CN114350631A - Glufosinate-ammonium dehydrogenase mutant, engineering bacteria, immobilized cell and application - Google Patents

Abstract

The invention discloses a glufosinate-ammonium dehydrogenase mutant, engineering bacteria, immobilized cells and application, wherein the mutant is obtained by performing single mutation or multiple mutation on 145 th, 384 th, 348 th, 292 th, 202 th, 70 th and 78 th positions of a glufosinate-ammonium dehydrogenase amino acid sequence shown in SEQ ID No. 2. The glufosinate-ammonium dehydrogenase mutant and formate dehydrogenase co-expression engineering bacteria immobilized cell is subjected to catalytic reduction to obtain L-glufosinate-ammonium by using a 2-carbonyl-4- (hydroxymethyl phosphonyl) -butyric acid substrate, so that asymmetric synthesis of L-glufosinate-ammonium is realized, an expensive chemical resolution reagent is not needed, the thermal stability and the operation stability of the glufosinate-ammonium dehydrogenase mutant are improved, and the glufosinate-ammonium dehydrogenase mutant and formate dehydrogenase co-expression engineering bacteria immobilized cell is reused. The immobilized cell has the enzyme activity of 162.5U/g, the recovery rate of the enzyme activity is 78.1 percent, the immobilized cell can be recovered by filtration and can be repeatedly used for more than 20 batches to keep 100 percent of conversion rate, and the production cost is greatly reduced.

Description

Glufosinate-ammonium dehydrogenase mutants, engineered bacteria, immobilized cells and applications

(1) Technical field

The present invention relates to an NADH-dependent glufosinate-ammonium dehydrogenase mutant, engineering bacteria, immobilized cells and applications thereof.

(2) Background technology

The chemical name of phosphinothricin (also called glufosinate, PPT) is 2-amino-4-[hydroxy(methyl)phosphono]-butyric acid, which is the world's second largest genetically modified crop tolerant to herbicides. It is developed and produced by Sterling Company (now owned by Bayer Company after several mergers), also known as glufosinate ammonium salt, Basta, Buster, etc. It is a phosphonic acid herbicide. The non-selective (killing) contact herbicide is glutamine. Synthetase inhibitors.

Glufosinate has two optical isomers, L-Glufosinate and D-Glufosinate. However, only the L-type has physiological activity, is easily decomposed in the soil, is less toxic to humans and animals, has a broad herbicidal spectrum, and is less destructive to the environment.

At present, glufosinate-ammonium sold on the market is generally a racemic mixture. If the glufosinate-ammonium product can be used in the form of pure optical isomer of L-configuration, the usage amount of glufosinate-ammonium can be significantly reduced, which is of great significance for improving atom economy, reducing use cost and reducing environmental pressure.

There are three main methods for the preparation of chiral pure L-glufosinate: chiral resolution, chemical synthesis and biocatalysis. Biocatalytic production of glufosinate has the advantages of strict stereoselectivity, mild reaction conditions and high yield, and is an advantageous method for the production of L-glufosinate. It mainly includes the following three categories:

1) Using the derivative of L-glufosinate as a substrate, it is obtained by direct hydrolysis by enzymatic method. The main advantages are high conversion rate and high product e.e. value, but expensive and difficult to obtain chiral raw materials as precursors, cost Increasing the height is not conducive to industrial production. For example, the easiest way to prepare L-glufosinate by biological method is to directly hydrolyze bialaphos with protease. Bialaphos is a natural tripeptide compound. Under the catalysis of protease, bialaphos removes 2 molecules of L-alanine to generate L-glufosinate.

2) The precursor of racemic glufosinate-ammonium is used as the substrate, and it is obtained by selective resolution of the enzyme. The main advantages are that the raw materials are relatively easy to obtain and the catalyst activity is high, but the theoretical yield can only reach 50%, which will cause waste of raw materials. For example, Cao et al. (CaoC-H, Cheng F, Xue Y-P, Zheng Y-G (2020) Efficient synthPseis of L-phosphinothricinusing a novel aminoacylase mined from Stenotrophomonas maltophilia. Enzyme and Microbial Technology 135doi:10.1016/j.enzmictec.2019.109493) adopted a A novel aminoacylase derived from Stenotrophomonas maltophilia chiral resolves N-acetyl-PPT to obtain L-glufosinate. Catalysis with whole cells yielded >49% conversion in 4 hours to obtain optically pure L-PPT (>99.9% e.e.).

3) Using 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid (PPO) as a substrate, it is obtained by asymmetric synthesis of enzymes, and the enzymes mainly involved include transaminase and glufosinate dehydrogenase. Bartsch (Bartsch K (2005) ProcPsPse for the preparation of l-phosphinothrcine by enzymatic transamination with aspartate. US Patent no. US6936444B1) etc. used PPO as the substrate and L-aspartic acid as the amino donor. The transaminase with specific enzymatic activity to PPO and L-aspartate catalyzed, when the substrate concentration was 552mM, the reaction was carried out at a very high temperature (80°C) for 4 hours, and the conversion rate still reached 52%, The space-time yield was 4.5 g L-PPT/g·L ⁻¹ ·d ⁻¹ . However, the use of transaminase to prepare L-glufosinate has two major defects. One is that this is a reversible reaction, the raw material PPO cannot be completely converted into L-PPT, and the conversion rate cannot reach 100%; To proceed in the direction of -PPT, it is necessary to add at least 2 times more L-aspartic acid as an amino donor, and excess aspartic acid brings great trouble to the separation of L-PPT.

The chiral resolution method obtained L-glufosinate-ammonium, and the theoretical maximum yield was only 50%; chemical asymmetric synthesis of L-glufosinate-ammonium can break through this limitation, but the reported chemical synthesis methods generally have poor efficiency and stereoselectivity. Low. The enzymatic asymmetric synthesis of L-glufosinate-ammonium builds a chiral center by asymmetric amination of the ketone carbonyl of the keto acid intermediate. This route is also suitable for L- - Route of industrial development and production of glufosinate-ammonium. Traditional enzymatic synthesis methods rely on expensive NADP as a coenzyme, which is costly.

Amino acid dehydrogenase (EC 1.4.1.X, AADH) is a class of amino acid dehydrogenases that can reversibly deaminate amino acids to the corresponding keto acids. The reaction requires the participation of nucleoside coenzymes (NAD ⁺ ) and is widely used. for the synthesis of natural and unnatural α-amino acids. According to its substrate specificity, it can be divided into glutamate dehydrogenase, leucine dehydrogenase, alanine dehydrogenase, valine dehydrogenase and so on. If it shows a certain activity to glufosinate precursor, it can be called "glufosinate dehydrogenase (PPTDH)".

Formate dehydrogenase (EC1.1.1.47, FDH) is an important auxiliary enzyme in biocatalysis and is used in the regeneration cycle of coenzyme NADH in redox catalysis reactions.

At present, the enzymatic activity of NADPH-dependent glufosinate dehydrogenase is significantly higher than that of NADH-dependent glufosinate dehydrogenase (more than 50 times), and the price of NADPH is 5 times that of NADH. Active glufosinate-ammonium dehydrogenase has good application prospects. Due to the poor thermal stability of glufosinate-ammonium dehydrogenase, it is easy to inactivate and reduce the reaction rate in practical applications. It is necessary to improve the stability of the enzyme at the molecular level by suitable methods; in addition, E. coli BL21 (DE3 ) expressed glufosinate dehydrogenase is an intracellular enzyme, so the whole cell of Escherichia coli containing glufosinate dehydrogenase can be immobilized by immobilized cell technology to further improve its thermal stability and operational stability, and Reuse and reduce production costs.

