TWI328011B - Recombinant super-compound interferon - Google Patents

Description

1328011 VI. Description of the invention: [Technical field to which the invention belongs] Its empty ί c〇) and

IKS's production steps 'which include the design of the codon-preferred design _ smart $ for the recombination of high-efficiency composite dry & 素 ^ = = ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ Recombinant Efficient Carrier Approximation and Recombinant Efficient Recombinant Interferon by Recombinant Efficient Carrier Approximation and Appropriate Appropriate Drugs Containing 4, (4) Interesting Interference and Its Approximation and Therapeutic Amount Membrane drug administration, intramuscular injection, subcutaneous injection, peritoneal injection, nasal cavity or dry [previous technique] The structure of the humanoid predicate subtype is the most conscious amino acid SUflll1 Description, has been psychologically described ^ wounded active, has strong antiviral and anti-tumor and natural kill;; ϊίf V372808 7 ^ IFN'C〇n ^ inflammation = Ϊ 97iH6. 8 disclosed the use of C_nSUS interferon to treat C again The type of liver is used to treat hepatitis B and hepatitis C. The method for preparing recombinant human C0nsensus interferon 公开 and the treatment of hepatitis B and hepatitis C are disclosed. The Pharmacy Administration (FDA) approved the INFERGEN® (interferon alfacon-i) from the United States at the end of 1997 for the diagnosis of patients with hepatitis B. When detecting surface antigens (HBsAg) ) positive and e-prototypical (HBeAg)-positive patients can be judged as hepatitis B patients, currently using a variety of 3 fees alpha-interferon for the treatment of chronic hepatitis B, ϊ 挥 其 其 抗 抗 抗 抗 抗 抗 和 和 和 和1 ί: ί2ίϊϊ Replication of virus in infected cells. But all 3 ί / / this inhibition disease, DNA and Xinjiang, can not inhibit e antigen and s antigen. Some interferon should be disclosed herein. Detailed description of the recombinant high-efficiency complex interferon, preparation method and [invention content] The group of high-efficiency compound dry * is improved by (rSIFN-c〇) and - type change # or Sometimes 2; warm 2^ sex may sometimes be missing P substance =. It is -: 勿:; &the mode of the interferon ▲" son. u son also °j: jj interferon is (10) has a unique secondary or tertiary structure. (See Figure 6) The spatial structure of the highly efficient complex interferon described by the post-dry process The change is due to the high efficiency of its production. The sr is known by a s» member with a special promoter. The sr is activated by the sr. sr. 1328011 sequence is observed. (4) 胄 偏 偏 对 对 野生 野生 野生 ^ ^ 469 469 469 469 469 469 469 469 469 Was used by her μ, and therefore ί reverse SSHi; :3⁄4 毒 £I:S^ X 兹本本本 hairpin ^有(10) 1328011 malignant tumor skin cancer basal cell carcinoma malignant melanoma renal cell carcinoma - liver cancer --- --- squamous adenocarcinoma ~~ 1 nasopharyngeal carcinoma solid tumor prostate cancer gastric cancer esophageal cancer colorectal cancer adenocarcinoma breast cancer ovarian cancer, superficial bladder cancer _------- jk tube tumor squamous cell Cervical cancer ~ Non-small cell lung cancer Small cell lung cancer Glioma Malignant hematological leukemia Acute white blood · Disease chronic leukemia 'A diffuse granulocyte leukemia----- Hairy cell leukemia*~~~---- Lymphoma -tumor--severe disease--丨other--tumor ________ The amount of recombinant high-efficiency complex interferon and tumor interferon can inhibit the awake replication of HBV and HBsAg and column. The artificial interferon or similar artificial gene coding sequence and other molecular life; Description of microsequences, methods of the evening, such as: Joseph Sambrook 1328011

And David W. Russell, Molecular Cloning (Molecular Cloning n A Laboratory Manual, December 2000, published bv Cold · Harbor Laboratory Press. ^Pnng's plant provides a gene containing high-efficiency composite pre- and its approximation The donor's Ϊ5-day gene with high-efficiency complex interferon and its approximation will contain S-containing substances including: culture conditions T culture silk up the composite dry, age-aged cells in the appropriate body, ΐίίϊΐϊΙΙ^ leaven Extraction of high-efficiency complex interferon in liquid, purification inclusiveness. Production of active interferon into lyophilizate or liquid liquid injection], A, and A combination of compounds The present invention also provides a mixture of high-efficiency composite interferon produced by the above method. a method containing a highly effective compound dry age or near her and a suitable carrier, containing a red compound or a similar substance, and an appropriate medicinal f, giving ί5Ιίί2;;??ϊ, a method for catching a disease, a liver The diseases include: μ hepatitis, <, his type of liver 7 inflammation. Disease caused by the following viral infections 1328011. Epstein-Barr virus, cellular melanoma virus, herpes simplex virus, 苴他^ ? ί Small, ribonucleic acid, adenovirus: visceral virus, m virus, type 11 human murine leukemia virus, or hi type human white*: membrane administration, inhalation through a beer suction machine. The main method of intraoperative injection, nasal cavity or dryness is to use the following method: Le, mother-injected 9 gg or 15, three times a week, 24 weeks a course of treatment. The recombination of the protein space structure is a preparation that not only inhibits the hepatitis B disease, but also inhibits the secretion of HBsAg and HBeAg in the cells. This is the use of this preparation ί only SS disease Ν? 2, the inflammation of the e antigen, so that it is reduced to normal levels. (d) one of the results of liver silk surface antigen and hepatitis B will be aj, rSlFN-co is produced by recombinant technology. E. coli codon preference redesigned IFN DNA庠#L古Ϊ ΐ. The cDNA sequence of 1'SIFN-co was cloned into the expression vector of Dashuifu. This high expression vector was passed. [_Inducing/activation expression of the strong PBAD promoter in the Arab-J mechanism initiation vector Control system has several significant advantages over other commonly induced by the genetic engineering production system: ⑴ usually

