CN109485718B - A kind of new forms of interferon α and preparation method thereof, composition and purposes - Google Patents
A kind of new forms of interferon α and preparation method thereof, composition and purposes Download PDFInfo
- Publication number
- CN109485718B CN109485718B CN201811437104.3A CN201811437104A CN109485718B CN 109485718 B CN109485718 B CN 109485718B CN 201811437104 A CN201811437104 A CN 201811437104A CN 109485718 B CN109485718 B CN 109485718B
- Authority
- CN
- China
- Prior art keywords
- interferon
- new forms
- ifn
- preparation
- purposes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/52—Cytokines; Lymphokines; Interferons
- C07K14/555—Interferons [IFN]
- C07K14/56—IFN-alpha
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention belongs to biotech drug technical field, it is related to a kind of new forms of interferon α and preparation method thereof, composition and purposes.The new forms of interferon α has amino acid sequence shown in SEQ ID No.1.New forms of interferon α of the invention can have considerably higher biological activity and stability on the basis of keeping good safety and drug effect.
Description
Technical field
The invention belongs to biotech drug technical field, it is related to a kind of new forms of interferon α and preparation method thereof, composition
And purposes.
Background technique
Interferon (interferon, IFN) is a kind of with broad-spectrum antiviral, antitumor and immunoregulation effect cell
Factor protein matter class drug, including I type, II type and type III, they are respectively provided with different receptor and function, are that body is natural
The key components of immune system.Wherein I type IFN has found in nineteen fifty-seven, is the weight generated after humans and animals are infected by the virus
Antiviral substance is wanted, according to the difference of its gene and protein structure, and is divided into IFN-α, IFN-β, IFN- ε, IFN- κ, IFN- ω
Deng.IFN-α has 3 hypotypes and is approved for drug in clinical use, respectively IFN-α 1b, IFN-α 2a and IFN-α 2b, at present
It is genetic recombination product.The IFN-α that foreign countries use is mainly IFN-α 2a and IFN-α 2b, and gene source is in west white race
People；The IFN-α that the country uses is mainly IFN-α 1b, and gene is by China Hou Yunde academician in nineteen eighty-two from normal Chinese's navel
It is obtained in blood leukocytes.Virology Inst., Chinese Academy of Preventive Medical Science's years of researches show Chinese human leukocytes by
To after virus attack, in a variety of interferon of generation based on IFN-α 1b type interferon.Therefore, genetic engineering IFN-α 1b and state
Inside and outside similar product is compared, and has (obvious effective rate is identical as external product) significant in efficacy, side effect is lower, is not likely to produce neutralization to resist
The advantages that body, is more suitable for Chinese's use.
IFN-α 1b injection is first, China genetic engineering I kind new medicine with independent intellectual property rights, at home
Antiviral field was widely applied for more than 20 years, had accumulated lot of documents report and clinical use experience.Multiple multiple center clinical studies
Data show that IFN-α 1b treats Respiratory Syncytial Virus(RSV) (RSV) pneumonia, bronchiolitis, hand-foot-and-mouth disease (HFMD) and disease
The good effects such as viral enteritis, adverse reaction are light." Pharmacopoeia of People's Republic of China version (three) in 2015 " includes recombined human interference
Plain α 1b injection, indication are viral disease and certain malignant tumours, are mainly used for treating chronic hepatitis B, chronic third
Type hepatitis and hairy cell leukemia etc..In addition, recombinant human interferon alpha 1 b is to condyloma acuminatum, chronic cervicitis, herpetic cornea
The viral diseases such as inflammation, shingles zoster, Hemorrhagic fever and children respiratory syncytial virus pneumonia are effective, to other diseases
Viral disease and malignant tumour such as chronic myelocytic leukemia, melanoma, lymthoma etc. also have good efficacy.