(3) Contents of the invention

The purpose of the present invention is to solve the problems that the existing glufosinate-ammonium dehydrogenase has low activity and poor stability for asymmetric amination reduction of 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid, and provides a NADH-dependent glufosinate-ammonium dehydrogenase mutants, engineering bacteria, immobilized cells and applications for chiral biosynthesis of L-glufosinate-ammonium solve the problem of high cost and high cost of preparing L-glufosinate-ammonium by asymmetric amination reduction. The problem of low catalytic efficiency.

The technical scheme adopted in the present invention is:

The present invention provides a NADH-dependent glufosinate-ammonium dehydrogenase mutant, wherein the mutant is the 145th, 384th and 348th positions of the amino acid sequence of glufosinate-ammonium dehydrogenase shown in SEQ ID No.2 , 292, 202, 70, 78 by single mutation or multiple mutation. The nucleotide sequence of the glufosinate-ammonium dehydrogenase encoding gene KmGDH is shown in SEQ ID No.1.

Preferably, in the mutant, the amino acid sequence shown in SEQ ID No. 2 is mutated to one of the following: (1) Proline at position 145 is mutated into glycine (P145G), or serine at position 348 is mutated into alanine (S348A); (2) Proline 145 was mutated to glycine, valine 384 was mutated to phenylalanine and lysine 70 was mutated to alanine (P145G-V384F-K70A); ( 3) Proline 145 is mutated to glycine, valine 384 is glutamine, and asparagine 78 is mutated to serine (P145G-V384Q-N78S); (4) Proline 145 Mutation to glycine, valine 384 to tyrosine, serine 348 to alanine, alanine 292 to cysteine and alanine 202 to leucine (P145G-V384Y-S348A-A292C-A202L).

The invention also relates to the encoding gene of the NADH-dependent glufosinate dehydrogenase mutant, a recombinant vector constructed from the encoding gene, and a recombinant genetic engineering bacterium prepared by co-expression and transformation of the recombinant vector and the formate dehydrogenase gene.

The recombinant vector of the present invention is based on the plasmid pETDuet, and is cloned into NcoI of MCS1 (multiple cloning site 1) of the plasmid pETDuet.

The recombinant genetic engineering bacteria of the present invention takes E.coli BL21 (DE3) as the host bacteria, and is prepared according to the following steps: clone the KmGDH mutant gene of glufosinate-ammonium dehydrogenase into MCS1 (multiple cloning site 1) of plasmid pETDuet On the NcoI, construct a recombinant expression vector to retain the His-Tag gene of the plasmid itself; and then construct the formate dehydrogenase gene PseFDH (nucleotide sequence as shown in SEQ ID No. 3) through the One Step Cloning Kit of Vazyme Company On the NdeI of MCS2 (multiple cloning site 2) of the recombinant expression vector, a co-expression vector was obtained, which was transformed into E. coli BL21 (DE3) to obtain a mutant of glufosinate dehydrogenase and formate dehydrogenase co-expression of recombinant genetically engineered bacteria.

The invention also provides the application of a glufosinate-ammonium dehydrogenase mutant in catalyzing 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid (PPO) to prepare L-glufosinate-ammonium, and the application method The method is as follows: using the wet cells obtained by inducing and culturing the recombinant genetically engineered bacteria containing glufosinate-ammonium dehydrogenase mutant gene and formate dehydrogenase gene or immobilized cells prepared from wet cells as catalysts, using 2-carbonyl-4- (Hydroxymethylphosphono)-butyric acid was used as the substrate, ammonium formate was used as the coenzyme regeneration substrate, NAD ⁺ was added exogenously, and the reaction system was formed with pH 7.4 and 100mM phosphate buffer as the reaction medium. (preferably 35°C), 200-800 rev/min (preferably 600 rev/min) to carry out the conversion reaction, after the reaction, the reaction solution is suction filtered, the filter cake recovers the catalyst, and the filtrate is separated and purified to obtain L-glufosinate-ammonium. In the reaction system, the catalyst dosage is 10-50g/L (preferably 10g/L) based on the volume of the reaction medium, the final concentration of the substrate is 100-400mM (preferably 400mM), the final concentration of ammonium formate is 100-800mM (preferably 600mM), NAD ⁺ Final concentration 0.05-2 mM (preferably 0.1 mM).

The wet cells were prepared as follows: the recombinant genetically engineered bacteria containing the mutant gene of glufosinate dehydrogenase and the gene of formate dehydrogenase were inoculated into the LB liquid medium containing the final concentration of 50 μg/mL ampicillin, Cultivated at 37°C for 8 hours, inoculated into a fresh LB liquid medium containing a final concentration of 50 μg/mL ampicillin with a volume concentration of 2%, cultured at 37°C and 180 rpm for 2 hours, and then added to the culture medium. Add the final concentration of 0.1mM IPTG, after culturing at 18°C for 14 hours, centrifuge at 4°C and 8000 rpm for 10 minutes to obtain the corresponding wet cells.

The immobilized cells of the recombinant genetically engineered bacteria are prepared as follows: the wet cells obtained by the fermentation and culture of the recombinant genetically engineered bacteria are added to a phosphate buffer of pH 6.0-8.0 (preferably a phosphate buffer of pH 7.5), Add the carrier, stir well for 20-30min, then add polyethyleneimine, stir well for 20-30min, then add cross-linking agent, stir well for 20-30min, filter under reduced pressure, and wash the filter cake with water to obtain the recombinant genetically engineered bacteria Immobilized cells; the volumetric dosage of the phosphate buffer is 5-20 mL/g (preferably 10 mL/g) based on the weight of wet cells; the carrier is activated carbon, diatomaceous earth, bentonite or montmorillonite (preferably diatomaceous earth). ), the amount of the carrier mass is 2-10% (preferably 2-3%) of the mass of the thalli; the molecular weight of the polyethyleneimine is 600-70000 (preferably 10,000), and the dosage is 1 to 10 mL based on the mass of the thalli /100g (preferably 3mL/100g); the cross-linking agent is glutaraldehyde, glyoxal or dialdehyde starch, and the dosage is 1-10mL/100g (preferably 3mL/100g) in terms of bacterial mass.

Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

(1) The present invention obtains a glufosinate-ammonium dehydrogenase mutant with improved thermal stability by screening, wherein the half-life of the mutant KmGDH-P145G-V384Y-S348A-A292C-A202L at 35°C, 50°C and 65°C is determined by 18.4h before mutation increased to 294.7h, 11.2h to 143.0h and 6.9h to 25.7h, the thermal stability was significantly improved. At the same time, when the glufosinate-ammonium dehydrogenase mutant catalyzes the reduction of 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid to prepare L-glufosinate, the lower-priced NADH is used as a coenzyme to replace the expensive NADPH. Coenzyme, significantly reducing costs.

(2) The immobilized cells of the engineered bacteria co-expressing the glufosinate-ammonium dehydrogenase mutant and the formate dehydrogenase prepared by the method of the present invention further improve its thermal stability and operational stability, and realize repeated use. The enzyme activity of the immobilized cells is 162.5U/g, and the recovery rate of the enzyme activity is 78.1%, which can be recovered by filtration, and can be reused for more than 20 batches to maintain 100% conversion rate, which greatly reduces the production cost.