Γίΐί J^: pr^'AraC efficient E. coli expression system; (2) crypto d promoter activation ώ, - arabinose dose linear relationship. This makes it very important to directly regulate the formation of foreign gene products by changing the concentration of 8 1328011 arabinose. Adding the characteristics of Arab tolerance to the change of the inclusion system exogenous gene products in E. coli t temperature / pH and other easier to directly control the cheap, non-toxic, which overcomes other lure surface = source rich 'rSIFN-cTo Qianda' The effective and stable 23⁄43⁄4ized rSIFN-C0 egg is used in the present invention, and the research is on the redundancy of the big bed. (4) The following are some preparations of rSIFN-co such as: μ Nanxun, shed poison injection, mouth Inhalation, sputum, solution, 'application, oral liquid, patch, medicine _ body, these fine---(4) acceptable substances, the present invention also provides a medicinal mixture containing the above mixture and appropriate carrier The different purposes of Jing Genming, "a carrier of _, refers to any standard use but is not limited to any fresh (four) carrier such as:

The body of Sii ii 22 often contains such things as: starch, lotion, sugar, some type of oyster sauce, t ϋ^, succinic acid and its salts such as: magnesium stearate or calcium stearate, talc, plant Li Alcohol or other known excipients. These carriers may also contain coloring agents and other ingredients. The ingredients in these carriers can be used in the conventional art, and the following examples will help to better understand the present invention. However, with skill in the art, one should be aware that the discussion of a particular method and result is merely an exemplification of the invention referred to in the claims appended hereto. [Examples] Example 1: Recombinant efficacious interferon (Recombinant Super Compound 1328011 material, 5== under the control ==, mechanism initiation # E. coli cDNA sequence synthesis

Deng papi new FN u^^^rsl § greatly [7] C in the use of the surface of the bacteria to set up the rod for the new has been winning the order and the big acid line P Ma ammonia FN weight 1 rsl_il> ffl yo SN-C^ teIFN order full _rsNA complete rhCDf up to co_ table to N-number ten-effect IFU sit high-code rsli5 first ^? Zhongyou: 0 HU 4Χ77Γ 4.3-· base into β-ammonium 醆 synthesis E. coli cDNA Synthesis of sequence rSIFN-co cDNA 5 - terminal and 3 - terminal half-molecules Direct synthesis of rSIFN-co cDNA 5 > - 280 bp (I fragment) and 3 - bp bp (Π fragment) cDNA by PCR Half molecule. The 3-terminal end of fragment I has a 41 bp nucleotide sequence overlap complementary to the 5/-end of the fragment. /, (1) Chemical synthesis of the following oligodeoxynucleotide fragment Oligomer A: S'ATGTGCGACCTGCCGCAGACCCACTCCCTGGGTAACCGTCGTGCTCTGATCCTGCTGGCTCA GATGCGTCGTATCTCCCCGTTCTCCTGCCTGAAAGACCGTCACGAC3' (SEQ ID No: 7)

Oligomer B: 10 1328011 S'CTGAAAGACCGTCACGACnCGGTTTCCCGCAGGAGAGGnCGACGGTAACCAGnCCAGAA AGCTCAGGCTATCTCCGHCTGCACGAAATGATCCAGCAGACCnC3, (SEQ ID No: 8)

Oligomer C: 5'GCTGCTGGTACAGTTCGGTGTAGAATmTCCAGCAGGGATTCGTCCCAAGCAGCGGAGGAG TCTTTGGTGGAGAACAGGnGAAGGTCTGCTGGATCAITTC3, (SEQ ID No: 9)

Oligomer D: b1 nC£ClGCYGGmkmaKC\CCGkkClGncaGCkGClGl^CGkCClGGKkGCnGCG TTATCCAGGAAGnGGTGTTGAAGAAACCCCGCTGATGAAC3, (SEQ ID No: 10)

Oligomer E: S'GAAGAAACCCCGCTGATGAACGnGACTCCATCCTGGCTGTTAAAAAATACnCCAGCGTAT CACCCTGTACCTGACCGAMAAAAATACTCCCCGTGCGCTTGGG3' (SEQ ID No: 11)