Since IFN-α 1b is compared with other type interferon, clinical adverse is small, therefore it is in pediatrics medication
Good effect is achieved, is available rare preferred product in similar product.A large amount of Pediatric Clinic medication experiences and multicenter
Research data shows to give IFN-α 1b by the approach such as intramuscular injection and respiratory tract aerosol sucking, control Childhood Viral
Treatment plays an important role, and especially Neulized inhalation IFN-α 1b treats virus infection, and drug can directly act on respiratory mucosa, has
Have the advantages that targeting is strong, curative effect is high, safety is good, easy to operate, children's compliance is high, and can be through bronchus, bronchiole
Lung is reached, lung tissue is more concentrated on, slowly enters blood, is acted on compared with administered intramuscular more longlasting.Therefore, Neulized inhalation
IFN-α 1b is recommended to use by national standard formulary " standardize administration guide at children atomizing center ".
But IFN-α 1b specific activity is lower, stability is not good enough, this all limits it in clinical further genralrlization application.
Summary of the invention
Primary and foremost purpose of the invention is to provide a kind of new forms of interferon α, be labeled as Interferon α1 z (IFN-α 1z), be
It is transformed to obtain by MOLECULE DESIGN and amino acid sequence on the basis of Interferon α1 b (IFN-α 1b), IFN-α can be being kept
There is considerably higher biological activity and stability compared with IFN-α 1b on the basis of the good safety of 1b and drug effect.
In order to achieve this, the present invention provides a kind of new forms of interferon α, and described is novel in the embodiment on basis
Interferon-' alpha ' has amino acid sequence shown in SEQ ID No.1.
The amino acid identity of new forms of interferon α (IFN-α 1z) and Interferon α1 b (IFN-α 1b) of the invention are 93%,
Amino acid identity with interferon alpha 2 b (IFN-α 2b) is 85%.
A second object of the present invention is to provide a kind of polynucleotides for encoding aforementioned new forms of interferon α, with can be more preferable
The aforementioned new forms of interferon α of coding, the aforementioned new forms of interferon α encoded can keep the good safety of IFN-α 1b
There is considerably higher biological activity and stability compared with IFN-α 1b on the basis of drug effect.
In order to achieve this, the present invention, which provides, a kind of encodes the more of aforementioned new forms of interferon α in the embodiment on basis
Nucleotide.
Third object of the present invention is to provide the preparation methods of aforementioned new forms of interferon α a kind of, can preferably make
Standby aforementioned new forms of interferon α, the aforementioned new forms of interferon α being prepared can keep the good safety of IFN-α 1b and medicine
There is considerably higher biological activity and stability compared with IFN-α 1b on the basis of effect.
In order to achieve this, the present invention provides the preparation side of aforementioned new forms of interferon α a kind of in the embodiment on basis
Method, the preparation method include the following steps:
(1) building of new forms of interferon alpha expression engineering bacteria；
(2) fermentation of new forms of interferon alpha expression engineering bacteria and chromatography (chromatography) isolate and purify.
Fourth object of the present invention is to provide the pharmaceutical composition of aforementioned new forms of interferon α a kind of, can keep
Pharmaceutical composition on the basis of the good safety of the pharmaceutical composition of IFN-α 1b and drug effect compared with IFN-α 1b has obviously more
High biological activity and stability.
In order to achieve this, the present invention provides the medicine group of aforementioned new forms of interferon α a kind of in the embodiment on basis
Object is closed, what the pharmaceutical composition contained the new forms of interferon α and appropriate amount of therapeutically effective amount and safe dose can medicine
Use carrier.
Fifth object of the present invention is to provide a kind of aforementioned new forms of interferon α or its pharmaceutical compositions in preparation prevention or
Treat the purposes in the drug of disease of viral infection.
In order to achieve this, the present invention provides a kind of aforementioned new forms of interferon α or its drug in the embodiment on basis
Purposes of the composition in the drug of preparation prevention or treatment disease of viral infection.
In a preferred embodiment, the present invention provides a kind of aforementioned new forms of interferon α or its pharmaceutical composition exists
Purposes in the drug of preparation prevention or treatment disease of viral infection, wherein the disease of viral infection is B-mode brain
Scorching, respiratory syncytial virus infection or virus hepatitis.