(3) The present invention utilizes the glufosinate-ammonium dehydrogenase mutant and the coenzyme recycling system to directly catalyze the reduction of 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid substrate to L-glufosinate-ammonium, thereby realizing Asymmetric synthesis of L-Glufosinate-ammonium does not require expensive chemical resolution reagents or synthesis of glufosinate-ammonium derivatives. The glufosinate-ammonium dehydrogenase mutant has better catalytic efficiency and higher stability. Compared with the wild-type parent, the enzyme activity is increased to 3856%, and the half-life at 35°C is extended from 18.4h to 294.7h. When 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid was used as the substrate for the catalytic reaction, the conversion rate was much higher than that of the wild-type enzyme, and the yield of glufosinate-ammonium was also greatly improved.

(4) Description of drawings

Figure 1 is a schematic diagram of the reaction of the asymmetric amination reduction of 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid to L-glufosinate-ammonium dehydrogenase mutant coupled with formate dehydrogenase.

FIG. 2 is a graph of KmGDH and PseFDH double-enzyme-coupled SDS-PAGE in Example 2. FIG. Among them, lane 1: standard protein molecular weight; lane 2: cells of strains co-expressing glufosinate-ammonium dehydrogenase parent and formate dehydrogenase. Lane 3: glufosinate dehydrogenase parent engineered bacteria cells.

Figure 3 is the standard curve of 2-carbonyl-4-(hydroxymethylphosphinyl)-butyric acid in Example 3.

Figure 4 is the standard curve of L-glufosinate-ammonium in Example 3.

5 is the half-life curve of the parent pure enzyme of glufosinate-ammonium dehydrogenase in Example 7 at 35°C, 50°C and 65°C.

6 is the half-life curve of the pure enzyme of glufosinate-ammonium dehydrogenase mutant KmGDH-P145G-V384Y-S348A-A292C-A202L in Example 7 at 35°C, 50°C and 65°C.

7 is a graph showing the conversion rate of 400 mM PPO catalyzed by immobilized cells of engineered bacteria E. coli BL21(DE3)-KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH in Example 9.

FIG. 8 is a bar chart of the reaction batch conversion rate of free cells and immobilized cells of engineering bacteria E. coli BL21(DE3)-KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH in Example 9. FIG.

(5) Specific implementation methods

The present invention is further described below in conjunction with specific embodiment, but the protection scope of the present invention is not limited to this:

In the following examples, the molecular formula of diatomite is SiO ₂ , the molecular weight is 60.08, and the median particle size is 19.6 μm, which was purchased from Aladdin Company. The molecular formula of bentonite is Al ₂ O ₃ ·4(SiO ₂ )·H ₂ O, the molecular weight is 360.31, and it was purchased from Aladdin Company. The molecular formula of activated carbon is C, the molecular weight is 12.01, and it was purchased from Aladdin Company. The composition of montmorillonite is Al ₂ O ₃ 16.54%, MgO ₄ 65%, SiO ₂ 50.95%, purchased from Aladdin Company. The molecular weights of polyethyleneimine were 700, 1800, 10000 and 70000, respectively, and were purchased from Aladdin Company.

Example 1: Construction and screening of glufosinate-ammonium dehydrogenase mutant library

1. Glufosinate-ammonium dehydrogenase parent engineering bacteria

The wild-type glufosinate-ammonium dehydrogenase KmGDH nucleotide sequence (NCBI accession number WP_010290083.1) derived from Kurthia massiliensis was codon-optimized, and gene synthesis was performed by Hangzhou Qingke Biotechnology Co., Ltd. , the obtained KmGDH gene (the nucleotide sequence is shown in SEQ ID No.1, the amino acid sequence of the encoded protein is shown in SEQ ID No.2), cloned into the NcoI of MCS1 (multiple cloning site 1) of plasmid pETDuet , construct the recombinant expression vector pETDuet-KmGDH, retain the His-Tag gene of the plasmid itself, transform it into Escherichia coli E.coli BL21 (DE3), and send it to Hangzhou Qingke Biotechnology Co., Ltd. to synthesize glufosinate dehydrogenase parent engineering bacteria E .coli BL21(DE3)/pETDuet-KmGDH.

SEQ ID NO.1

atggcagaaaacctgaacttatttacgagcacccaggcgattattaaagaagcgctgcagaaactgggctacgatgaggcgatgtatgacttactgaaagaaccgctgcgtatgctgcaggttagaatcccggtccgtatggacgacggcaccgttaccgttttcacaggttatcgtgcccaacataatgatgcagttggcccgaccaagggtggcgtacgttttcatccgaatgttagtgaagaagaagttaaagcactgagcatgtggatgaccctgaaagcaggtattgttgatttaccatatgggggtggtaaaggcggcgtgatttgtgatcctcgtcagatgagcatgggtgaactggaaagattaagccgtggatatgttcgggcaacctcgcagattgttggtccgaccaaagatattccggcaccggatgtttttaccaatgcacaaattatggcatggatgatggatgaatatagccgtatggatgaatttaatagcccgggctttataacgggtaaacctattgtgttaggtggtagtcaggggcgtgatcgtgccacagcccagggcgtaacgattgttatagaacaggcagcaaaacggcggaatctgcaaatcgaaggtgcaagagtggtgattcagggatttggaaatgcaggtagctttctggctaaattcatgaatgatctgggcgcgaaagtggtgggtattagtgacgcaaatggcgcactgtacgatccggaaggactggatattgattatctgttagaccgtcgtgatagttttggtaccgttactaatctgtttgaaaataccattaccaacgaagaacttttagaattagagtgtgatatcctggttccggctgccattgaaaaccaaattacagcagaaaatgcacataatatcaaggccaacattgttgtggaagcagcaaacggaccgaccacccaggaagccacaaaaatactgaccgagcgtggagttctgc tggtgccggacgttttagcaagcgcaggtggcgttacagtaagctactttgaatgggttcagaataatcagggctattactggagtgaagaagaggttaatgataaattatacaagaagaagatggtggaggcgtttgataatatttataatgtggcagaagcccgcaaaatagatatgagactggcggcatatatggtgggcgttagaaaaacagcagaagcaagccggtttagaggtggt.

SEQ ID NO.2

MAENLNLFTSTQAIIKEALQKLGYDEAMYDLLKEPLRMLQVRIPVRMDDGTVTVFTGYRAQHNDAVGPTKGGVRFHPNVSEEEVKALSMWMTLKAGIVDLPYGGGKGGVICDPRQMSMGELERLSRGYVRATSQIVGPTKDIPAPDVFTNAQIMAWMMDEYSRMDEFNSPGFITGKPIVLGGSQGRDRATAQGVTIVIEQAAKRRNLQIEGARVVIQGFGNAGSFLAKFMNDLGAKVVGISDANGALYDPEGLDIDYLLDRRDSFGTVTNLFENTITNEELLELECDILVPAAIENQITAENAHNIKANIVVEAANGPTTQEATKILTERGVLLVPDVLASAGGVTVSYFEWVQNNQGYYWSEEEVNDKLYKKMVEAFDNIYNVAEARKIDMRLAAYMVGVRKTAEASRFRGWV。

2. Departure co-expression strains

The formate dehydrogenase gene PseFDH derived from Pseudomonas sp. was then synthesized (PDB accession number is 2GUG_A, and the nucleotide sequence is shown in SEQ ID No. 3), which was constructed by Vazyme's One Step Cloning Kit To the NdeI of MCS2 (multiple cloning site 2) of the recombinant expression vector pETDuet-KmGDH, the co-expression vector pETDuet-KmGDH-PseFDH was obtained, and it was transformed into E. coli BL21 (DE3) to obtain the mother glufosinate dehydrogenase The strain E.coli BL21(DE3)/pETDuet-KmGDH-PseFDH was co-expressed with formate dehydrogenase.