Oligomer F: 5 TTATTCTTTACGACGCAGACGTTCCTGCAGGTTGGTGGACAGGGAGAAGGAACGCATGATTT CAGCACGAACAACTTCCCAAGCGCACGGGGAGTATTTnTTTCGGTCAGG3, (SEQ ID No: 12) PCR reaction I synthesizes rSIFN-co 5, terminal half molecule: using polyoxydeoxynucleotide fragment B as the template 'A and C two oligodeoxynucleons As a primer, the peri-acid fragment was subjected to a pcR reaction to synthesize a 280 bp rSIFN-co 5 --terminal half molecule product. Reaction mixture: (production: 1) _ nuclease-free disinfection steamed water 39 5 2 lOxPfu reaction buffer (produced by Stratagen, USA) dNTP mixture (each dNTP concentration is 2·5mm〇l/L) A fragment Primer (25/zmol/L) C fragment primer (25//mol/L) B fragment module (1 emol/L)

Pfu DNA polymerase (produced by Stratagen, USA) (25U/ //1)___ total volume 11 1328011 50//1 95〇C2^-(95〇C45m->65〇C1 72°C1 - ) χ25 cycles -

PCR reaction cycle 72°C10"-4°C PCR reaction II synthesis of rSIFN-co terminal half molecule: wide extraction soil

Duanyu as a module, D and F two oligodeoxynucleotide fragments for nucleoside reaction to synthesize a length of 268 bp rSIFN-o) 3 end half-point $= thing' 仃 PCR reaction mixture: (unit: / /1)_ Aseptic steaming water 39 lOxPfu reaction buffer (produced by Stratagen, USA) 5 dNTP mixture (each dNTP concentration is 2. 5mra〇l/L) 2 D fragment primer (25#mol/L) 1 E fragment Primer (25/zmol/L) 1 1 F fragment module (1/zmoI/L) 丄1 Pfu DNA polymerase (produced by Stratagen, USA) (25U/ ΡΛ) 1 Total volume 50//1 / rSIFN-co Assembly of cDNA molecules The above-described PCR-synthesized I and sputum fragments were assembled using an "overlap-extension PCR" method to obtain a complete rSIFN-co cDNA full-length molecular sequence. And Nde I and Pst I restriction sites were introduced at their 5 / - and 3 > - ends, respectively, to facilitate cloning of the rSIFN-co CDNA sequence into a plasmid vector. (1) Chemical synthesis primers

Oligomer G : 5*ATCGGCCATATGTGCGACCTGCCGCAGACCC3, (SEQ ID No: 13)

Oligomer H : 5, ACTGCCAGGCTGCAGnATTCTTTACGACGCAGACGnCC3, (SEQ ID No: 14) 12 1328011 (2) "Overlap-extension PCR" reaction reaction mixture: Unit (//1)___~ Nuclease-free sterile distilled water 38 lOxPfu reaction buffer (produced by Stratagen, USA) 5 dNTP mixture (each dNTP concentration is 2. 5 mmol/L) 2 Primer G (25/zmol/L) \ Primer H (25/zmol/L) 1 * Fragment IPCR product (1/zmol/L) ι * Fragment II PCR product (l^mol/L) 1

Pfu DNA polymerase (produced by Stratagen, USA) (25U/βΐ) 1 total volume _ 50 "1 *The PCR product was first purified and then dissolved according to the StrataPrep PCR purification kit manufactured by Stratagen, USA. In sterile distilled water. ° PCR reaction conditions and cycles are the same as the aforementioned PCRI. Cloning and sequence analysis of the rSIFN-co gene The pLacT7 plasmid was used as a vector for the rSIFN-co cDNA gene clone. What is the pLacT7 plasmid? 811^(^卩1;111^(+) plasmid (manufactured by 81^7 & 611, USA), the plasmid map is shown in Figure 3. The StrataPrep PCR purification kit (produced by American Stratagen) will contain The rSIFN-co full-length cDNA PCR product was purified, and then digested with Mel and PstI; the pLacT7 plasmid was double-digested with Ndel and PstI. The two digested DNA fragments were separated by electrophoresis on 1% agarose gel. Then, the 5 〇 7 bp long rSIFN-co DNA fragment and the 2. 9 kb plasmid cleavage DNA fragment were purified, and the two were ligated into a recombinant plasmid by T4 DNA and henase. The ligation reaction mixture was transformed into DH5a competent cells (Gibco, USA). Produced by the company. After incubation at 37 ° C overnight, select positive recombinant colonies, 1328011 named ρΗΥ-1. Current DNA sequence analysis kit (seqUiThermTM Cycle Sequencing Kit, purchased = American Epicentre Technologies) instructions for DNA sequencing ^ The primers should be the universal T7 and T3 primers, and the DNA sequencing results showed that they were consistent with the theoretical design. Af-recombinant rSIFN-C0 protein was used to determine the 16 amino acid sequence of the end. The σ fruit is consistent with the theoretical sequence of the N-terminal amino acid in Figure 4.1. The result is: Ν-end

