.1% after 20 batches of continuous conversion.

Example 12: preparation and performance detection of glufosinate dehydrogenase mutant immobilized cells

The preparation method is the same as in example 8, except that the carrier in step (1) is changed to montmorillonite, the molecular weight of polyethyleneimine in step (2) is 70000, and the crosslinking agent used in step (3) is glyoxal.

The properties of the obtained immobilized cells were determined as follows: the enzyme activity of the immobilized cells is 80.7U/g, and the conversion rate is 56.6% after 20 batches of continuous conversion.

Sequence listing

<110> Zhejiang university of industry

<120> glufosinate dehydrogenase mutant, engineering bacterium, immobilized cell and application

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1242

<212> DNA

<213> Marseilles (Kurthia massiliensis)

<400> 1

atggcagaaa acctgaactt atttacgagc acccaggcga ttattaaaga agcgctgcag 60

aaactgggct acgatgaggc gatgtatgac ttactgaaag aaccgctgcg tatgctgcag 120

gttagaatcc cggtccgtat ggacgacggc accgttaccg ttttcacagg ttatcgtgcc 180

caacataatg atgcagttgg cccgaccaag ggtggcgtac gttttcatcc gaatgttagt 240

gaagaagaag ttaaagcact gagcatgtgg atgaccctga aagcaggtat tgttgattta 300

ccatatgggg gtggtaaagg cggcgtgatt tgtgatcctc gtcagatgag catgggtgaa 360

ctggaaagat taagccgtgg atatgttcgg gcaacctcgc agattgttgg tccgaccaaa 420

gatattccgg caccggatgt ttttaccaat gcacaaatta tggcatggat gatggatgaa 480

tatagccgta tggatgaatt taatagcccg ggctttataa cgggtaaacc tattgtgtta 540

ggtggtagtc aggggcgtga tcgtgccaca gcccagggcg taacgattgt tatagaacag 600

gcagcaaaac ggcggaatct gcaaatcgaa ggtgcaagag tggtgattca gggatttgga 660

aatgcaggta gctttctggc taaattcatg aatgatctgg gcgcgaaagt ggtgggtatt 720

agtgacgcaa atggcgcact gtacgatccg gaaggactgg atattgatta tctgttagac 780

cgtcgtgata gttttggtac cgttactaat ctgtttgaaa ataccattac caacgaagaa 840

cttttagaat tagagtgtga tatcctggtt ccggctgcca ttgaaaacca aattacagca 900

gaaaatgcac ataatatcaa ggccaacatt gttgtggaag cagcaaacgg accgaccacc 960

caggaagcca caaaaatact gaccgagcgt ggagttctgc tggtgccgga cgttttagca 1020

agcgcaggtg gcgttacagt aagctacttt gaatgggttc agaataatca gggctattac 1080

tggagtgaag aagaggttaa tgataaatta tacaagaaga tggtggaggc gtttgataat 1140

atttataatg tggcagaagc ccgcaaaata gatatgagac tggcggcata tatggtgggc 1200

gttagaaaaa cagcagaagc aagccggttt agaggctggg tt 1242

<210> 2

<211> 414

<212> PRT

<213> Marseilles (Kurthia massiliensis)