Term used in the present invention " therapeutically effective amount and safe dose " is indicated when application active pharmaceutical ingredient is for treating
Or when prevention disease, the amount of active pharmaceutical ingredient is enough to realize the treatment or prevention to disease and does not cause obvious toxic-side effects.
Therapeutically effective amount and safe dose will be according to age, the weight etc. of active pharmaceutical ingredient, disease and its seriousness and treated patient
And it is different.
The beneficial effects of the present invention are new forms of interferon α of the invention can keep the good safety of IFN-α 1b
There is considerably higher biological activity and stability compared with IFN-α 1b on the basis of drug effect.
Specific embodiment
Implementation of the invention is described further by following embodiment, but embodiments of the present invention are not limited to
In following embodiment.
Embodiment 1: the construction and expression sequence confirmation of new forms of interferon alpha expression engineering bacteria
It is corresponding nucleic acid-templated according to the SEQ ID No.1 of sequence table synthesis, sufficient amount is amplified by the method for PCR
Nucleic acid.
Amplification reaction system primer are as follows:
F:CATATGTGCGACCTGCCACA
R:CTCGAGTTAGTTGGTGCTCAGGC
Amplification reaction system includes: 1 μ l of dNTP, 5 μ l of 10X pfu buffer, each 2 μ l of upstream and downstream primer, 1 μ of client's template
L, 0.4 μ l of Pfu enzyme (5u/ μ l), 38.6 μ l of ddH2O.
Amplification reaction condition are as follows: 95 DEG C, 3 minutes, 95 DEG C, 22 seconds, 68 DEG C, 20 seconds, 72 DEG C, 60 seconds, 72 DEG C, 5 minutes.Altogether
24 circulations.It is separated after the reaction was completed with agarose gel electrophoresis, with Nde I/Xho I double digestion, electrophoresis recycles 500bp
The target DNA fragment of left and right.
By pET30a plasmid vector Nde I/Xho I double digestion, the simultaneously mesh with above-mentioned recycling is recycled through agarose electrophoresis
DNA fragmentation connection.Connect reaction condition are as follows: 4 μ l, seamless clone's mixed liquor, 8.5 μ l, digestion carrier pET30a have been purified
PCR product, 7.5 μ l, above-mentioned connection mixed liquor be placed on 37 DEG C under the conditions of in PCR instrument 1h.
Escherichia coli BLD21 competent cell is prepared, above-mentioned connection product is converted, is coated with ammonia benzyl plate, 37 DEG C of trainings overnight
It supports.
Picking single colonie is expanded as template with the primers F of above-mentioned design, R, and product is detected through agarose electrophoresis,
There is specific band in 474bp or so in positive colony；It takes positive colony to cultivate in a small amount, extracts the plasmid bis- enzymes of Nde I/Xho I
It cuts.Occur the band of specificity in 3kb or so and 500bp or so respectively, is consistent with estimated situation, tentatively illustrates recombinant plasmid structure
Build up function.To further confirm that its sequence, full-automatic sequencing is carried out to ABI377 sequenator with T7 universal primer.
Embodiment 2: fermentation, purifying and the detection of new forms of interferon α
Single bacterium is selected after the expression engineering bacteria that previous embodiment 1 constructs obtained new forms of interferon α is applied plate activation
Fall in the LB culture medium for being inoculated in the kanamycins containing final concentration of 30 μ g/mL (every liter with peptone 10g, yeast powder 5g,
NaCl 10g prepare, adjust pH be 7.0), 37 DEG C, 235 revs/min of shaking table shaking flask cultures to OD600nm be 0.6-0.8.Then with
5% volume inoculum concentration be inoculated in the LB culture medium of 50L in 80L fermentor carry out fermented and cultured (card containing 30 μ g/mL that
Mycin), cultivation temperature is 37 DEG C, pH is adjusted between 6.5-7.5 with ammonium hydroxide in incubation, with revolving speed control oxygen dissolving value in 3-
Between 5%.IPTG 10g is added in the ratio of mass volume ratio 1:5000 after OD600nm reaches 1.0 and continues Fiber differentiation 4.5
Hour, Fiber differentiation temperature is 37 DEG C, and appropriate into fermentor in the process adds LB culture medium.The Fiber differentiation time
Put 5000 revs/min of tank room temperature centrifugations, 20 minutes collection thallus after, gained thallus with TE buffer (50mmol/L Tris-HCl,
5mmol/L EDTA, pH8.0) centrifugation is washed twice to remove the major impurity in fermentation liquid.