Construction, transformation and restriction enzyme digestion of Cys-Asp-Leu-Pro-G1n-Thr-H i s-Ser-Leu-G1y-Asn-Arg-Ar g-Ala-Leu- (SEQ ID No: 15) Construction and transformation of its genetically stable expression vector (IV) Expression vector sound 4 plasmid, see Figure 3, first digested with Nde 1 to make ϋίί > ( =eailzed), and then fully enzymatically digested with Xba 1 . After 1% agarose gelatin electro-ice ice, and then using QIAEXn kit produced by QIAGEN of Germany, 1% cytoplasmic lii5 Π will turn over and cut l'it after the enzyme WT is double-W, I β-accumulate ba ΜConnected and painted. I large VA sense in debpDNJ said TN15T4DH agricultural break b7 in the chemical S in and out J special granulation section 137 ° If pure (four) shot PHY-I4.t plate 钊.IPH will be fat s: t > and 4 ° Joan this fco diagram _ With N-see BA sugar IF, LB lipid rs granules in the screening of positive clones S ί ί ΐ 选 选 选 选 选 选 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核 核The PG5 quality r-granule Jl'iSIFN-C〇 gene is regulated by the strong promoter Pbad and the regulation of the PBD and Ara C protein. Ara q is a protein encoded by the ^^ gene. In the absence of arabinose -1 1328011 relieves inhibition of transcription. The arabinose is also categorized, and the transcription of i1 and i2 is combined, so that the high-% mouth 1IFN can be detected and the amount of detection can reach 50% of the total protein of the cell. Expression of rSIFNco expression summary & f-conserved active amino acids in the f-dry age = use ίίΙΚϋϊΐ high-degree rS win (7) protein for "the treatment of ί ί 构建 构建 构建 构建 构建 构建 rs rs rs rs rs rs rs rs rs rs rs rs rs rs rs rs rs rs rsiFN-c〇 amino acid sequence, using the large intestine rod _ first S sub # ΐ ΐ ΐ ϋ ϋ: ϋ 1, code rS win (7) full length 167 amino acid residues of the _ gene, sub-DNA sequencing # two-way sequencing analysis It is proved that the authenticity of the 全长(4) subsequence of the full length 5〇ibD is consistent with the theoretical design. And the recombinant protein carries the ammonia fraction composition and $, t # Ϊ the full 4 long coding gene cloned into our constructed Escherichia coli efficiently The recombinant ρΗΥ-4 plasmid was expressed to obtain the recombinant engineering plasmid ρΗγ_5. Further, the granule was transformed into Escherichia coli LMG194 strain to obtain rsiFN-co efficient and stable expression engineering, and the strain was analyzed after PVin passage 3 generation. The results showed that the recombinant plasmid prγγ5 was passaged in the colon of L. sinensis LMG194 cells, and there was no abnormality, and the expression of rSIFN_c〇 was highly efficient and stable. The results showed that 'we prepared the pHY-5 plasmid containing £π" Bacillus is an ideal engineered strain that stably expresses the rSlFN-co protein. References 1. Blatt LM, Davis JM, Klein SB. et al. The biologic activity and molecular characterization of a novel synthetic interferon-alpha species, consensus interferon Journal of Interferon and Cytokine Research, 1996;16(7):489-499. 2. Alton, K. et al: Production characterization and biological effects of recombinant DNA derived human IFN-α and IFN-r analogs. In: 1328011

De Maeger E, Schellekens H. eds. The Biology of Interferon System. 2nd ed. Amsterdam: Elsevier Science Publishers, 1983: 119-128 3. Pfeffer LM. Biologic activity of natural and synthetic type 1 interferons. Seminars in Oncology, 1997; 24(3 suppl 9): S9-63-S9-69. 4. Ozes ON, Reiter Z, Klein S, et al. A comparison of interferon-conl with natural recombinant interferons-α: antiviral, antiproliferative, and natural killer- Inducing activities. J. Interferon Res., 1992; 12:55-59. 5. Heathcote EJL, Keeffe EB, Lee SS, et al. Re-treatment of chronic hepatitis C with consensus interferon. Hepatology, 1998;27(4) :1136-1143. 6. Klein ML, Bartley TD, Lai PH, et al. Structural characterization of recombinant consensus interferon-alpha· Journal of Chromatography, 1988;454:205-215.

