CN110438055B

CN110438055B - Whole-cell catalyst containing phenylpyruvate decarboxylase mutant and application of whole-cell catalyst in production of phenethyl alcohol

Info

Publication number: CN110438055B
Application number: CN201910705699.4A
Authority: CN
Inventors: 陈守文; 占杨杨; 王欢; 石姣; 周梦林; 马昕
Original assignee: Hubei University
Current assignee: Hubei University
Priority date: 2019-08-01
Filing date: 2019-08-01
Publication date: 2022-05-27
Anticipated expiration: 2039-08-01
Also published as: CN110438055A

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to a whole-cell catalyst containing a phenylpyruvate decarboxylase mutant and application of the whole-cell catalyst in production of phenethyl alcohol. The invention uses phenylethanol tolerant bacteria bacillus licheniformis as an expression host, heterologously expresses a phenylpyruvate decarboxylase mutant from lactococcus lactis and alcohol dehydrogenase from the bacillus licheniformis through a free plasmid pHY300PLK, and obtains the recombinant bacillus licheniformis co-expressed by the phenylpyruvate decarboxylase and the alcohol dehydrogenase. And (3) producing the phenethyl alcohol by whole-cell catalysis of the recombinant bacteria by using the L-phenylalanine as a substrate. Has the advantages of low production cost, mild production conditions, less impurities in a conversion system, simple process steps, safe production operation and the like.

Description

Whole-cell catalyst containing phenylpyruvate decarboxylase mutant and application of whole-cell catalyst in production of phenethyl alcohol

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a whole-cell catalyst containing a phenylpyruvate decarboxylase mutant and application of the whole-cell catalyst in production of phenethyl alcohol.

Background

Phenethyl alcohol is an aromatic alcohol with elegant, fine and persistent rose fragrance. Due to its peculiar smell, phenethyl alcohol is widely used as a fragrance substance in perfumes, cosmetics and food industries. The phenethyl alcohol can also be used as an insecticide and a novel biofuel. Therefore, the phenethyl alcohol has wide application prospect.

Currently, the synthesis of phenethyl alcohol mainly comprises a chemical method and a biological method, and the biological method is divided into an extraction method and a fermentation method. In the process of phenethyl alcohol biosynthesis, phenylalanine generates phenylpyruvic acid through transamination, the phenylpyruvic acid is further decarboxylated into phenylacetaldehyde, and the phenylacetaldehyde is further reduced into phenethyl alcohol, and the process needs the participation of coenzyme NADH or NADPH. Whole cell transformation has the following advantages over the isolated enzyme: the whole-cell biocatalyst is easier to prepare and has low cost; compared with the separating enzyme, the separating enzyme is more stable, is not easily influenced by factors such as environmental temperature, pH and the like, and is convenient to use; no toxic and harmful products and no other by-products are produced in the conversion process. Is expected to realize the industrialized production of the phenethyl alcohol with low energy consumption, high efficiency, high purity and no pollution.

Heretofore, studies have been made on co-expression of three enzymes (phenylalanine transaminase, keto-acid decarboxylase and alcohol dehydrogenase) in yeast and E.coli and production of phenethyl alcohol by whole-cell transformation, but the methods have the following disadvantages: (1) escherichia coli is not a food-grade microorganism, and endotoxin generated in the fermentation process of Escherichia coli can bring about a new food safety problem; (2) the operation process of taking the escherichia coli as the whole-cell catalyst is complex, an inducer needs to be added in the culture process, and strict induction conditions are controlled; (3) the tolerance of the yeast and the escherichia coli to the phenethyl alcohol is low, and the high yield of the phenethyl alcohol is not facilitated; (3) the whole cell catalyst of the yeast is cultured for too long time, and the whole process is as long as 100 hours.

Ketoacid decarboxylase KivD from lactococcus lactis is a ketoacid decarboxylase with a wide substrate spectrum and can catalyze branched ketoacids, 3-methyl-2-oxobutanoic acid, 4-methyl-2-oxovaleric acid and 3-methyl-2-oxovaleric acid, aromatic ketoacids, 4-hydroxyphenylpyruvate, phenylpyruvic acid and benzoylformic acid, and linear ketoacid 2-oxohexanoic acid, 2-oxopentanoic acid and pyruvic acid at the same time. The KivD best suited substrate for the production of isobutanol was found by enzymatic profiling to be 3-methyl-2-oxobutanoic acid in branched-chain keto acids. Lactococcus lactis has been analyzed for protein structure, and researchers found that valine at position 461, serine at position 268, phenylalanine at position 381, and methionine at position 538 near the catalytic active center play important roles in substrate catalysis. The 4 amino acids become key targets for obtaining the corresponding products. Researchers Peter Lindblad et al constructed V461I (VI), V461L (VL), V461F (VF), V461A (VA), M538W (MW), S286T (ST), S286Y (SY), S286A (SA), F542L (FL) and F542W (FW) mutants by making a series of mutations at these four sites in order to increase the yield of isobutanol and increase the catalytic activity of KivD on 3-methyl-2-oxobutanoic acid. Among a plurality of mutants, only the isobutanol yield of ST and VI is greatly improved, and the catalytic activity of 3-methyl-2-oxobutanoic acid is improved. The James C.Liao subject group carries out double-site overlapping mutation on KivD to improve the synthesis of 3-methyl-1-pentanol, and the construction is strain mutant strains which are respectively V461A/M538A, V461A/M538L, V461A/F381A and V461A/F381L, wherein the yield of the 3-methyl-1-pentanol in the four mutants is improved by 20-50 times compared with that of a control strain, and the yield of the 3-methyl-1-pentanol in V461A/F381L is the highest and reaches 384.3 +/-30.3 mg/L. KivD was hardly used for the synthesis of phenethyl alcohol due to its low substrate affinity and catalytic efficiency for phenylpyruvic acid.