SEQ ID NO.3

atggccaaagttctgtgtgtactgtatgacgacccggttgatggttaccctaaaacttacgcacgtgacgatctgccgaaaatcgaccactacccgggcggccagaccctgccgacgccgaaagcgatcgatttcactccgggccaactgctgggttctgtttctggtgaactgggcctgcgtaaatatctggaatccaacggccacaccctggtggtgaccagcgacaaagatggtccggactccgtgttcgaacgtgaactggttgatgctgacgttgtcattagccagccgttctggccggcgtatctgaccccggaacgcatcgccaaagctaaaaacctgaaactggcactgaccgcaggtattggttctgaccacgttgatctgcagtccgccatcgatcgtaacgttaccgttgccgaagtaacctactgtaactctatctccgtggctgaacatgtggttatgatgatcctgtctctggttcgcaactatctgccgtctcatgaatgggcgcgtaaaggcggctggaacatcgctgattgtgtcagccatgcgtatgacctggaagcaatgcatgtgggcactgttgcagctggtcgcatcggcctggctgtcctgcgtcgcctggcaccattcgacgtacacctgcactacactgaccgtcaccgtctgccagaaagcgtggagaaagaactgaacctgacctggcatgctactcgcgaagacatgtacccggtgtgcgacgttgttaccctgaactgtccactgcacccggagaccgaacacatgattaacgatgaaaccctgaagctgttcaaacgtggcgcgtacatcgtaaacacggctcgtggtaagctgtgcgatcgtgacgctgtggcacgtgcgctggaatctggtcgcctggccggttacgctggtgatgtatggtttccacagccggctccgaaagaccacccgtggcgcaccatgccttacaatggtatgaccccgcaca tttctggtaccactctgaccgcacaggcgcgttacgcagcgggtacccgtgaaattctggagtgcttctttgaaggtcgcccgatccgtgatgaatacctgatcgttcagggtggtgcgctggctggcactggtgctcattcctactctaaaggtaacgcgaccggtggttctgaagaggcggcgaaattcaaaaaggccgtt.

3. Glufosinate-ammonium dehydrogenase mutant library

The preparation of the glufosinate-ammonium dehydrogenase mutant library was achieved by seven rounds of site-directed saturation mutagenesis. The primers were designed as shown in Table 1, and the specific operations were as follows:

(1) Using the vector pETDuet-KmGDH-PseFDH as the template and the sequence (P145) in Table 1 as the primer, PCR site-directed saturation mutation was performed, and the PCR result was verified by DNA agarose gel electrophoresis. DpnI enzyme was added to the positive PCR product It is used to digest the template, react at 37°C and 220 rpm for 1 hour, and then inactivate at 65°C for 1 minute to obtain the digested PCR product. The digested PCR product was heat-shock transformed into E.coli BL21(DE3) competent cells, placed at 37°C and activated at 220 rpm for 1 hour, and the culture was then coated with 50 μg/mL ampicillin-resistant On the LB plate, invert at 37°C overnight to obtain a positive clone with a saturation mutation at the P145 site (the 145th position of the amino acid sequence shown in SEQ ID No. 2 is mutated to other 19 amino acids).

(2) Replace the primers in step (1) with those shown in Table 1, and repeat step (1) for site-directed saturation mutation to obtain the following clones: mutant S348 (serine at position 348 of the amino acid sequence shown in SEQ ID No.2) mutated to other 19 amino acids), V384 (the 384th valine of the amino acid sequence shown in SEQ ID No.2 was mutated to other 19 amino acids), K70 (the 70th lysine of the amino acid sequence shown in SEQ ID No.2) Mutated to other 19 amino acids), A292 (Alanine at position 292 of the amino acid sequence shown in SEQ ID No. 2 was mutated to other 19 amino acids), A202 (Alanine at position 202 of the amino acid sequence shown in SEQ ID No. 2) mutated to other 19 amino acids), N78 (asparagine at position 78 of the amino acid sequence shown in SEQ ID No. 2 was mutated to other 19 amino acids), Q134 (glutamine at position 134 of the amino acid sequence shown in SEQ ID No. 2) mutated to other 19 amino acids), D146 (aspartic acid at position 146 of the amino acid sequence shown in SEQ ID No. 2 was mutated to other 19 amino acids), R74 (arginine at position 74 of the amino acid sequence shown in SEQ ID No. 2) Acid mutated to other 19 amino acids), K106 (the 106th lysine of the amino acid sequence shown in SEQ ID No. 2 was mutated to other 19 amino acids).

(3) Multiple mutations

Using the single mutant plasmid obtained in step (2) as a template, the second, third and fourth rounds of site-directed saturation mutagenesis were continued with other primers shown in Table 1 to obtain a mutant library. Specifically, the P145 mutant was used as the template, and the S348 primer was used for the second round of mutation to obtain the P145-S348 double-site saturation mutation; the P145 mutant was used as the template, the V384 primer was used for the second round of mutation, and the K70 primer was used for the first round of mutation. Three rounds of mutation were performed to obtain the three-point saturation mutation of P145-V384-K70; the P145 mutant was used as the template, the V384 primer was used for the second round of mutation, and the N78 primer was used for the third round of mutation to obtain the three-point P145-V384-N70 three-point mutation Using the P145 mutant as the template, the V384 primer was used for the second round of mutation, the K70 primer was used for the third round of mutation, and the A292 primer was used for the fourth round of mutation to obtain the four-site saturation mutation of P145-V384-K70-A292 ; Take the P145 mutant as the template, use the V384 primer to carry out the second round of mutation, the S348 primer to carry out the third round of mutation, the A292 primer to carry out the fourth round of mutation, and the A202 primer to carry out the fifth round of mutation to obtain P145-V384-S348-A292- Saturation mutation at five-site A202.

Mutation PCR system (100 μL): 2 times Phanta Max buffer 25 μL, 1 μL dNTPs, 1 μL upper and lower primers for mutation, 1 μL template, 0.5 μL Phanta Super-Fidelity DNA polymerase, supplemented with ddH ₂ O to 50 μL. PCR conditions were: pre-denaturation at 95°C for 5 minutes, followed by 30 cycles of: 90°C for 30 seconds, 62°C for 30 seconds, 72°C for 7 minutes, and a final extension at 72°C for 5 minutes.

The mutant co-expression strains constructed in steps (1), (2) and (3) were induced and expressed according to the method of Example 2, and the dominant mutants were screened according to the method of Example 3, and the obtained dominant strains were sent to Hangzhou Qingke Biology Technology Co., Ltd. conducts sequencing confirmation and saves.

Table 1 Design of primers for site-directed saturation mutagenesis of glufosinate-ammonium dehydrogenase

In Table 1, N represents any one of the four bases of A, T, G, and C, and K represents any one of the two bases of G and T. The codons formed by the combination of NNK can cover all 20 amino acids.

Example 2: Induction and expression of glufosinate-ammonium dehydrogenase mutant engineering bacteria

The glufosinate-ammonium dehydrogenase parent engineering bacteria in Example 1, the glufosinate-ammonium dehydrogenase parent and formate dehydrogenase co-expression strain and the glufosinate-ammonium dehydrogenase mutant co-expressed with formate dehydrogenase The strains were respectively inoculated into the LB liquid medium containing the final concentration of 50 μg/mL ampicillin, cultivated at 37°C for 8 hours, and inoculated into fresh LB liquid containing the final concentration of 50 μg/mL ampicillin with the volume concentration of 2% of the inoculum. In the medium, culture at 37°C and 180 rpm for 2 hours, then add 0.1 mM IPTG to the culture medium, and after culturing at 18°C for 14 hours, centrifuge at 4°C and 8000 rpm for 10 minutes to obtain the corresponding wetness. Bacteria. The composition of LB liquid medium: 10g/L peptone, 5g/L yeast powder, 10g/L sodium chloride, the solvent is water, and the pH value is natural.