7. The Wisconsin Package, by Genetics Computer Group, Inc. Copyright 1992, Medison, Wisconsin, USA 8. Nishimura, A et al: A rapid and highly efficient method for preparation of competent £ co//cells. Nuclei. Acids Res. 1990, 18:6169 9. The "Molecular Cloning" techniques referred to in this document refer to: Sambrook, J., EF Fritsch, and T. Maniatis. Molecular CLONING: A laboratory manual 5 2nd ed. CSH Laboratory Press, Cold Spring Harbour, NY.1989. 10. Guzman, L. Metal: Tight regulation, modulation, and high-level express-ion by vectors containing the arabinose Pbad promoter. J. Bacteriol· 1995, 177: 412 Bu 4130. Example 2 rSIFN- Separation and purification of co. The fermentation genus of the bacterium is inoculated in a 3rc shake flask in a medium (20) overnight (about 1 liter of liquid added to a 50% concentration of 30% glycerin and mixed into 1 101 per -20 C was stored as a production strain. _ Seeds were added to LB medium at 37 °C in a ratio of 1%, cultured overnight, seed bacteria, added to RM medium at a ratio of 10%, 37 ° C, pH 7 0, alcohol to 〇De. Add arabinose (20%) to the final concentration of 0. 02 ° / 〇 16 16 1328011 Guide '4 hours, centrifuge, collect bacteria. The pulp machine is broken and the liquid is 4 ί suspended, set -20 t: the precipitate is twice, then washed with steamed water. The buffers B and C are washed separately, denatured and renatured τι * 10000 m_, Add the denatured solution three times for about three times (about 18 h), then dialyze 10 times of PB buffer and fine water in 10 。 。. After dialysis, H/L, 5 mol/L (pH 5. 0), adjust the pH. Separation of 疋 ' ' with 2 m 〇 1 / L of acetic acid - sodium acetate III, purified US cation chromatography \ column first with 20 mmol / L of sodium acetate monoacetate (pH 5. 〇) balance, 30 ml / min Speed loading, v 20 column volumes of 20 mm 〇l / L sodium acetate monoacetate (pH 5 · 〇) (extracted protein) ▼ 5 column volume containing 0.15 mol / L gasification of 20 _l /L acetic acid - sodium acetate r (depleted heteroprotein) 3 column volume containing 0.18111 〇 1 / 1 sodium chloride 2 () 111111 〇 1 / 1 ^ acetic acid monoacetate (oil 5 ()) (elution Protein) · 20 ramol/L sodium acetate monoacetate (pH with 0·25 mol/L vaporized sodium) 5. 0) (dissociated target protein) 夯广子岁和/##fchelating sepharoseTM fast flow) : HS dissociated protein solution added 0.2 mol/L, pH 6. 6 PB buffer and 4 mol/L gas After the sodium is adjusted to 1 mol/L of sodium sulphate pH 6. 0, it is ready for loading. ° J 3 column with 50 mmol / L sodium hydrogen wall disodium buffer containing 1 mol / L sodium chloride (pf [ ^ balance; 丄ψ 1 ml / min speed loading 50 mmol / L disodium hydrogen phosphate Buffer (pH 5 〇) (extracted protein) ψ 50 mmol/L disodium hydrogen phosphate buffer (pH 4 ()) (extracted protein) 50 _1 / L disodium hydrogen phosphate buffer (ρΗ 3 · 6) (dissociated target protein) Dissociated target protein solution diluted 3 times, and adjusted PH5 0 on HS, f 13⁄4 love green record although smuggling molecules _ (sephacrrl Note:

m^K: 100 nnnol/LTris pH 7. 5-10«Ι/LEDTA^lOO raffl〇l/L

-10 mmol/L Liquid _1/L Tris Hydrochloric acid pH 7.5-i m〇1/L Urine EDTA—0. 5% Triton X-100 ^

-10 mmol/L buffer C : 50 imnol/L Tris hydrochloric acid pH 7. 5-2 m〇1/L urine EDTA—0. 5°/〇 Triton X-100 ^

=Liquid: G. 5 mQl/L fine button -150 mmGl/L Tris thief pH 7. 5—Q 2 _1/L

LB medium: 1 L peptone 10 g 'yeast extract 5 g, gasified sodium i〇g RM medium: 1 L disodium hydrogen phosphate 4 casein 20 g, magnesium gasification 1 leg 〇 1 to 〇.203 g) g 'filling acid · one wind clock 3 g, gasification nano 〇 · 5 g, gasification amine ig preparation example formula: 1328011 iyi

QC

1328011

Process" Isoelectric focusing UV spectrum (wavelength range: 190-380 peptide map (pancreatic enzyme hydrolysis, C-18 column analysis, N-terminal sequence determination, C-terminal sequence determination, circular dichroism, amino acid analysis)

According to the Biological Bacterial Endotoxin Test Regulations

Appearance inspection Chemistry According to the biochemical and other verification methods, the method of "interferon ratio p is determined"