Disclosure of Invention

The invention provides a whole-cell catalyst containing a phenylpyruvic acid decarboxylase mutant for solving the defects in the prior art, and the whole-cell catalyst is a recombinant bacillus licheniformis containing the phenylpyruvic acid decarboxylase mutant and alcohol dehydrogenase.

The invention also aims to provide application of the whole-cell catalyst containing the phenylpyruvate decarboxylase mutant, and the cell catalyst can be used for preparing the phenethyl alcohol or the phenethyl alcohol derivative by directly using the L-phenylalanine as a substrate.

In order to achieve the purpose, the invention adopts the following technical measures:

a whole-cell catalyst containing a phenylpyruvate decarboxylase mutant is a bacillus licheniformis co-expressing the phenylpyruvate decarboxylase mutant F542W and alcohol dehydrogenase, and the amino acid sequence of the mutant F542W is shown in SEQ ID NO. 1.

In the above scheme, preferably, the Bacillus licheniformis is Bacillus licheniformis DW2, CC TCC NO: m2011344;

in the above-mentioned embodiment, preferably, the alcohol dehydrogenase is derived from Bacillus licheniformis DW2, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO. 2.

In the above-mentioned scheme, specifically, the gene encoding the mutant F542W and the alcohol dehydrogenase encoding gene yqdH derived from Bacillus licheniformis DW2 were constructed into the plasmid pHY300PLK, and then transformed into Bacillus licheniformis DW 2.

The application of the whole-cell catalyst containing the phenylpyruvate decarboxylase mutant comprises the steps of preparing phenethyl alcohol or phenethyl alcohol derivatives by using the whole-cell catalyst provided by the invention;

in the above-mentioned application, preferably, the fermentation system comprises: 40-120g/L of molasses, 1-10g/L of L-phenylalanine, 0.5-5g/L of yeast extract and KH₂PO₄0.5-20g/L，K₂HPO₄0.5-10g/L, 2-10g/L sodium citrate and MgSO₄·7H₂O0.1-1.0g/L，MnCl₂0.001-0.01g/L,CaCl₂0.001-0.005g/L and FeSO₄·7H₂O0.001-0.005g/L，pH 6.5～7.5。

Compared with the prior art, the invention has the following advantages:

1) according to the invention, the 542 th phenylalanine near the catalytic domain of the phenylpyruvate decarboxylase molecule is mutated into the tryptophan (named as mutant F542W) in a site-specific mutation mode, so that the enzyme activity of the phenylpyruvate decarboxylase is obviously improved, and the problem of low catalytic efficiency of the conventional phenylpyruvate decarboxylase on the phenylpyruvate is solved.

2) The invention can obviously improve the catalytic efficiency of converting phenylalanine into phenethyl alcohol and improve the conversion rate of phenylpyruvic acid by coexpressing mutated ketonic acid decarboxylase and bacillus licheniformis self alcohol dehydrogenase.

Drawings

FIG. 1 shows SDS-PAGE electrophoresis of YqdH-induced expression and purification of alcohol dehydrogenase;

wherein lane M: marker; 1-3: the purified Ni-NTA gave pure YqdH protein, lanes 4-6 were binding solution, 20mM imidazole washing solution, 50mM imidazole washing solution, and lane 7 was the supernatant after cell disruption, respectively.

FIG. 2 plasmid map of recombinant plasmid pHY-kivD-yqdH construction.

Detailed Description

The following examples are further illustrative of the present invention and are not intended to be limiting thereof. The technical scheme of the invention is a conventional scheme in the field if not specifically stated; the reagents or materials, if not specifically mentioned, are commercially available.

Seed culture medium: 10g/L of peptone, 5g/L of yeast powder and 10g/L of NaCl.