The thallus 40g for taking above-mentioned processing to obtain sets ultrasonic wave with the mass volume ratio addition 600ml TE buffer of 1:15 and breaks
Ultrasonication is carried out on broken instrument, condition is to make a call to 5 seconds, is had a rest 5 seconds, and totally 60 minutes, gained was crushed the 12000 revs/min of centrifugations 20 of liquid chamber temperature
Minute abandoning supernatant, precipitating are centrifuged with the mass volume ratio addition TE buffer washing of 1:10 and obtain isolation of occlusion bodies twice.
Solubilization of inclusion bodies liquid (8mol/L urea, 50mmol/L is added with the mass volume ratio of 1:10 in gained 10g inclusion body
Tris-HCl, 300mmol/L NaCl, pH8.0) dissolution after under the conditions of being slightly agitated for denaturation treatment 2 hours, it is complete to inclusion body
12000 revs/min of room temperature centrifugation abandoning in 20 minutes precipitatings, supernatant carry out renaturation process, renaturation solution group with dilution refolding method after fully dissolved
Become: 0.15mol/L sodium borate buffer liquid, 3mmol/L oxidized form of glutathione, 1mmol/L reduced glutathione adjust pH
It is 9.5.Renaturation process carries out in 2-8 DEG C of low-temperature cold store, and supernatant is diluted 6 times with renaturation solution first, is used again after placing 8 hours
Renaturation solution dilutes 5 times continuation renaturation 6 hours.
Renaturation solution after dialysis is upper molten with 25mmol/LTris-HCl pH8.0 after 4 DEG C 12000 revs/min are centrifuged 30 minutes
The DEAE Sepharose FF chromatographic column of liquid balance.First continued to rinse 2-3 column of chromatographic column with equilibration buffer after completion of the sample
Then volume carries out elution with the 25mmol/L Tris-HCl pH8.0 solution containing 0.35mol/L NaCl and collects eluting peak.
Linear flow rate in above-mentioned loading, flushing and elution process should control between 50-200cm/h.
DEAE Sepharose FF eluting peak is with 50mmol/L Acetic acid-sodium acetate pH4.5 buffer with the volume ratio of 1:10
The upper CM Sepharose FF chromatographic column balanced with same buffer after dilution.First continued with equilibration buffer after completion of the sample
2-3 column volume of chromatographic column is rinsed, then with the 25mmol/L Acetic acid-sodium acetate containing 0.1-0.15mol/L NaCl
With the 25mmol/L Acetic acid-sodium acetate pH4.5 containing 0.5mol/L NaCl behind pH4.5 buffer elution removing major impurity peak
Target peak is collected in buffer elution.Linear flow rate in above-mentioned loading, flushing and elution process should control 50-200cm/h it
Between.
Dying method with coomassie brilliant blue and molecular exclusion HPLC method is added to detect above-mentioned CM respectively with SDS-PAGE electrophoresis
The purity of the isolated new forms of interferon α of Sepharose FF chromatographic column, as a result 97% or more.With " the Chinese people are total
With state's pharmacopeia version (three) in 2015 " as defined in " interferon activity measuring method " and " protein determination " determine it than work
Property be 3.37 × 108IU/mg, the specific activity of control IFN-α 1b are 1.32 × 107IU/mg, the former is 25.5 times or so of the latter.
Embodiment 3: the stability test of new forms of interferon α
Previous embodiment 2 is purified into obtained new forms of interferon α and places 3 months under room temperature (25 DEG C) environment, herein mistake
The variation of periodically sampling observation appearance in journey, and purity, biological activity are detected (with " Pharmacopoeia of People's Republic of China 2015
Version (three) " as defined in " interferon activity measuring method ") etc. major quality controllings index variation, as a result as shown in table 1 below.It is right
The results are shown in Table 2 for 25 DEG C of stability tests of the IFN-α 1b answered.