<400> 2

Met Ala Glu Asn Leu Asn Leu Phe Thr Ser Thr Gln Ala Ile Ile Lys

1 5 10 15

Glu Ala Leu Gln Lys Leu Gly Tyr Asp Glu Ala Met Tyr Asp Leu Leu

20 25 30

Lys Glu Pro Leu Arg Met Leu Gln Val Arg Ile Pro Val Arg Met Asp

35 40 45

Asp Gly Thr Val Thr Val Phe Thr Gly Tyr Arg Ala Gln His Asn Asp

50 55 60

Ala Val Gly Pro Thr Lys Gly Gly Val Arg Phe His Pro Asn Val Ser

65 70 75 80

Glu Glu Glu Val Lys Ala Leu Ser Met Trp Met Thr Leu Lys Ala Gly

85 90 95

Ile Val Asp Leu Pro Tyr Gly Gly Gly Lys Gly Gly Val Ile Cys Asp

100 105 110

Pro Arg Gln Met Ser Met Gly Glu Leu Glu Arg Leu Ser Arg Gly Tyr

115 120 125

Val Arg Ala Thr Ser Gln Ile Val Gly Pro Thr Lys Asp Ile Pro Ala

130 135 140

Pro Asp Val Phe Thr Asn Ala Gln Ile Met Ala Trp Met Met Asp Glu

145 150 155 160

Tyr Ser Arg Met Asp Glu Phe Asn Ser Pro Gly Phe Ile Thr Gly Lys

165 170 175

Pro Ile Val Leu Gly Gly Ser Gln Gly Arg Asp Arg Ala Thr Ala Gln

180 185 190

Gly Val Thr Ile Val Ile Glu Gln Ala Ala Lys Arg Arg Asn Leu Gln

195 200 205

Ile Glu Gly Ala Arg Val Val Ile Gln Gly Phe Gly Asn Ala Gly Ser

210 215 220

Phe Leu Ala Lys Phe Met Asn Asp Leu Gly Ala Lys Val Val Gly Ile

225 230 235 240

Ser Asp Ala Asn Gly Ala Leu Tyr Asp Pro Glu Gly Leu Asp Ile Asp

245 250 255

Tyr Leu Leu Asp Arg Arg Asp Ser Phe Gly Thr Val Thr Asn Leu Phe

260 265 270

Glu Asn Thr Ile Thr Asn Glu Glu Leu Leu Glu Leu Glu Cys Asp Ile

275 280 285

Leu Val Pro Ala Ala Ile Glu Asn Gln Ile Thr Ala Glu Asn Ala His

290 295 300

Asn Ile Lys Ala Asn Ile Val Val Glu Ala Ala Asn Gly Pro Thr Thr

305 310 315 320

Gln Glu Ala Thr Lys Ile Leu Thr Glu Arg Gly Val Leu Leu Val Pro

325 330 335

Asp Val Leu Ala Ser Ala Gly Gly Val Thr Val Ser Tyr Phe Glu Trp

340 345 350

Val Gln Asn Asn Gln Gly Tyr Tyr Trp Ser Glu Glu Glu Val Asn Asp

355 360 365

Lys Leu Tyr Lys Lys Met Val Glu Ala Phe Asp Asn Ile Tyr Asn Val

370 375 380

Ala Glu Ala Arg Lys Ile Asp Met Arg Leu Ala Ala Tyr Met Val Gly

385 390 395 400

Val Arg Lys Thr Ala Glu Ala Ser Arg Phe Arg Gly Trp Val

405 410

<210> 3

<211> 1203

<212> DNA

<213> Pseudomonas aeruginosa (Pseudomonas sp.)

<400> 3

atggccaaag ttctgtgtgt actgtatgac gacccggttg atggttaccc taaaacttac 60

gcacgtgacg atctgccgaa aatcgaccac tacccgggcg gccagaccct gccgacgccg 120

aaagcgatcg atttcactcc gggccaactg ctgggttctg tttctggtga actgggcctg 180

cgtaaatatc tggaatccaa cggccacacc ctggtggtga ccagcgacaa agatggtccg 240

gactccgtgt tcgaacgtga actggttgat gctgacgttg tcattagcca gccgttctgg 300

ccggcgtatc tgaccccgga acgcatcgcc aaagctaaaa acctgaaact ggcactgacc 360

gcaggtattg gttctgacca cgttgatctg cagtccgcca tcgatcgtaa cgttaccgtt 420

gccgaagtaa cctactgtaa ctctatctcc gtggctgaac atgtggttat gatgatcctg 480

tctctggttc gcaactatct gccgtctcat gaatgggcgc gtaaaggcgg ctggaacatc 540

gctgattgtg tcagccatgc gtatgacctg gaagcaatgc atgtgggcac tgttgcagct 600

ggtcgcatcg gcctggctgt cctgcgtcgc ctggcaccat tcgacgtaca cctgcactac 660

actgaccgtc accgtctgcc agaaagcgtg gagaaagaac tgaacctgac ctggcatgct 720

actcgcgaag acatgtaccc ggtgtgcgac gttgttaccc tgaactgtcc actgcacccg 780

gagaccgaac acatgattaa cgatgaaacc ctgaagctgt tcaaacgtgg cgcgtacatc 840

gtaaacacgg ctcgtggtaa gctgtgcgat cgtgacgctg tggcacgtgc gctggaatct 900

ggtcgcctgg ccggttacgc tggtgatgta tggtttccac agccggctcc gaaagaccac 960

ccgtggcgca ccatgcctta caatggtatg accccgcaca tttctggtac cactctgacc 1020

gcacaggcgc gttacgcagc gggtacccgt gaaattctgg agtgcttctt tgaaggtcgc 1080

ccgatccgtg atgaatacct gatcgttcag ggtggtgcgc tggctggcac tggtgctcat 1140

tcctactcta aaggtaacgc gaccggtggt tctgaagagg cggcgaaatt caaaaaggcc 1200

gtt 1203

Claims (9)