And (3) determination of phenethyl alcohol: the content of the phenethyl alcohol is analyzed by adopting gas chromatography, and the specific method comprises the following steps: centrifuging the fermentation liquor at 12000rpm for 10min to obtain 400 μ L of fermentation supernatant; adding 1.2mL ethyl acetate containing 1g/L internal standard for extraction, oscillating and mixing uniformly for 5min, and centrifuging at 10000rpm for 2 min; taking 800 μ L of the supernatant, adding 0.2g of anhydrous sodium sulfate, mixing, and standing at room temperature for 30 min; centrifuging to obtain supernatant, and measuring the concentration of the fermentation product by gas chromatography. The fermentation product is measured by Agilent 7890B gas chromatograph (equipped with FID detector), the sample volume is 1 μ L, no shunt sample injection is carried out, and the carrier gas is hydrogen (1 ml/min). The column temperature procedure was: equilibrating at 50 deg.C for 2min, heating to 160 deg.C at 10 deg.C/min, heating to 220 deg.C at 20 deg.C/min, and holding for 3 min.

Example 1:

1) construction of recombinant plasmid pHY-kivD:

an alpha-keto acid decarboxylase kivD gene was cloned from Lactococcus lactis subsp.lactis, CICC6246 using kivD-F and kivD-R. Amplifying by taking Bacillus subtilis 168 genome as a template and P43-F and P43-R as primers to obtain a P43 promoter; and taking TamyL-F and TamyL-R as primers for amplification to obtain an amylase terminator TamyL. P43-F and TamyL-R are used as primers to carry out SOE-PCR on three fragments of P43, kivD and TamyL to obtain a fusion fragment P43-kivD-TamyL. Plasmid pHY300PLK is used as a template, pHY-T5-F and pHY-T5-R are used as primers to carry out whole plasmid PCR amplification, and a linearized pHY300PLK vector is obtained. And (3) after the amplification products are subjected to electrophoresis detection, purifying and recovering the PCR products by using a gel recovery kit. The fusion fragment was fused with the linearized vector pHY300PLK by the Clonexpress II one-step cloning kit to obtain the recombinant plasmid pHY-kivD.

P43-F:TTTTTATAACAGGAATTCTGATAGGTGGTATGTTTTCG

P43-R:TAATCTCCTACTGTATACATTGATCCTTCCTCCTTTAGA

kivD-F:CTAAAGGAGGAAGGATCAATGTATACAGTAGGAGATTA

kivD-R:TCCGTCCTCTCTGCTCTTTTATGATTTATTTTGTTCAG

TamyL-F:CTGAACAAAATAAATCATAAAAGAGCAGAGAGGACGGATT

TamyL-R:AAGCTTCTAGAAGCTTCTAGCGCAATAATGCCGTCGCACT

pHY-T5-F:GAATTCCTGTTATAAAAAAAGGATC

pHY-T5-R:TCTAGAAGCTTGGGCAAAGCGTTTT；

The fused recombinant plasmid pHY-kivD was transformed into competent E.coli DH 5. alpha. and positive colonies were screened with ampicillin-containing LB plates. After overnight shake culture at 37 ℃ the plasmid pHY-kivD was extracted and verified by sequencing.

2) Enzyme activity assay of wild KivD:

the correct plasmid pHY-kivD will be sequenced and transformed into Bacillus licheniformis DW 2. Selecting transformants, verifying the transformants to be correct, inoculating the transformants into an LB culture medium, and culturing for 14h at 37 ℃; the cells were transferred to a fermentation medium with an inoculum size of 3%, cultured at 37 ℃ for 24 hours, harvested by centrifugation, washed twice with PBS, and finally resuspended in 1 ml of 50mM potassium phosphate buffer (pH 6.8). Cell disruption was performed using an ultrasonograph, which was set up: 150W, 20kHz, 2s of work; closing for 2s, taking 8 minutes totally, centrifuging at 4 ℃ and collecting supernatant fluid to obtain crude enzyme liquid.

The supernatant was subjected to enzyme activity assay according to the following system, enzymatic reaction system (200. mu.L): 50mM potassium phosphate buffer (pH 6.8), 1mM magnesium sulfate heptahydrate, 0.5mM thiamine pyrophosphate, 5mM sodium propiophenonate and 10. mu.L of the crude enzyme solution were reacted at 30 ℃. Measuring the absorbance at 320nm by using a microplate reader to measure the activity of the phenylpyruvate decarboxylase, and defining the enzyme quantity required by consuming 1 micromole of the substrate phenylpyruvate per minute as one enzyme activity unit (U). The enzyme activity measurement result shows that the enzyme activity (enzyme concentration) of the wild KivD is 290.05U/mL.

3) Preparation of expression plasmid pHY-F542W for pyruvate decarboxylase mutant:

the constructed pHY-kivD is used as a template, a primer is designed to carry out whole plasmid PCR amplification, and a pHY300PLK vector of a linearized P43 promoter and an amylase TamyL terminator is obtained. Site-directed mutagenesis is carried out on the kivD catalytic active site, and the mutation is replaced to a gene sequence in a primer mode, specifically comprising the following steps:

the 542 th phenylalanine is mutated into tryptophan, the base TGG of the 542 th amino acid of the coded kivD is split into two parts, primers F542W-AR and F542W-BF, and the upper section and the lower section of a kivD mutant sequence are amplified by taking pHY-kivD plasmid as a template; two sections were subjected to SOE-PCR using kivD-F and kivD-R as primers to amplify the kivD mutant sequence F542W.