_ than the live test; ^ sterility test abnormal toxicity pen to shame original quality sound stability mystery. "Chemical and other verification methods", ''Bioproducts test the original quality test, find the bacterial endotoxin test procedures, can be in the Chinese iff products SiSSJSV Duan Zhibing, etc.; Chinese biological products, recombinant high-efficiency complex interferon injection The stability of lyophilized powder injection is stable iSi group = § prime £ =, sample into 20 1328011 1. Sample source ί ϊ combined with interferon continuous ball two kinds of specifications Wei powder injection prepared by Sichuan Province The batch numbers of the pilot samples are: 990HU, 990102, 990103. 2. Sample Standards Each sample of this experiment should meet the requirements of the following table before testing. Table 1 Samples before the test. Appearance 2. Dissolution time 3. Clarity 4. pH value 5. Potency (IU/branch) 6. Moisture-IL amount White loose body The water for injection dissolves rapidly at room temperature (within 2 minutes) Colorless or micro-cyanified clear liquid, should not be turbid, contain foreign matter or precipitate without shaking. , 6. 5-7. 5 80%~150% of the indicated amount (9#2: 4.5 million IU, 15/zg: 7.5 million IU) ^A^3^Q°/〇(W/W)__ 3. The content of the test is to be sampled in a refrigerator at 2~8 °C, and the samples are set to record 2, 18, 24, 30, and 36 months, respectively, and the above indicators are defeated, and the sample is placed in the hungry In the incubator, HH, 6, 9, 12, 18, 24, and 3M samples are set separately, and the above indicators are measured and 4, i, and U 2 are sampled, and the above indicators are measured and recorded. Bu 99_2, 99_3) Each of the two gauge sampling system indicators, and the test indicators before the test in line with the I Γ gastric descending trend, the three batches of sample titer changes similar, the rest (990101 '990102 '990103) grid m5c sample retention inspection ' Sampling and testing various indicators at different times, compared with 1328011 before the test, within g months, the titer did not change much, and the rest of the test indicators required the symbol. (3). Freeze-dried rSIFN-co three batches (990101, 990102, 990103 ) Each of the two specifications, the product is observed at 2~8〇C, and the various indicators are sampled and tested at different times. Compared with the test, the titer is stable within 9 months, no obvious change, each test indicator Requirements. w We recommend that the freeze-dried recombinant high-efficiency composite interferon should be stored and transported at a low temperature. If there is no condition, it can be placed at room temperature in a short time (3 months). Example 4 rSIFN-co inhibits HBV -DNA replication and secretion materials of HBsAg and HBeAg • Solvent and preparation method: When preparing the test drug, add 1 ml of normal saline to each raw material bottle, dissolve it, and then mix it with MEM culture solution according to the difference of the different dose groups. Control drug: IFN-a2b produced by Schering can be a lyophilized preparation, each of which is 3 χ 106 ϋ with a culture solution of 3xl 〇 6nj / ml solution. The dry smelting produced by Amgen is Injection: 9pg per each, 0. 3nU' is equivalent to 9xl〇6IU/branch, and the culture medium is mixed with 9xl06IU/ml solution in the experiment '4°C refrigerator, 2. 2.15 cells: Hepatitis B virus (HBB) DNA Clone transfected human hepatoma cells (Hep G2) 2. 2. 15 cell line, constructed by Mount Sinai Medical Center, USA. Reagents: Eagles MEM dry powder 'American Gibco products; fetal bovine serum, American HycloneLab products; G-418 (Geneticin) , MEM preparation American Gibco product; L-prolinamide, Jingke Chemical Reagent Company imported sub-package; HBsAg, HBeAg solid-phase radioimmunoassay kit 'purchased from China Isotopic Company North Immunoreagent Institute; Kanamycin, Huabei Pharmaceutical Factory Product; Lipofectin, a product of Gibco, USA. Laboratory supplies and instruments. Culture flasks 'Denmark TunclonTM; culture plates 96-well plates, 24 wells, Coming, USA products: carbon dioxide incubator, US Shel_Lab products. MEM medium l〇〇ml: containing fetal calf serum 1%, glutamine 1%, G418 380pg/ml, kana toxin 50U/ml. Test method 2. 2.15 cell culture: add 〇 in a flask filled with 2. 2. 15 cells. 25% pancreas 22 1328011 enzyme ' 3rc digestion for 3 minutes, add culture solution to blow ' 1:3 passage, 10 days long full. Toxicity test: The test was divided into no drug cell control, plate mother hole 200μ1 37C 5 rot) 2 for 24 hours, and the cells were grown into a single layer and then experimented. With Su ΐ ΐ ϊΛϋ 干 兰 兰 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 用 ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ ΐ Lesion, complete destruction was 4; 3it^ was 1; no lesion was G. Calculate the average fineness of each concentration of liquid (tc〇)# eed (TC5〇)