SDS-PAGE detection was performed on the wet cells of the glufosinate-ammonium dehydrogenase parent engineering bacteria (lane 3) and the co-expressing strains (lane 2) from the parent glufosinate dehydrogenase and formate dehydrogenase, and the results are shown in the figure 2 shown.

The cells obtained above produce corresponding proteins, which can be used for the preparation of protein-pure enzyme solutions and also for the preparation of immobilized cells.

Example 3: Mutation Library Screening

The glufosinate-ammonium dehydrogenase parent engineering bacteria prepared by the method of Example 2, the glufosinate-ammonium dehydrogenase parent and formate dehydrogenase co-express wet cells or the glufosinate-ammonium dehydrogenase mutant and formate dehydrogenase Enzyme co-expression Wet cells were used as catalysts, 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid was used as substrate, ammonium formate was used as coenzyme regeneration substrate, and a small amount of NAD ⁺ was added exogenously to pH 7.4 , 100 mM phosphate buffer as the reaction medium to form a 1 mL reaction system, the final concentration of catalyst is 10 g/L based on the weight of wet cells, the final concentration of substrate is 100 mM, the final concentration of ammonium formate is 125 mM, and the final concentration of NAD ⁺ 1 mM, 35 ° C, 600 rev/min reaction for 5min. Take 50 μL of the reaction solution, add 5 μL hydrochloric acid (6mol/L) to stop the reaction, dilute the reaction solution 100 times with distilled water, take 200 μL of the diluted reaction solution + 400 μL derivatization reagent (containing 15mM o-phthalaldehyde, 15mM N-acetyl-L) - Cysteine boric acid buffer (pH 9.8) derivatized at 30°C for 5 min, add 400 μL ultrapure water to make up to 1 mL, centrifuge at 12,000 rpm for 1 minute, take the supernatant, pass through a 0.22 μM microfiltration membrane, and collect The filtrate was used as a liquid sample, and high performance liquid chromatography was used to detect the peak areas of 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid, L-glufosinate-ammonium, and D-glufosinate-ammonium, and obtained the respective standard curves according to their respective standard curves. content, calculate the ee value. Using the products L-glufosinate-ammonium and ee as indicators, the dominant mutants were screened, and the experimental results are shown in Table 2.

C18(4.6×250mm，Acchrom，China)柱，流动相乙腈：50mM磷酸二氢铵溶液(pH3.8，含10％四丁基氢氧化铵)体积比为12∶88。流速为1mL/min，检测波长为232nm，进样量10μL，柱温30℃，2-羰基-4-(羟基甲基膦酰基)-丁酸保留时间为：9.7分钟。2-Carbonyl-4-(hydroxymethylphosphono)-butyric acid Liquid phase detection conditions: chromatographic column

C18 (4.6×250 mm, Acchrom, China) column, mobile phase acetonitrile: 50 mM ammonium dihydrogen phosphate solution (pH 3.8, containing 10% tetrabutylammonium hydroxide) in a volume ratio of 12:88. The flow rate was 1 mL/min, the detection wavelength was 232 nm, the injection volume was 10 μL, the column temperature was 30°C, and the retention time of 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid was 9.7 minutes.

C18(4.6×250mm，Acchrom，China)柱，流动相甲醇∶0.05M乙酸铵(pH 5.7)体积比为10∶90，流速1.0mL/min，检测波长Ex＝340nm、Em＝450nm，进样量10μL，柱温35℃。L-草铵膦、D-草铵膦保留时间分别为：10.6分钟，12.6分钟。Glufosinate-ammonium liquid detection conditions: chromatographic column

C18 (4.6×250mm, Acchrom, China) column, mobile phase methanol: 0.05M ammonium acetate (pH 5.7) volume ratio of 10:90, flow rate 1.0mL/min, detection wavelength Ex=340nm, Em=450nm, injection volume 10 μL, column temperature 35°C. The retention times of L-glufosinate-ammonium and D-glufosinate-ammonium were 10.6 minutes and 12.6 minutes, respectively.

Concentration-peak area standard curves were drawn using 2-carbonyl-4-(hydroxymethylphosphinyl)-butyric acid and glufosinate-ammonium standards (Figure 3 and Figure 4, respectively), and the sample concentrations were calculated using the standard curves. Cell viability was calculated from the amount produced.

Table 2 The catalytic performance and stereoselectivity of wet cells containing KmGDH and dominant mutants

Mutation site L-Glufosinate-ammonium (mM) e.e(%) Wild-type enzyme - PseFDH 0.325 99.9 P145G-PseFDH 14.221 99.9 S348A-PseFDH 9.237 99.9 R74A-PseFDH 1.215 99.9 K106A-PseFDH 2.023 99.9 P145G-V384Q-N78S-PseFDH 20.265 99.9 D134G-V384Q-A292C-PseFDH 5.256 99.9 P145G-V384F-K70A-PseFDH 25.268 99.9 D146A-V384Q-K70A-PseFDH 4.025 99.9 P145G-D134G-N78S-PseFDH 1.599 99.9 P145G-V384Y-S348A-A292C-A202L-PseFDH 38.259 99.9

Note: P145G-V384Q-N78S represents the mutation of proline 145 to glycine, valine 384 to glutamine, and asparagine 78 to serine in KmGDH.

The co-expression strains E.coli BL21(DE3)-KmGDH-P145G,

E.coli BL21(DE3)-KmGDH-S348A,

E.coli BL21(DE3)-KmGDH-P145G-V384Q-N78S-PseFDH,

E.coli BL21(DE3)-KmGDH-P145G-V384F-K70A-PseFDH,

E. coli BL21(DE3)-KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH.

Example 4: Purification of the parent glufosinate dehydrogenase and its mutants

Corresponding wet cells were prepared according to the method of Example 2 by co-expressing the parent glufosinate dehydrogenase constructed in Example 1 and co-expressing the engineering bacteria with the dominant mutant screened in Example 3.

Take 0.2 g of the wet cells of the glufosinate-ammonium dehydrogenase parent co-expressing engineering bacteria and the glufosinate-ammonium dehydrogenase mutant co-expressing engineering bacteria, respectively, with 10 ml of binding buffer (pH 7.4, 100 mM containing 0.3 M NaCl) Sodium phosphate buffer), sonicated for 15 minutes (ice bath, power 400W, crushed for 1 second, paused for 5 seconds), centrifuged at 4°C, 12,000 rpm for 20 min, and the supernatant was taken as the loading sample. Use Ni affinity column (1.6×10cm, Bio-Rad Company, USA) to purify the KmGDH monomer protein. The specific operations are as follows: ①Use 5 times the column volume of binding buffer (pH 7.4 containing 0.3M NaCl, 50mM sodium phosphate) Buffer) to equilibrate the Ni column until the baseline is stable; ② Load the sample at a flow rate of 1 mL/min, and the loading volume is 2 times the column volume to adsorb the target protein on the Ni column; ③ Use 6 times the column volume of buffer A (containing 6 times the column volume) 0.3M NaCl, 30mM imidazole pH7.4, 50mM sodium phosphate buffer) to wash the impurity protein, the flow rate is 1mL/min, until the baseline is stable; ④ Use 2 column volumes of buffer B (containing 0.3M NaCl, 500mM imidazole pH7 .4, 50mM sodium phosphate buffer) elution, the flow rate is 1mL/min, and the target protein is collected. The target protein was dialyzed in pH 7.4 and 20 mM phosphate buffer overnight, and the retentate was collected to obtain 10 ml of the parental pure enzyme of glufosinate dehydrogenase and 10 ml of the mutant pure enzyme of glufosinate dehydrogenase; ⑤ 5 times column The Ni column was rinsed with a volume of binding buffer (pH 8.0, 50 mM sodium phosphate buffer containing 0.3 M NaCl) until the baseline stabilized, and the Ni column was stored with 5 column volumes of ultrapure water containing 20% ethanol.