And purifying and recovering the PCR product by using a gel recovery kit, and carrying out electrophoresis detection on the recovered product. Fusing the fused mutant fragment with a linearized vector pHY300PLK with a P43 promoter and an amylase TamyL terminator, converting a product into E.coli DH5 alpha, and obtaining a recombinant plasmid pHY-F542W, wherein the amino acid sequence of the expressed mutant F542W is shown in SEQ ID No. 1;

F542W-AR:GATTTATTTTGTTCAGCCCATAGTTTGCCCATTTTTTTC

F542W-BF:GAAAAAAATGGGCAAACTATGGGCTGAACAAAATAAATC。

4) enzyme activity assay of mutant F542W

Transforming the mutant plasmid of the step 3) into Bacillus licheniformis DW 2. Selecting transformants, verifying the transformants to be correct, inoculating the transformants into an LB culture medium, and culturing for 14h at 37 ℃; transferring the strain into a fermentation medium, wherein the inoculation amount is 3%, culturing at 37 ℃ for 24h, detecting the enzyme activity of the mutant according to the method in the step 2), and the enzyme activity (enzyme concentration) of the mutant F542W is 1195.18U/mL.

Example 2:

1) cloning of Bacillus licheniformis DW2 alcohol dehydrogenase encoding Gene yqdH

Sequence alignment was performed in NCBI database based on the amino acid sequence of Bacillus licheniformis alcohol dehydrogenase YqdH, and it was found to have 38.65% homology with alcohol dehydrogenase YqhD of E.coli K12. YqhD is reported to have a broad substrate spectrum. To test the catalytic ability of Bacillus licheniformis YqdH to phenylacetaldehyde, primers yqdH-F1 and yqdH-R1 were designed based on the gene sequence of yqdH, and the yqdH sequence was amplified using the genomic DNA of Bacillus licheniformis as a template. And carrying out enzyme digestion on the yqdH fragment of the alcohol dehydrogenase gene by using Ba mHI and XhoI, connecting the fragment with an expression vector pET28a (+) subjected to the same enzyme digestion by using T4DNA ligase, transforming E.coli DH5 alpha competent cells by using a connecting product, transferring the transformed positive clone into a liquid LB culture medium for overnight culture, and extracting to obtain a recombinant expression plasmid pET28 a-yqdH. The recombinant expression plasmid pET28a-yqdH is transformed into E.coli BL21(DE3) competent cells, and positive clones are screened on a resistant culture medium to obtain a recombinant strain BL21(DE3)/pET28 a-yqdH.

yqdH-F1:CGGGATCCATGGATAATTTTACATATTG

yqdH-R1:CCGCTCGAGTTATAAAGAAGCCTTCAAAAT

2) Inducible expression and purification of YqdH protein

The BL21(DE3) strain containing the recombinant plasmid pET28a-yqdH was inoculated into 100mL of LB liquid medium, cultured with shaking at 37 ℃ and 230rpm for 3 hours, and after OD600 reached about 0.8, the final concentration of 0.5mM IPTG was added, and induced at 37 ℃ and 230rpm for 4 hours. And centrifuging the induced culture medium to collect thalli, resuspending the thalli by using a proper amount of phosphate buffer solution with the pH value of 8.0, crushing the thalli by using a low-temperature high-pressure cell crusher, centrifuging to remove cell fragments, detecting the expression of the alcohol dehydrogenase YqdH by using SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) of the obtained soluble total protein solution, wherein the protein electrophoresis result shows that an obvious band can be seen at the position of about 42.5kDa (figure 1), and the expression of the alcohol dehydrogenase YqdH in escherichia coli is shown.

E.coli BL21(DE3)/pET28a-yqdH fermentation broth after IPTG induction is centrifuged at 12000rpm for 5min, and thalli are collected; the cells were resuspended in an appropriate amount of solution I (20mM Tris-HCl (pH 7.9), 10mM imidazole, 0.5M NaCl; and disrupted by a low-temperature high-pressure cell disrupter); centrifuging at 12000rpm at 4 deg.C for 20min, and collecting supernatant to obtain crude enzyme solution; taking 20mL of crude enzyme solution, loading the crude enzyme solution on a Ni-NTA affinity chromatography column, and collecting a penetration peak; the column was washed with 15 column volumes of solution II (20mM Tris-HCl (pH 7.9), 20mM imidazole, 0.5M NaCl;) to remove the contaminating proteins; eluting YqdH protein with appropriate amount of solution III (20mM Tris-HCl (pH 7.9), 500mM imidazole, 0.5M NaCl;) and collecting the eluate; the protein purity in the eluate was checked by SDS-PAGE and desalted. The protein electrophoresis result shows that the YqdH protein accounts for more than 90 percent, the high-purity purified protein (figure 1) is obtained, and the amino acid sequence of the expressed alcohol dehydrogenase is shown as SEQ ID NO. 2.