1. A glufosinate dehydrogenase mutant, characterized in that the mutant is one of the amino acid sequences shown in SEQ ID No.2 mutated to: (1) Proline at position 145 is mutated to glycine, or serine at position 348 is mutated to alanine; (2) Proline at position 145 is mutated to glycine, valine at position 384 is mutated to phenylalanine and lysine at position 70 is mutated to alanine; (3) Proline at position 145 is mutated to glycine, valine at position 384 is mutated to glutamine and asparagine at position 78 is mutated to serine; (4) Proline at position 145 is mutated to glycine, valine at position 384 is mutated to tyrosine, serine at position 348 is mutated to alanine, alanine at position 292 is mutated to cysteine and alanine at position 202 is mutated to leucine.

2. A gene encoding the glufosinate dehydrogenase mutant of claim 1.

3. A recombinant genetically engineered bacterium constructed from the coding gene of claim 2.

4. The recombinant genetically engineered bacterium of claim 3, wherein the recombinant genetically engineered bacterium is constructed by: cloning a glufosinate dehydrogenase mutant gene to NcoI of MCS1 of a plasmid pETDuet, constructing a recombinant expression vector, and reserving His-Tag genes of the plasmid; and constructing a formate dehydrogenase gene on NdeI of MCS2 of the recombinant expression vector to obtain a co-expression vector, and converting the co-expression vector into E.coli BL21 (DE 3) to obtain recombinant genetic engineering bacteria co-expressed by the glufosinate dehydrogenase mutant and the formate dehydrogenase.

5. Use of a glufosinate dehydrogenase mutant according to claim 1 for catalyzing 2-carbonyl-4- (hydroxymethylphosphono) -butyric acid to prepare L-glufosinate.

6. The application according to claim 5, wherein the application method is as follows: immobilized cells prepared from wet thalli or wet thalli obtained by induced culture of recombinant genetic engineering bacteria containing glufosinate dehydrogenase mutant genes and formate dehydrogenase genes are used as catalysts, 2-carbonyl-4- (hydroxymethylphosphonyl) -butyric acid is used as a substrate, ammonium formate is used as a coenzyme regeneration substrate, and NAD is exogenously added ⁺ The reaction system is formed by taking phosphate buffer solution with the pH value of 7.4 and the pH value of 100mM as a reaction medium, the conversion reaction is carried out at the temperature of 20-50 ℃ and the rotation speed of 200-800 r/min, after the reaction is finished, the reaction solution is filtered, a filter cake is used for recovering a catalyst, and the filtrate is separated and purified to obtain the L-glufosinate-ammonium.

7. The use of claim 6, wherein the immobilized cells are prepared by: adding wet thalli obtained by fermenting and culturing the recombinant genetic engineering bacteria into a phosphate buffer with the pH value of 6.0-8.0, adding a carrier, fully stirring for 20-30 min, adding polyethylenimine, fully stirring for 20-30 min, then adding a cross-linking agent, fully stirring for 20-30 min, carrying out vacuum suction filtration, and washing a filter cake with water to obtain the immobilized cells of the recombinant genetic engineering bacteria; the carrier is activated carbon, diatomite, bentonite or montmorillonite; the cross-linking agent is glutaraldehyde, glyoxal or dialdehyde starch; the molecular weight of the polyethyleneimine is 600-70000.

8. The use according to claim 7, wherein the phosphate buffer is used in a volume amount of 5 to 20mL/g based on the weight of the wet bacteria; the mass consumption of the carrier is 2-10% of the mass of the thalli; the dosage of the polyethyleneimine is 1-10 mL/100g based on the mass of the thalli; the dosage of the cross-linking agent is 1-10 mL/100g based on the mass of the thallus.

9. The use according to claim 6, wherein the catalyst is used in the reaction system in an amount of 10 to 50g/L based on the volume of the reaction medium, the final concentration of the substrate is 100 to 400mM, the final concentration of ammonium formate is 100 to 800mM, NAD ⁺ Final concentration 0.05-2mM.