25 DEG C of stability test results of 1 new forms of interferon α of table
25 DEG C of stability test results of 2 IFN-α 1b of table
Embodiment 4: the cell pharmacodynamic test of new forms of interferon α
(1) material
1, cell
WISH (people passes on amnion) cell, is provided by microorganism teaching and research room, medical college, New York University；
Vero (grivet kidney) cell is provided by Chinese Center for Disease Control and Prevention virosis research institute.
All passage cells secondary culture according to a conventional method.
2, viral
Follicularis Indiana plants of stomatitis virus (VSV) is provided by viral gene national engineering laboratory, and U.S. ATCC draws
Into；
MA plants of measles virus, herpes simplex virus I, II type (HSV-I, HSV-II), 7 type adenovirus (Ad7), 1 and of Cox Β
Sind β is virus is provided by Chinese Center for Disease Control and Prevention virosis research institute's seed culture of viruses center；
- 28 attenuated strain of epidemic encephalitis B virus (J Β EV-28) is people's lung diploid cell adapted strain, by virology
Encephalitis research department, research institute provides；
Respiratory Syncytial Virus(RSV) (RSV) is by isolated in China.
The above virus routinely passes on respective sensitive cells.
3, interferon
Natural human leukocyte interferon (nIFN-Le) is induced through NDV by people's peripheral white blood cells and generates and separate.
The equal > 10 of the specific activity of each interferoid6IU/mg。
(2) method: the measurement of antiviral activity of interferon
After above-mentioned cell forms single layer, the interferon of various concentration is added to handle, control group replaces interferon with nutrient solution.37
DEG C culture 24 hours after, incline interferon liquid, and with the above-mentioned virus attack of l00 TCID50,37 DEG C are continued to cultivate, to control group
After the complete lesion of cell, judging result calculates relative anti-viral activity from the concentration of added interferon.In same cell culture
It is control with VSV when comparing sensibility of the interferon to different virus, is all made of lesion and inhibits the antiviral of method measurement interferon
Activity.Acquired results are as shown in following table 3-5.
3 new forms of interferon α of table is compared with the relative anti-viral activity that other interferon infect different virus
4 new forms of interferon α of table is with other interferon to the inhibiting effect of encephalitis B on human diploid cell
5 new forms of interferon α of table is with other interferon to the inhibiting effect of Respiratory Syncytial Virus(RSV) on HeLa cell
The above results show that new forms of interferon α is respectively less than the antiviral titre of different virus on different cell strains
IFN-α 1b illustrates that the antiviral effect of new forms of interferon α is substantially better than IFN-α 1b under the same conditions.
Embodiment 5: the acute toxicity test in mice of new forms of interferon α
Taking weight is mouse 30 of 20g or so, is divided into 2 groups, every group 15.The 2 subcutaneous single injection of difference of group 1 and group
Embodiment 2 purifies obtained new forms of interferon α and IFN-α 1b.Be observed continuously 14 days after injection, as a result two groups be showed no it is any different
Often performance, shows that mouse, in 5.8mg/Kg or more, is equivalent to people's quantity to the maximal tolerance dose of new forms of interferon α
3480 times.New forms of interferon α and IFN-α 1b safety are suitable.