3) Enzyme activity determination of recombinant alcohol dehydrogenase YqdH

The purified protein was subjected to enzyme activity measurement according to the following system, enzymatic reaction system (200. mu.L): containing 50mM MOPS buffer (pH7.0), 5mM phenylacetaldehyde, 0.2mM NADH, and 10. mu.L of purified alcohol dehydrogenase enzyme solution, reacting at 30 ℃, measuring absorbance at 340nm every 1min by an enzyme-labeling instrument, and continuously measuring for 20 min. 1 enzyme activity unit (U) is defined as the amount of enzyme required to consume 1 nNADH per minute under the given conditions. The result of enzyme activity measurement is that the specific enzyme activity of the alcohol dehydrogenase is 10.39U/mg. The YqdH in the source bacillus licheniformis can catalyze phenylacetaldehyde to synthesize phenethyl alcohol.

Example 3:

construction of the Co-expression recombinant plasmid pHY-F542W-yqdH:

the yqdH gene in the genome of Bacillus licheniformis DW2 is amplified by yqdH-F2 and yqdH-R2, the genome of Bacillus subtilis 168 is used as a template, and P43-F1 and P43-R are used as primers to obtain a P43 promoter through amplification. P43-F1 and yqdH-R2 are used as primers, and the two fragments of P43 and yqdH are subjected to SOE-PCR to obtain a fusion fragment P43-yqdH. Plasmid pHY-F542W or pHY-kivD is used as a template, and amp-T5-F and amp-T5-R are used as primers to carry out whole plasmid PC R amplification, so as to obtain linearized pHY-F542W and pHY-kivD. And (3) after the amplification products are subjected to electrophoresis detection, purifying and recovering the PCR products by using a gel recovery kit. The yqdH fragment was inserted into the expression vectors pHY-F542W and pHY-kivD by Cloneexpress II one-step cloning kit, respectively, and the success of the construction of the recombinant co-expression plasmids pHY-F542W-yqdH and pHY-kivD-yqdH was confirmed by colony PCR and DNA sequencing.

yqdH-F2:TCTAAAGGAGGAAGGATCAATGGATAATTTTACATATTG

yqdH-R2:GTAAACTTGGTCTGACAGTTATAAAGAAGCCTTCAAAAT

P43-F1:ACTTTTCGGGGAAATGTCTGATAGGTGGTATGTTTTCG

P43-R1:CAATATGTAAAATTATCCATTGATCCTTCCTCCTTTAGA

amp-T5-F:GACATTTCCCCGAAAAGTGCCAC

amp-T5-R:CTGTCAGACCAAGTTTACTCATATA。

Example 4:

construction of recombinant DW2/pHY-kivD-yqdH and DW2/pHY-F542W-yqdH Bacillus licheniformis

The constructed pHY-kivD-yqdH plasmid or the recombinant plasmid pHY-F542W-yqdH is respectively electrically transformed into the bacillus licheniformis DW 2. Transformants are selected by pHY-F and pHY-R primers for colony PCR, and gel electrophoresis verification shows that a 2800bp band appears, the successful construction of recombinant Bacillus licheniformis DW2/pHY-kivD-yqdH and DW2/pHY-F542W-yqdH is verified, DW2/pHY-kivD-yqdH is shown in figure 2, and the plasmid structure of DW2/pHY-F542W-yqdH is that kivD in DW2/pHY-kivD-yqdH is changed into a kivD mutant.

pHY-F:CAGATTTCGTGATGCTTGTC

pHY-R:GTTTATTATCCATACCCTTAC。

Example 5:

influence of molasses concentration on recombinant bacteria DW2/pHY-kivD-yqdH and DW2/pHY-F542W-yqdH in production of phenethyl alcohol by fermentation:

the cells cultured in example 4 were used as a catalyst, and the final concentration of the added cells was OD₆₀₀The concentration of molasses is 0.2, 40, 60, 80, 100, 120 and 140g/L, the other culture medium components are 10g/L sodium citrate, 5g/L L-phenylalanine, 2g/L yeast extract,6.4g/L KH₂PO₄,5.32g/L K₂HPO₄,0.6g/L MgSO₄·7H₂O,0.005g/L MnCl₂,0.003g/L FeSO₄·7H₂O,0.003g/L CaCl₂The content of phenethyl alcohol was measured at pH6.5 and at a culture temperature of 37 ℃ for 60 hours of fermentation, and the results shown in Table 1 show that the content of phenethyl alcohol was higher at a molasses concentration of 60-100 and highest at a molasses concentration of 80. The yield of the recombinant strain DW2/pHY-F542W-yqdH phenethyl alcohol is higher than that of the control strain.