The protein concentration of the pure enzyme was determined with a BCA protein assay kit (Nanjing Keygen Biotechnology Development Co., Ltd., Nanjing), as shown in Table 3.

Example 5: Determination of specific enzyme activity of glufosinate-ammonium dehydrogenase parent and its mutants

The unit of enzyme activity (U) is defined as: the amount of enzyme required to generate 1 μmol of L-glufosinate per minute at 35° C. and pH 7.4 is defined as one unit of enzyme activity, U. Specific enzyme activity is defined as the unit of activity per milligram of enzyme protein, U/mg.

Standard conditions for enzyme activity detection: 100mM 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid, add 50mM NADH, pure enzyme solution containing 200μg protein content (prepared by the method of Example 4), pH7.4, 50mM Sodium phosphate buffer was used as the reaction medium to form a 1 mL reaction system. The reaction was carried out at 30° C., pH 7.4, and 600 rpm for 10 minutes. The method of Example 3 was used for HPLC detection and analysis. The relative enzyme activity is shown in Table 3.

Table 3 Specific enzyme activity of glufosinate-ammonium dehydrogenase parent and its mutant

^a : The initial enzymatic activity of each parent glufosinate dehydrogenase was assigned as 100% under standard conditions.

Example 6: Determination of kinetic parameters of the parent glufosinate dehydrogenase and its mutants

To investigate the kinetic parameters of the parent glufosinate dehydrogenase and its mutants, 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid was used as the substrate, and the concentration was set to 20-200 mM (20, 50, 100, 150, 200 mM), add enough coenzyme, and add an appropriate amount of pure enzyme solution (collected by the method of Example 4).

The reaction system was chosen to be 500 μL: the parent and mutant pure enzyme solutions collected by the method in Example 4 were diluted with pH 7.4 and 100 mM phosphate buffer. Take the diluted pure enzyme solution, add the substrate and exogenous coenzyme NADH, pH 7.4, 100mM phosphate buffer as the reaction medium to form a 500 μL reaction system, in which the amount of pure enzyme added is 200 mg/L in terms of protein content, and the bottom is 200 mg/L. The concentration of NADH was 20-200mM (20, 50, 100, 150, 200mM), the concentration of NADH was 50mM, and the reaction was performed at 35°C and 600 rpm for 10min.

K _cat , v _max , and K _m can be calculated by double-reciprocal plotting, and the results are shown in Table 4. By comparing k _cat and K _m , it can be found that KmGDH has a significant effect on 2-carbonyl-4-(hydroxymethylphosphono )-butyric acid had a Km value of 8.56 mM, and the remaining mutants showed an increasing affinity for 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid. The catalytic efficiency k _cat /K _m of mutant KmGDH-P145G-V384Y-S348A-A292C-A202L towards 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid reached 396.8s ^-1 *M ^-1 , parent (k _cat /K _m =3.2s ^-1 *M ^-1 ) is improved by a factor of 124.

Table 4 Comparison of kinetic parameters of parental KmGDH and its mutants

enzyme K_cat(s^-1) k_m(M) k_cat/k_m(s^-1*M^-1) KmGDH 1.30±0.1 0.41±0.02 3.2 KmGDH-P145G 54.1±4.2 0.35±0.07 154.6 KmGDH-S348A 33.6±3.8 0.40±0.03 84.0 KmGDH-P145G-V384Q-N78S 71.4±3.1 0.32±0.01 223.1 KmGDH-P145G-V384F-K70A 72.4±2.8 0.22±0.05 329.1 KmGDH-P145G-V384Y-S348A-A292C-A202L 75.4±1.2 0.19±0.01 396.8

Example 7: Determination of thermostability of the parent glufosinate dehydrogenase and its mutants

To investigate the thermal stability of the co-expressed enzyme of the parent and its mutants of glufosinate-ammonium dehydrogenase, 20 ml of the pure enzyme solution of the parent and mutant KmGDH-P145G-V384Y-S348A-A292C-A202L collected by the method in Example 4 were placed separately Incubate in a water bath at 35°C, 50°C, and 65°C, and take out an appropriate amount of enzyme solution every 4 h for activity determination (according to Example 5). The half-life was calculated after fitting the obtained data after 24 hours of continuous measurement. The thermal stability of the parent glufosinate dehydrogenase and mutant KmGDH-P145G-V384Y-S348A-A292C-A202L are shown in Figure 5 and Figure 6, respectively. The half-lives at 35℃, 50℃ and 65℃ were 18.4h, 11.2h and 6.9h, respectively; the half-lives of the mutant KmGDH-P145G-V384Y-S348A-A292C-A202L at 35℃, 50℃ and 65℃ were 294.7 h, 143.0h and 25.7h.

Example 8: Preparation of immobilized cells of glufosinate-ammonium dehydrogenase mutant engineering bacteria

(1) Prepare 100 g of wet cells of the mutant co-expressing E.coli BL21(DE3)-KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH engineering bacteria according to the method of Example 2, add pH7.5 phosphate buffer 1L, prepare a suspension of 100g/L, add 2.25g of diatomaceous earth, and fully stir for 30min;

(2) to the mixed solution of step (1), add polyethyleneimine (molecular weight 10000) 3mL (pre-adjust pH to 7.0 with hydrochloric acid), fully stir for 30min;

(3) add glutaraldehyde 3mL to the mixed solution of step (2), continue to fully stir for 30min;

(4) Step (3) Vacuum filtration to separate solid and liquid, collect 150 g of immobilized cells (wet cell content 0.67 g/g immobilized cells), wash with water 3 times, and store in a 4°C refrigerator.

Example 9: Immobilized cell performance assay and its use in L-glufosinate synthesis

1. Enzyme activity

Take 0.5 g of immobilized cells (containing 0.2 g of wet cells) prepared in Example 8 in 10 mL of pH 7.5 phosphate buffer, add 100 mM of 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid, 150mM ammonium formate, 1mM NAD+ constitute a 1mL reaction system, react at 35°C and 600rpm for 10min, take samples, use the HPLC described in Example 3 to detect the concentration of the product L-glufosinate-ammonium, and calculate the immobilized cells according to the enzyme activity test method in Example 5 enzyme activity.

Under the same conditions, the enzyme activity of the wet cells of the mutant co-expressing E.coli BL21(DE3)-KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH engineering bacteria was detected as free cell enzyme activity.

The enzyme activity recovery rate of immobilized cells was calculated by dividing the enzyme activity of immobilized cells by the enzyme activity of free cells.

The results showed that the enzymatic activity of immobilized cells was 162.5 U/g, and the recovery rate of enzymatic activity was 78.1%.

2. Reuse

Take 37.5 g of immobilized cells (containing 25 g of wet cells) prepared by the method of Example 8 into a 3 L mechanically stirred reactor equipped with 1 L of phosphate buffer (pH=7.5, 100 mM), add 2-carbonyl-4- (Hydroxymethylphosphono)-butyric acid 400mM, ammonium formate 600mM, NAD ⁺ 0.1mM, 35°C, 600rpm stirring speed reaction for 8h, sampling every 0.5h, using the method described in Example 3 to detect the substrate and product L- The concentration of glufosinate-ammonium, the substrate conversion rate and the ee value were calculated, and the results are shown in Figure 7. Figure 7 shows that using immobilized cells as a catalyst can achieve complete conversion of 400 mM substrate PPO within 4 h, and the product-to-ee value is greater than 99.9%.