AB TCs〇=Antil〇g (B+^—®xC) A=l〇g>50% drug concentration B=log<50% drug concentration C=l〇g dilution factor ΑΜ·ίί HBeAg, HBsAg inhibition test: test design HBeAg, HBsAS positive to Zhao group, ^ birth control group, cell control group and different drug concentration administration group. 7 〇 per ml) solid i2. ί5 6-well cell culture plate, 3 ml per well, 37 ° C 5% C 〇 2 culture 24 〇 〇, poison & 3 times diluted test solution, 5 dilutions respectively 4. 5χ ^ =, 1 5x10 I,, (). 5xl() 6IU/ml, 〇17xl() 6lu/ml, and 〇〇56χ ^ 2 '37°C 5%C〇2 culture 'every 4 days The culture medium was harvested at 8 days after the original concentration of the drug solution, and stored at -20 ° C. The test was repeated in three batches and tested separately, ^sAg and HBeAg. HBsAg and HBeAg were measured by the solid phase radioimmunoassay kit of the China Institute of Isotopes North Freedom Institute. The method was found in 蚩, and the c-value of each well was determined by Y-counter. Brothers used drug effect calculations: calculated cell control and Cpm mean and standard deviation per concentration, P/N values such as percent inhibition 'half effective concentration (IQo) and selection index (file si'). 1 Antigen inhibition percentage (%) - Cell control · Administration group cpm Cell control ςρ/η 23 1328011 2 Calculate the half effective concentration of the drug-inhibiting antigen (IC5〇: IC50=Antil〇g (B+x〇上=1〇g> 5°% drug concentration (Μ_释倍数对服^|/^=^^ Efficient compound interferon in 2.2.15 cell culture#|B, Ag and HBeAg selection index (5)), according to its cytotoxicity index Cytopathic (9) ςτ: _ cytopathic sputum sputum 7 ^ ICS0 4 by t test to calculate the differential drug between each diluted lysine SAg, HBeAg and control group, intracellular HBV-DNA extraction: 2. 2. 15 cell Ϊ Body 4 phenol, gas imitation * 岔 cells, adding cell lysate, lysing cells, ϊϊJiS sinking 2 times, high speed 1 〇, _ centrifugation, taking the supernatant, body analysis relative density, calculation inhibition ^ and ° IC5 (). Tian Xian tablets, the gel-Pro gel analysis soft results maximum recognition": Table 3) shows: the sample with a degree of 9. 0 compilation _ 61_ to HBeAg large non-toxic (P < 0.001), ICso is 4. 54 ± 1. 32xl〇6IU/ml, select ς; the average inhibition rate of ne is 44. 8±6 genera, 丨96; right, skillfully 2.77. Therefore, recombinant high-efficiency compound interference has 0, select inflammation Facial antigen and e antigen activity, and on the group of disturbances ^|^ have ^ _ inhibition of hepatitis B =. Clinical cases have also confirmed the chronic activity of the ^ ^ above the interaction of interferon red Zhejiang record cpu e complex 24 1328011螽私4丨城 ICso 602.74446016 Accumulated inhibition rate 0. 614693546 0. 300392321 0. 08867188 0. 001633453 CD ICs〇641.7736749 i Accumulated inhibition rate 0. 595006426 0.286349225 0.113977019 0.058767408 0.02918541 1-Accumulate 0.592921 1.254924 2. 059088 3. 054091 4.054091 1 - Accumulation 0. 627739 1.370724 2. 27756 3. 20033 4. 077742 Dilution multiple 3 0. 945909 0. 5388299 0.200833 0. 0049969 Dilution multiple 3 0. 922258 0. 5499972 0.292983 0.1998179 0.122588 Average inhibition rate 0.407079 0. 337997 0.195836 0. 004997 〇> average inhibition rate 0.372261 0.257014 0. 093165 0. 07723 0.122588 blank 0 third inhibition rate 0. 345659 0. 369269 0.2005 〇> blank 0 third inhibition rate 0.392693 0.191053 0.118149 0.097661 0.077173 second inhibition rate 0.43935 0. 245347 0. 0005 〇>〇> Second inhibition rate 0.381936 0. 336008 0.084856 0.051221 0.201639 First Rate 0. 436227 0. 3993754 0. 386508 0. 014991 L______ o First inhibition rate 0. 342155 0.2439816 0. 07649 0. 082807 0.088953 Cell control 16010 'Ί城: 10476 10098 12800 16824 118934 i______ Cell control 11714 'Ί城7114 9476 10330 10570 10810 tv 躲 hiding 8976 12082 16002 19306 22270 躲 hiding 7240 7778 10720 11114 9352 tv 1 9026 9616 9822 15770 19172 tv 1 7706 8856 10818 10744 10672 e antigen concentration (10,000 IU / ml) 〇§ 〇CO Ο Ο -丨·丨·< 33.33333 11.11111 Surface antigen concentration (10,000 IU/ml) ◦ cz> 05 Ο <=> CO Ο Ο 33.33333 11.11111 1328011 螽驷4-:r Hide: <« ICso 365.9357846 Accumulated inhibition rate 0.737521972 0. 447563245 0.79201839 0. 063933386 0. 03148073 ICso 611.0919568 Accumulated inhibition rate 0.634835847 0.252210647 0.04583464 0.001632835 0.001237728 1 0. 487992 1.060496 1.816423 2. 74677 3. 628819 1 0.513937 1.207957 2·111612 3.111612 4.106523 Dilution multiple 3 Μ: 1.371181 0.8591731 0.4316522 0. 1876045 0· 117951 1 Dilution multiple 3 0. 893477 0.4074138 0. 101434 0.005 0891 0.005089 Average inhibition rate 0.512008 0.427497 0. 244072 0. 069653 0.117951 Average inhibition rate 0.486063 0.30598 0.096345 Ο 0.005089 Blank 0 Third inhibition rate 0.467054 0. 477884 0. 244072 0. 77291 0.121865 Blank 0 Third inhibition rate 0.497571 0.278452 0.11433 Ο 0.015267 The second inhibition rate is 0.514592 0. 394209 0.18901 0. 00741 0. 222982 Second inhibition rate 0.462353 0. 259715 0. 027412 ο First inhibition rate 0.554378 0.4103967 0.299134 0.124259 0.009006 First inhibition rate 0. 498265 0. 379771 0.147294 ◦ CD cell Control 16962 tv 'Ί 姝 9350 9160 13262 16188 15406 Cell control tv 姊 5792 8318 10210 13478 11352 城 City · 8516 10628 14228 17414 13632 Ί City: 6198 8534 11212 12368 11634 tv 1 械 · 7818 10344 12296 15364 17386 (V 1 City: 5784 7150 9830 13942 12418 e antigen concentration (10,000 IU/ml) 〇«〇05 〇<〇CO Ο Ο 33.33333 11.11111 Surface antigen concentration (10,000 IU/ml) CD CD Ο Ο Ο 1丨丨丨· 33.33333 11.11111 1328011 龠驷骂Ή-姝: <zan IC5〇382.0496935 cumulative inhibition rate 0. 70959954 3 0.440859127 0.172641621 1 0.082519158 0.014875633 ICso 694.7027149 Accumulated inhibition rate 0.597838293 0.182690031 <=> o 〇1 - accumulate 0.538969 1.085603 1.929332 2.738631 3. 683017 M: Λ 0.513349 1.236875 2. 236875 4.236875 Dilution multiple 3 1.316983 0. 8559525 0. 402586 0 2463153 0. 055615 Dilution factor 3 0.763125 0.2764738 CD <Z5 〇 average inhibition rate 0.461031 0.453366 0.156271 0.190701 0.0055615 average inhibition rate 0. 486651 0. 276474 c=>c=> 〇) blank 0 third inhibition rate 0.521872 0 477066 0.178517 0.216602 0. 072751 Blank 0 Third inhibition rate 0. 521054 0. 364272 cr> CD cz> Second inhibition rate 0.433204 0. 40856 0.251975 0. 244547 0. 094093 Second inhibition rate 0.442035 0.230425 〇) First suppression Rate 0.428016 0. 4744723 0. 038321 0.110954 First inhibition rate 0. 496864 0.234725 o Cell control 17544 tV 'Ί城8110 8870 13934 13288 15728 Cell control 11528 Third hole 5346 7096 11394 13110 13342 tv Ί κ 9614 10032 12688 12814 15366 tv Ί 6228 8590 I 11360 ! i 11582 12336 tv l Hide 9702 8914 16312 15080 21928 1 5616 8542 11420 12656 13142 e antigen concentration (10,000 IU/ml) cz>C2> ¢33⁄4 C=> CD CO cr>c=> i 1 i 33.33333 11.11111 Surface antigen concentration (10,000 IU /ml) CD 〇> CD Ο 〇> CO 〇〇> 33. 33333 11.11111 oooi·^蜊 鳔 68 inch 68r6s reward. 01 : 6 卜寸 LnIeooocol its ^_0 write 埏 „01 : _^ω