TABLE 1 influence of molasses concentration on recombinant bacteria DW2/pHY-kivD-yqdH and DW2/pHY-F542W-yqdH in the fermentative production of phenethyl alcohol

Example 6:

influence of pH during fermentation on recombinant bacteria DW2/pHY-kivD-yqdH and DW2/pHY-F542W-yqdH in the production of phenethyl alcohol by fermentation:

the cells cultured in example 4 were used as a catalyst, and the final concentration of the added cells was OD₆₀₀The culture medium components are 60g/L of molasses, 10g/L of sodium citrate, 5g/L L-phenylalanine, 2g/L of yeast extract and 0.6g/L of Mg SO respectively₄·7H2O,0.005g/L MnCl2,0.003g/L FeSO4·7H2O,0.003g/L CaCl₂Fermenting for 60h at 37 deg.C to change KH₂PO₄And K₂HPO₄The content of phenethyl alcohol was measured in the reaction system at such concentrations that the pH was 6.5, 6.8, 7.0 and 7.5, respectively, and as a result, as shown in Table 2, the content of phenethyl alcohol was the highest at pH 7.0. The DW2/pHY-F542W-yqdH yield is at least 12 percent higher than the phenethyl alcohol yield of the control bacteria.

TABLE 2 influence of pH during fermentation on recombinant bacteria DW2/pHY-kivD-yqdH and DW2/pHY-F542W-yqdH in the fermentative production of phenethyl alcohol:

example 7:

the influence of the inoculation amount on the recombinant bacteria DW2/pHY-kivD-yqdH and DW2/pHY-F542W-yqdH in the production of phenethyl alcohol by fermentation:

the cells obtained by culturing in example 4 were used as a catalyst, and the medium components were 80g/L molasses, 10g/L sodium citrate, 5g/L L-phenylalanine, 2g/L yeast extract, and 14.14g/L KH ₂PO₄,5.17g/L K₂HPO₄,0.6g/L MgS O₄·7H₂O,0.005g/L MnCl₂,0.003g/L FeSO₄·7H₂O,0.003g/L CaCl₂pH7.0, final concentrations of the added cells of 0.2, 1.0, 2.0 and 5.0, fermentation for 60h, and measurement of phenethyl alcohol content at 37 deg.C, the results are shown in Table 3 when the initial final concentration of the cells is OD₆₀₀The highest phenethyl alcohol content is obtained when the content is 0.2-1.0. The DW2/pHY-F542W-yqdH yield is at least improved by 9 percent compared with the phenethyl alcohol yield of the control bacteria.

Table 3 Effect of inoculum size on recombinant bacteria DW2/pHY-kivD-yqdH and DW2/pHY-F542W-yqdH in the fermentative production of phenethyl alcohol:

example 8:

influence of substrate concentration on recombinant bacteria DW2/pHY-kivD-yqdH and DW2/pHY-F542W-yqdH in production of phenethyl alcohol by fermentation:

the cells obtained by culturing in example 4 were used as a catalyst, and the medium components were 80g/L molasses, 10g/L sodium citrate, 2g/L yeast extract, and 14.14g/L KH₂PO₄,5.17g/L K₂HPO₄,0.6g/L MgSO₄·7H₂O,0.005g/L MnCl₂,0.003g/L FeSO₄·7H₂O,0.003g/L CaCl₂pH7.0, final concentration of added cells is 0.2, 5, 6, 8 and 10g/L of L-phenylalanine are respectively added into the reaction system, fermentation is carried out for 60 hours, the reaction temperature is 37 ℃, and the yield of the phenethyl alcohol generated by adding 5, 6, 8 and 10g/L of L-phenylalanine is detected and is shown in Table 4, and the yield of the phenethyl alcohol is increased along with the increase of the concentration of the L-phenylalanine. When 10g/L L-phenylalanine is added, the yield of phenethyl alcohol of the DW2/pHY-F542W-yqdH strain is the highest and reaches 5.15 g/L. Compared with the control strain, the strain is improved by 16 percent. The highest L-phenylalanine conversion rate of the DW2/pHY-F542W-yqdH strain can reach 94.32 percent.

TABLE 4 influence of substrate concentration on the fermentation production of phenethyl alcohol by recombinant bacteria DW2/pHY-kivD-yqdH and DW 2/pHY-F542W-yqdH:

although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> university of Hubei

<120> whole-cell catalyst containing phenylpyruvate decarboxylase mutant and application thereof in production of phenethyl alcohol

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 548

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Tyr Thr Val Gly Asp Tyr Leu Leu Asp Arg Leu His Glu Leu Gly