SEQUENCE LISTING
<110>Shenzhen Li Yunde Bioisystech Co., Ltd
<120>a kind of new forms of interferon α and preparation method thereof, composition and purposes
<130> -
<160> 1
<170> PatentIn version 3.3
<210> 1
<211> 158
<212> PRT
<213>people
<400> 1
Met Cys Asp Leu Pro Gln Thr His Ser Leu Gly Asn Arg Arg Ala Leu
1 5 10 15
Ile Leu Leu Ala Gln Met Arg Arg Ile Ser Pro Phe Ser Cys Leu Lys
20 25 30
Asp Arg His Asp Phe Gly Phe Pro Gln Glu Glu Phe Asp Gly Asn Gln
35 40 45
Phe Gln Lys Ala Gln Ala Ile Ser Val Leu His Glu Met Ile Gln Gln
50 55 60
Thr Phe Asn Leu Phe Ser Thr Lys Asp Ser Ser Ala Ala Trp Asp Glu
65 70 75 80
Ser Leu Leu Glu Lys Phe Tyr Thr Glu Leu Tyr Gln Gln Leu Asn Asp
85 90 95
Leu Glu Ala Cys Val Ile Gln Glu Val Gly Val Glu Glu Thr Pro Leu
100 105 110
Met Asn Val Asp Ser Ile Leu Ala Val Lys Lys Tyr Phe Gln Arg Ile
115 120 125
Thr Leu Tyr Leu Thr Glu Lys Lys Tyr Ser Pro Cys Ala Trp Glu Val
130 135 140
Val Arg Ala Glu Ile Met Arg Ser Phe Ser Leu Ser Thr Asn
145 150 155
Claims (6)
1. a kind of new forms of interferon α, it is characterised in that: the amino acid sequence of the new forms of interferon α such as SEQ ID No.1 institute
Show.
2. a kind of polynucleotides for encoding new forms of interferon α described in claim 1.
3. a kind of preparation method of new forms of interferon α according to claim 1, which is characterized in that the preparation method
Include the following steps:
(1) building of new forms of interferon alpha expression engineering bacteria；
(2) fermentation of new forms of interferon alpha expression engineering bacteria and chromatographic separation and purification.
4. a kind of pharmaceutical composition of new forms of interferon α according to claim 1, it is characterised in that: the medicine group
Close the pharmaceutical acceptable carrier for the new forms of interferon α and appropriate amount that object contains therapeutically effective amount and safe dose.
5. prepared by a kind of new forms of interferon α according to claim 1 or pharmaceutical composition according to claim 4
Purposes in the drug of prevention or treatment disease of viral infection.
6. purposes according to claim 5, it is characterised in that: the disease of viral infection is encephalitis B, breathing
Road syncytial virus infection or virus hepatitis.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811437104.3A CN109485718B (en) | 2018-11-28 | 2018-11-28 | A kind of new forms of interferon α and preparation method thereof, composition and purposes |
| PCT/CN2019/120575 WO2020108427A1 (en) | 2018-11-28 | 2019-11-25 | NOVEL INTERFERON-α AND PREPARATION METHOD THEREFOR, COMPOSITION AND USE THEREOF |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811437104.3A CN109485718B (en) | 2018-11-28 | 2018-11-28 | A kind of new forms of interferon α and preparation method thereof, composition and purposes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109485718A CN109485718A (en) | 2019-03-19 |
| CN109485718B true CN109485718B (en) | 2019-08-30 |
Family
ID=65698323
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811437104.3A Active CN109485718B (en) | 2018-11-28 | 2018-11-28 | A kind of new forms of interferon α and preparation method thereof, composition and purposes |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN109485718B (en) |
| WO (1) | WO2020108427A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109485718B (en) * | 2018-11-28 | 2019-08-30 | 深圳市利云德生物技术有限公司 | A kind of new forms of interferon α and preparation method thereof, composition and purposes |
| CN114533706B (en) * | 2022-02-15 | 2022-10-14 | 深圳市利云德生物技术有限公司 | Aerosol inhalation preparation for preventing and treating respiratory diseases and application thereof |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1570117A (en) * | 2003-07-18 | 2005-01-26 | 中国科学院微生物研究所 | Composite interferon expression method and vector used in the method |
| CN1202861C (en) * | 2003-07-18 | 2005-05-25 | 中国科学院微生物研究所 | Use of compound interferon in the treating of SARS disease |
| US7597884B2 (en) * | 2004-08-09 | 2009-10-06 | Alios Biopharma, Inc. | Hyperglycosylated polypeptide variants and methods of use |
| CN101525381B (en) * | 2008-03-04 | 2012-04-18 | 北京百川飞虹生物科技有限公司 | Novel recombinant consensus interferon and construction of a high-efficiency expression vector thereof |