After the reaction, the reaction solution was vacuum filtered for solid-liquid separation, and the precipitate (i.e., the immobilized cells) was washed three times with distilled water, and then the next batch of transformation was carried out, and the conversion rate of each batch was calculated. The results are shown in Figure 8. Under the same conditions, the immobilized cells were replaced with wet cells of E.coli BL21(DE3)-KmGDH-P145G-V384Y-S348A-A292C-A202L-PseFDH engineering bacteria.

The results in Figure 8 show that 22 batches of immobilized cells can still maintain a 100% conversion rate, while under the same reaction conditions, the conversion rate of the unimmobilized wet cells starts to drop significantly from the second batch. Repeated use Completely lost vitality after 4 batches.

Example 10: Preparation and performance testing of glufosinate-ammonium dehydrogenase mutant immobilized cells

The preparation method is the same as in Example 8, except that the carrier in step (1) is changed to activated carbon, the molecular weight of polyethyleneimine in step (2) is 1800, and the crosslinking agent used in step (3) is dialdehyde starch.

The properties of the obtained immobilized cells were determined as follows: the enzymatic activity of the immobilized cells was 106.4 U/g, and the conversion rate was 68.7% after 20 batches of continuous transformation.

Example 11: Preparation and performance testing of glufosinate-ammonium dehydrogenase mutant immobilized cells

The preparation method is the same as that in Example 8, except that the carrier in step (1) is changed to bentonite, the molecular weight of polyethyleneimine in step (2) is 700, and the crosslinking agent used in step (3) is glutaraldehyde.

The properties of the obtained immobilized cells were determined as follows: the enzymatic activity of the immobilized cells was 154.3 U/g, and the conversion rate after 20 batches of continuous transformation was 65.1%.

Example 12: Preparation and performance testing of glufosinate-ammonium dehydrogenase mutant immobilized cells

The preparation method is the same as in Example 8, except that the carrier in step (1) is changed to montmorillonite, the molecular weight of polyethyleneimine in step (2) is 70000, and the crosslinking agent used in step (3) is glyoxal .

The properties of the obtained immobilized cells were determined as follows: the enzymatic activity of the immobilized cells was 80.7 U/g, and the conversion rate was 56.6% after 20 batches of continuous transformation.

sequence listing

<110> Zhejiang University of Technology

<120> Glufosinate-ammonium dehydrogenase mutants, engineered bacteria, immobilized cells and applications

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1242

<212> DNA

<213> Kurthia massiliensis

<400> 1

atggcagaaa acctgaactt atttacgagc acccaggcga ttattaaaga agcgctgcag 60

aaactgggct acgatgaggc gatgtatgac ttactgaaag aaccgctgcg tatgctgcag 120

gttagaatcc cggtccgtat ggacgacggc accgttaccg ttttcacagg ttatcgtgcc 180

caacataatg atgcagttgg cccgaccaag ggtggcgtac gttttcatcc gaatgttagt 240

gaagaagaag ttaaagcact gagcatgtgg atgaccctga aagcaggtat tgttgattta 300

ccatatgggg gtggtaaagg cggcgtgatt tgtgatcctc gtcagatgag catgggtgaa 360

ctggaaagat taagccgtgg atatgttcgg gcaacctcgc agattgttgg tccgaccaaa 420

gatattccgg caccggatgt ttttaccaat gcacaaatta tggcatggat gatggatgaa 480

tatagccgta tggatgaatt taatagcccg ggctttataa cgggtaaacc tattgtgtta 540

ggtggtagtc aggggcgtga tcgtgccaca gcccagggcg taacgattgt tatagaacag 600

gcagcaaaac ggcggaatct gcaaatcgaa ggtgcaagag tggtgattca gggatttgga 660

aatgcaggta gctttctggc taaattcatg aatgatctgg gcgcgaaagt ggtgggtatt 720

agtgacgcaa atggcgcact gtacgatccg gaaggactgg atattgatta tctgttagac 780

cgtcgtgata gttttggtac cgttactaat ctgtttgaaa ataccattac caacgaagaa 840

cttttagaat tagagtgtga tatcctggtt ccggctgcca ttgaaaacca aattacagca 900

gaaaatgcac ataatatcaa ggccaacatt gttgtggaag cagcaaacgg accgaccacc 960

caggaagcca caaaaatact gaccgagcgt ggagttctgc tggtgccgga cgttttagca 1020

agcgcaggtg gcgttacagt aagctacttt gaatgggttc agaataatca gggctattac 1080

tggagtgaag aagaggttaa tgataaatta tacaagaaga tggtggaggc gtttgataat 1140

atttataatg tggcagaagc ccgcaaaata gatatgagac tggcggcata tatggtgggc 1200

gttagaaaaa cagcagaagc aagccggttt agaggctggg tt 1242

<210> 2

<211> 414

<212> PRT

<213> Kurthia massiliensis

<400> 2

Met Ala Glu Asn Leu Asn Leu Phe Thr Ser Thr Gln Ala Ile Ile Lys

1 5 10 15

Glu Ala Leu Gln Lys Leu Gly Tyr Asp Glu Ala Met Tyr Asp Leu Leu

20 25 30

Lys Glu Pro Leu Arg Met Leu Gln Val Arg Ile Pro Val Arg Met Asp

35 40 45

Asp Gly Thr Val Thr Val Phe Thr Gly Tyr Arg Ala Gln His Asn Asp

50 55 60

Ala Val Gly Pro Thr Lys Gly Gly Val Arg Phe His Pro Asn Val Ser

65 70 75 80

Glu Glu Glu Val Lys Ala Leu Ser Met Trp Met Thr Leu Lys Ala Gly

85 90 95

Ile Val Asp Leu Pro Tyr Gly Gly Gly Lys Gly Gly Val Ile Cys Asp

100 105 110

Pro Arg Gln Met Ser Met Gly Glu Leu Glu Arg Leu Ser Arg Gly Tyr

115 120 125

Val Arg Ala Thr Ser Gln Ile Val Gly Pro Thr Lys Asp Ile Pro Ala

130 135 140

Pro Asp Val Phe Thr Asn Ala Gln Ile Met Ala Trp Met Met Asp Glu

145 150 155 160

Tyr Ser Arg Met Asp Glu Phe Asn Ser Pro Gly Phe Ile Thr Gly Lys

165 170 175

Pro Ile Val Leu Gly Gly Ser Gln Gly Arg Asp Arg Ala Thr Ala Gln

180 185 190

Gly Val Thr Ile Val Ile Glu Gln Ala Ala Lys Arg Arg Asn Leu Gln

195 200 205

Ile Glu Gly Ala Arg Val Val Ile Gln Gly Phe Gly Asn Ala Gly Ser

210 215 220

Phe Leu Ala Lys Phe Met Asn Asp Leu Gly Ala Lys Val Val Gly Ile

225 230 235 240

Ser Asp Ala Asn Gly Ala Leu Tyr Asp Pro Glu Gly Leu Asp Ile Asp

245 250 255

Tyr Leu Leu Asp Arg Arg Asp Ser Phe Gly Thr Val Thr Asn Leu Phe

260 265 270

Glu Asn Thr Ile Thr Asn Glu Glu Leu Leu Glu Leu Glu Cys Asp Ile

275 280 285

Leu Val Pro Ala Ala Ile Glu Asn Gln Ile Thr Ala Glu Asn Ala His

290 295 300

Asn Ile Lys Ala Asn Ile Val Val Glu Ala Ala Asn Gly Pro Thr Thr

305 310 315 320

Gln Glu Ala Thr Lys Ile Leu Thr Glu Arg Gly Val Leu Leu Val Pro

325 330 335

Asp Val Leu Ala Ser Ala Gly Gly Val Thr Val Ser Tyr Phe Glu Trp

340 345 350

Val Gln Asn Asn Gln Gly Tyr Tyr Trp Ser Glu Glu Glu Val Asn Asp

355 360 365

Lys Leu Tyr Lys Lys Met Val Glu Ala Phe Asp Asn Ile Tyr Asn Val

370 375 380

Ala Glu Ala Arg Lys Ile Asp Met Arg Leu Ala Ala Tyr Met Val Gly

385 390 395 400

Val Arg Lys Thr Ala Glu Ala Ser Arg Phe Arg Gly Trp Val

405 410

<210> 3

<211> 1203

<212> DNA

<213> Pseudomonas sp.