1 5 10 15

Ile Glu Glu Ile Phe Gly Val Pro Gly Asp Tyr Asn Leu Gln Phe Leu

20 25 30

Asp Gln Ile Ile Ser Arg Lys Asp Met Lys Trp Val Gly Asn Ala Asn

35 40 45

Glu Leu Asn Ala Ser Tyr Met Ala Asp Gly Tyr Ala Arg Thr Lys Lys

50 55 60

Ala Ala Ala Phe Leu Thr Thr Phe Gly Val Gly Glu Leu Ser Ala Val

65 70 75 80

Asn Gly Leu Ala Gly Ser Tyr Ala Glu Asn Leu Pro Val Val Glu Ile

85 90 95

Val Gly Ser Pro Thr Ser Lys Val Gln Asn Glu Gly Lys Phe Val His

100 105 110

His Thr Leu Ala Asp Gly Asp Phe Lys His Phe Met Lys Met His Glu

115 120 125

Pro Val Thr Ala Ala Arg Thr Leu Leu Thr Ala Glu Asn Ala Thr Val

130 135 140

Glu Ile Asp Arg Val Leu Ser Ala Leu Leu Lys Glu Arg Lys Pro Val

145 150 155 160

Tyr Ile Asn Leu Pro Val Asp Val Ala Ala Ala Lys Ala Glu Lys Pro

165 170 175

Ser Leu Pro Leu Lys Lys Glu Asn Ser Thr Ser Asn Thr Ser Asp Gln

180 185 190

Glu Ile Leu Asn Lys Ile Gln Glu Ser Leu Lys Asn Ala Lys Lys Pro

195 200 205

Ile Val Ile Thr Gly His Glu Ile Ile Ser Phe Gly Leu Glu Lys Thr

210 215 220

Val Ser Gln Phe Ile Ser Lys Thr Lys Leu Pro Ile Thr Thr Leu Asn

225 230 235 240

Phe Gly Lys Ser Ser Val Asp Glu Ala Leu Pro Ser Phe Leu Gly Ile

245 250 255

Tyr Asn Gly Lys Leu Ser Glu Pro Asn Leu Lys Glu Phe Val Glu Ser

260 265 270

Ala Asp Phe Ile Leu Met Leu Gly Val Lys Leu Thr Asp Ser Ser Thr

275 280 285

Gly Ala Phe Thr His His Leu Asn Glu Asn Lys Met Ile Ser Leu Asn

290 295 300

Ile Asp Glu Gly Lys Ile Phe Asn Glu Ser Ile Gln Asn Phe Asp Phe

305 310 315 320

Glu Ser Leu Ile Ser Ser Leu Leu Asp Leu Ser Glu Ile Glu Tyr Lys

325 330 335

Gly Lys Tyr Ile Asp Lys Lys Gln Glu Asp Phe Val Pro Ser Asn Ala

340 345 350

Leu Leu Ser Gln Asp Arg Leu Trp Gln Ala Val Glu Asn Leu Thr Gln

355 360 365

Ser Asn Glu Thr Ile Val Ala Glu Gln Gly Thr Ser Phe Phe Gly Ala

370 375 380

Ser Ser Ile Phe Leu Lys Pro Lys Ser His Phe Ile Gly Gln Pro Leu

385 390 395 400

Trp Gly Ser Ile Gly Tyr Thr Phe Pro Ala Ala Leu Gly Ser Gln Ile

405 410 415

Ala Asp Lys Glu Ser Arg His Leu Leu Phe Ile Gly Asp Gly Ser Leu

420 425 430

Gln Leu Thr Val Gln Glu Leu Gly Leu Ala Ile Arg Glu Lys Ile Asn

435 440 445

Pro Ile Cys Phe Ile Ile Asn Asn Asp Gly Tyr Thr Val Glu Arg Glu

450 455 460

Ile His Gly Pro Asn Gln Ser Tyr Asn Asp Ile Pro Met Trp Asn Tyr

465 470 475 480

Ser Lys Leu Pro Glu Ser Phe Gly Ala Thr Glu Glu Arg Val Val Ser

485 490 495

Lys Ile Val Arg Thr Glu Asn Glu Phe Val Ser Val Met Lys Glu Ala

500 505 510

Gln Ala Asp Pro Asn Arg Met Tyr Trp Ile Glu Leu Ile Leu Ala Lys

515 520 525

Glu Asp Ala Pro Lys Val Leu Lys Lys Met Gly Lys Leu Trp Ala Glu

530 535 540

Gln Asn Lys Ser

545

<210> 2

<211> 387

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Asp Asn Phe Thr Tyr Trp Asn Pro Thr Lys Leu Ile Phe Gly Arg