| CN109485718B (en) * | 2018-11-28 | 2019-08-30 | 深圳市利云德生物技术有限公司 | A kind of new forms of interferon α and preparation method thereof, composition and purposes |
-
2018
- 2018-11-28 CN CN201811437104.3A patent/CN109485718B/en active Active
-
2019
- 2019-11-25 WO PCT/CN2019/120575 patent/WO2020108427A1/en active Application Filing
Also Published As
| Publication number | Publication date |
|---|---|
| WO2020108427A1 (en) | 2020-06-04 |
| CN109485718A (en) | 2019-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100424096C (en) | Survivin mutant containing HIV transduction structural area and its preparation method and uses | |
| KR101329878B1 (en) | Uses of recombinant super-compound interferons | |
| JP5709800B2 (en) | Interferon with altered spatial structure and its application | |
| CN109485718B (en) | A kind of new forms of interferon α and preparation method thereof, composition and purposes | |
| TWI375716B (en) | Recombinant human interferon-like proteins | |
| CN101230335B (en) | Herpes simplex virus and recombinant virus as well as host cell, and medicinal combination thereof | |
| CN113855665A (en) | Application of oridonin and/or prodrug thereof in preparation of medicines for inhibiting SARS-CoV-2 | |
| CN109485719B (en) | A kind of new forms of interferon α 1 and preparation method thereof, composition and purposes | |
| CN101230334A (en) | Herpes simplex virus and recombinant virus as well as host cell and medicinal combination thereof | |
| CN112704072B (en) | Application of wood frog antibacterial peptide in preparation of medicine for resisting novel coronavirus SARS-CoV-2 | |
| CN109467597A (en) | A kind of new forms of interferon and preparation method thereof, composition and purposes | |
| CN1740197B (en) | Recombination interferon with new space conformation and enhanced effect, its preparing method and application | |
| WO1986004506A1 (en) | Infection-protective agent containing human granulocyte colony-stimulating factor as effective ingredient | |
| CN108179151A (en) | A kind of recombinant IFN-alpha, preparation method and its application | |
| CN114539426A (en) | Fusion protein containing interferon alpha, recombinant strain expressing fusion protein and preparation method thereof | |
| WO2020108428A1 (en) | Recombinant human antiviral cytokine and preparation method therefor, composition thereof and use thereof | |
| CN101875688B (en) | Folic acid modification step of method for preparing recombinant tumor specific apoptosis factor and application of products of recombinant tumor specific apoptosis factor | |
| CN101921820B (en) | Preparation method of recombinant tumor specificity antiapoptotic factors with activity and application of products thereof | |
| JPH0699314B2 (en) | Macrophage activator | |
| CN104211802B (en) | Human blood coagulation light chain protein and its application | |
| CN114805539B (en) | Preparation method and application of pig interferon alpha 17 mutant recombinant protein | |
| CN112852817B (en) | Composition for RNA editing in III-A type CRISPR-Csm system and application | |
| CN101671388B (en) | Blood brain barrier penetrable erythropoietin (EPO) and application thereof | |
| TWI328011B (en) | Recombinant super-compound interferon | |
| CN101475636B (en) | Human interferon-like protein and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Hou Yunde Inventor after: Tang Xudong Inventor after: Song Yuli Inventor before: Hou Yunde Inventor before: Zhang Li Inventor before: Tang Xudong Inventor before: Zhou Minyi Inventor before: Li Hua |
|
| CB03 | Change of inventor or designer information | ||
| CP02 | Change in the address of a patent holder |
Address after: 518101 401 / 403, platform building of Key Laboratory of Virtual University Park, No. 1, Yuexing Second Road, high tech Zone community, Yuehai street, Nanshan District, Shenzhen, Guangdong Patentee after: Shenzhen liyunde Biotechnology Co., Ltd Address before: 518101 8e, unit a, business apartment, qianhaiyi building, Xin'an street, Bao'an District, Shenzhen, Guangdong Patentee before: Shenzhen liyunde Biotechnology Co., Ltd |
|
| CP02 | Change in the address of a patent holder |