<400> 3

atggccaaag ttctgtgtgt actgtatgac gacccggttg atggttaccc taaaacttac 60

gcacgtgacg atctgccgaa aatcgaccac tacccgggcg gccagaccct gccgacgccg 120

aaagcgatcg atttcactcc gggccaactg ctgggttctg tttctggtga actgggcctg 180

cgtaaatatc tggaatccaa cggccacacc ctggtggtga ccagcgacaa agatggtccg 240

gactccgtgt tcgaacgtga actggttgat gctgacgttg tcattagcca gccgttctgg 300

ccggcgtatc tgaccccgga acgcatcgcc aaagctaaaa acctgaaact ggcactgacc 360

gcaggtattg gttctgacca cgttgatctg cagtccgcca tcgatcgtaa cgttaccgtt 420

gccgaagtaa cctactgtaa ctctatctcc gtggctgaac atgtggttat gatgatcctg 480

tctctggttc gcaactatct gccgtctcat gaatgggcgc gtaaaggcgg ctggaacatc 540

gctgattgtg tcagccatgc gtatgacctg gaagcaatgc atgtgggcac tgttgcagct 600

ggtcgcatcg gcctggctgt cctgcgtcgc ctggcaccat tcgacgtaca cctgcactac 660

actgaccgtc accgtctgcc agaaagcgtg gagaaagaac tgaacctgac ctggcatgct 720

actcgcgaag acatgtaccc ggtgtgcgac gttgttaccc tgaactgtcc actgcacccg 780

gagaccgaac acatgattaa cgatgaaacc ctgaagctgt tcaaacgtgg cgcgtacatc 840

gtaaacacgg ctcgtggtaa gctgtgcgat cgtgacgctg tggcacgtgc gctggaatct 900

ggtcgcctgg ccggttacgc tggtgatgta tggtttccac agccggctcc gaaagaccac 960

ccgtggcgca ccatgcctta caatggtatg accccgcaca tttctggtac cactctgacc 1020

gcacaggcgc gttacgcagc gggtacccgt gaaattctgg agtgcttctt tgaaggtcgc 1080

ccgatccgtg atgaatacct gatcgttcag ggtggtgcgc tggctggcac tggtgctcat 1140

tcctactcta aaggtaacgc gaccggtggt tctgaagagg cggcgaaatt caaaaaggcc 1200

gtt 1203

Claims (10)

1. A glufosinate-ammonium dehydrogenase mutant, characterized in that the mutant is the amino acid sequence of glufosinate-ammonium dehydrogenase shown in SEQ ID No. 2 at positions 145, 384, 348, The 292nd, 202nd, 70th, and 78th positions are obtained by single mutation or multiple mutation. 2. The glufosinate-ammonium dehydrogenase mutant according to claim 1, wherein the mutant is the amino acid sequence shown in SEQ ID No. 2 mutated into one of the following: (1) Proline at position 145 Acid is mutated to glycine, or serine 348 is mutated to alanine; (2) proline 145 is mutated to glycine, valine 384 is mutated to phenylalanine and lysine 70 is mutated to Alanine; (3) Proline 145 is mutated to glycine, valine 384 is mutated to glutamine and asparagine 78 is mutated to serine; (4) Proline 145 is mutated to Glycine, valine 384 to tyrosine, serine 348 to alanine, alanine 292 to cysteine and alanine 202 to leucine. 3. A gene encoding the glufosinate-ammonium dehydrogenase mutant of claim 1. 4. A recombinant genetic engineering bacterium constructed from the coding gene of claim 3. 5. recombinant genetic engineering bacterium as claimed in claim 4 is characterized in that described recombinant genetic engineering bacterium is constructed according to the following steps: the glufosinate-ammonium dehydrogenase mutant gene is cloned on the NcoI of the MCS1 of plasmid pETDuet, constructs recombination The expression vector retains the His-Tag gene of the plasmid itself; the formate dehydrogenase gene is then constructed on the NdeI of MCS2 of the recombinant expression vector to obtain a co-expression vector, which is transformed into Escherichia coli E.coli BL21 (DE3) to obtain glufosinate Recombinant genetically engineered bacteria co-expressing phosphine dehydrogenase mutants and formate dehydrogenase. 6. The application of a glufosinate-ammonium dehydrogenase mutant of claim 1 in catalyzing 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid to prepare L-glufosinate-ammonium. 7. application as claimed in claim 6, it is characterized in that described application method is: the wet bacterium that the recombinant genetic engineering bacterium containing glufosinate-ammonium dehydrogenase mutant gene and formate dehydrogenase gene is obtained through induction culture The immobilized cells prepared from bacterial cells or wet cells are used as catalysts, 2-carbonyl-4-(hydroxymethylphosphono)-butyric acid is used as substrate, ammonium formate is used as coenzyme regeneration substrate, and NAD ⁺ is added exogenously to pH 7.4, 100mM phosphate buffer is the reaction medium to form a reaction system, and the conversion reaction is carried out at 20-50 ° C and 200-800 r/min. After the reaction, the reaction solution is suction filtered, the filter cake is used to recover the catalyst, and the filtrate is separated and purified to obtain L-Glufosinate-ammonium. 8. application as claimed in claim 7 is characterized in that described immobilized cell is prepared by the following method: the wet thalline that described recombinant genetic engineering bacteria is obtained through fermentation culture is added in the phosphate buffer of pH6.0-8.0 , add the carrier, stir well for 20-30min, then add polyethyleneimine, stir well for 20-30min, then add cross-linking agent, stir well for 20-30min, filter under reduced pressure, and wash the filter cake with water to obtain the recombinant genetic engineering Bacteria immobilized cells; the carrier is activated carbon, diatomite, bentonite or montmorillonite; the cross-linking agent is glutaraldehyde, glyoxal or dialdehyde starch; the molecular weight of the polyethyleneimine is 600-70000 . 9. The application according to claim 8, wherein the volumetric dosage of the phosphate buffer is 5-20 mL/g in terms of wet cell weight; the carrier mass dosage is 2-10% of the cell mass; The dosage of the polyethyleneimine is 1-10 mL/100g based on the mass of the bacterial body; the dosage of the cross-linking agent is 1-10 mL/100 g based on the mass of the bacterial body. 10. The application according to claim 7, characterized in that in the reaction system, the amount of catalyst is 10-50g/L by volume of the reaction medium, the final concentration of the substrate is 100-400mM, the final concentration of ammonium formate is 100-800mM, and the NAD ⁺ Final concentration 0.05-2mM.

Images