1 5 10 15

Gly Glu Val Glu Lys Leu Ala Glu Glu Val Lys His Tyr Gly Arg Asn

20 25 30

Val Leu Leu Val Tyr Gly Gly Gly Ser Ile Lys Arg Asn Gly Leu Tyr

35 40 45

Asp Gln Val Ile Ser Ile Leu Glu Lys Ala Gly Ala Thr Val His Glu

50 55 60

Leu Pro Gly Val Glu Pro Asn Pro Arg Val Ala Thr Val Asn Lys Gly

65 70 75 80

Val Ala Ile Cys Lys Glu Asn Asp Ile Asn Phe Leu Leu Ala Val Gly

85 90 95

Gly Gly Ser Val Ile Asp Cys Thr Lys Ala Ile Ala Ala Gly Ala Lys

100 105 110

Tyr Asp Gly Asp Ala Trp Asp Ile Val Thr Lys Lys His Ile Pro Ala

115 120 125

Asp Ala Leu Pro Phe Gly Thr Val Leu Thr Leu Ala Ala Thr Gly Ser

130 135 140

Glu Met Asn Ser Gly Ser Val Ile Thr Asn Trp Glu Thr Asn Glu Lys

145 150 155 160

Tyr Gly Trp Gly Ser Pro Leu Val Phe Pro Lys Phe Ser Ile Leu Asp

165 170 175

Pro Val Asn Thr Phe Thr Val Pro Lys Asp His Thr Ile Tyr Gly Ile

180 185 190

Val Asp Met Met Ser His Val Phe Glu Gln Tyr Phe His His Thr Glu

195 200 205

Asn Thr Pro Tyr Gln Asp Arg Met Cys Glu Ser Leu Leu Lys Thr Val

210 215 220

Ile Glu Thr Ala Ser Lys Leu Ile Glu Asp Leu Glu Asn Tyr Glu Leu

225 230 235 240

Arg Glu Thr Ile Leu Tyr Thr Gly Thr Ile Ala Leu Asn Gly Met Leu

245 250 255

Ser Met Gly Ala Arg Gly Asp Trp Ala Thr His Asn Ile Glu His Ala

260 265 270

Val Ser Ala Val Tyr Asp Ile Pro His Ala Gly Gly Leu Ala Ile Leu

275 280 285

Phe Pro Asn Trp Met Lys His Thr Leu Ser Glu Asn Val Gly Arg Phe

290 295 300

Lys Gln Leu Ala Val Arg Val Phe Asp Val Asp Glu Thr Gly Lys Thr

305 310 315 320

Asp Arg Glu Val Ala Leu Val Gly Ile Glu Lys Leu Ser Glu Phe Trp

325 330 335

Thr Ser Leu Gly Ala Pro Asn Arg Leu Ala Asp Tyr Asp Ile Thr Asp

340 345 350

Glu Lys Leu Asp Leu Ile Ala Asp Lys Ala Met Ala Asn Gly Glu Phe

355 360 365

Gly Arg Phe Lys Thr Leu Asn Lys Asp Asp Val Leu Ser Ile Leu Lys

370 375 380

Ala Ser Leu

385

<210> 3

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tttttataac aggaattctg ataggtggta tgttttcg 38

<210> 4

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

taatctccta ctgtatacat tgatccttcc tcctttaga 39

<210> 5

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctaaaggagg aaggatcaat gtatacagta ggagatta 38

<210> 6

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tccgtcctct ctgctctttt atgatttatt ttgttcag 38

<210> 7

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctgaacaaaa taaatcataa aagagcagag aggacggatt 40

<210> 8

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aagcttctag aagcttctag cgcaataatg ccgtcgcact 40

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gaattcctgt tataaaaaaa ggatc 25

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tctagaagct tgggcaaagc gtttt 25

<210> 11

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gatttatttt gttcagccca tagtttgccc atttttttc 39

<210> 12

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gaaaaaaatg ggcaaactat gggctgaaca aaataaatc 39

<210> 13

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cgggatccat ggataatttt acatattg 28

<210> 14

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ccgctcgagt tataaagaag ccttcaaaat 30

<210> 15

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

tctaaaggag gaaggatcaa tggataattt tacatattg 39

<210> 16

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gtaaacttgg tctgacagtt ataaagaagc cttcaaaat 39

<210> 17

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

acttttcggg gaaatgtctg ataggtggta tgttttcg 38

<210> 18

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

caatatgtaa aattatccat tgatccttcc tcctttaga 39

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gacatttccc cgaaaagtgc cac 23

<210> 20

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ctgtcagacc aagtttactc atata 25

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

cagatttcgt gatgcttgtc 20

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

gtttattatc cataccctta c 21

Claims

1. A whole-cell catalyst containing a phenylpyruvate decarboxylase mutant is a bacillus licheniformis co-expressing the phenylpyruvate decarboxylase mutant F542W and alcohol dehydrogenase, and the amino acid sequence of the mutant F542W is shown in SEQ ID NO. 1.

2. The whole-cell catalyst of claim 1, wherein the Bacillus licheniformis is Bacillus licheniformisBacillus licheniformis DW2，CCTCC NO：M2011344。

3. The whole-cell catalyst according to claim 1, wherein the alcohol dehydrogenase is derived fromBacillus licheniformis DW2, the amino acid sequence of alcohol dehydrogenase is shown in SEQ ID NO. 2.

4. The whole-cell catalyst according to claim 1, which is obtained by converting a gene encoding mutant F542W and a gene derived from the sameBacillus licheniformis DW2 alcohol dehydrogenase encoding geneyqdHConstructed into plasmid pHY300PLK and transformed into Bacillus licheniformis DW 2.

5. Use of the whole-cell catalyst of claim 1 for the production of phenethyl alcohol.

6. Use of the whole-cell catalyst of claim 1 for the production of a phenethyl alcohol derivative.