LZ 蜣龙螽驷 siti:r^3^«s?^«^efe Lily to silence (q^-gI) 韶 sound vf: M^ ICso FALSE cumulative inhibition rate 0. 068746724 <=5 CD 〇CD I Go FALSE Accumulated inhibition rate 0.185857736 0.010110817 〇Ο Ο )- Accumulate 0. 931253 1.931253 2. 931253 3.931253 4. 931253 M: Λ 0. 8292 1.810705 2.810705 3. 810705 4.810705 !Dilution factor 3 Μ: 0.068747 CD 〇CD CD Dilution multiple 3 0 189295 0.0184947 〇Ο Ο I average inhibition rate 0. 068747 CD <〇CD average inhibition rate 0. 1708 0.018495 CD Ο CD blank 0 third inhibition rate 0.176529 Ο CD cr> C3 third inhibition rate 0.521054 0.364272 C5 C=5 CT5 second inhibition rate 0.029711 C=> o C3 second inhibition rate 0.247106 0.050156 Ο) first inhibition rate CD CD cr>C=> first inhibition rate 0.152489 Ο Ο 〇> C=5 cell control 17544 tv ' Ί 9950 15182 16400 16168 12083 Cell control 10886 'Ί 9658 10828 13934 12000 10886 Ί 11724 16890 21716 15042 12083 tv 躲 Avoid 8196 10340 12980 12342 10886 14918 14868 16760 20854 12083 1 9226 10946 12250 12634 10886 e antigen concentration (10,000 IU / ml) CO CD 〇> ί—H 33.33333 11.11111 3.703704 Surface antigen concentration (10,000 IU/ml) 〇〇CO ◦ ^ 1 4 33. 33333 11.11111 3. 703704 1328011 ICso FALSE Accumulated inhibition rate 0.254710274 0.102024519 0.029916678 0. 007306592 0.005801377 ICs〇FALSE Accumulate Inhibition rate 0.024647111 0.010422073 0.003606955 0. 002704416 0.002167838 Bu Accu 0. 895825 1. 777764 2. 721232 3. 721232 4. 693843 1-Accumulate 0.99575 1.985646 2. 985646 3. 985646 4. 974837 Dilution multiple 3 0.306157 0. 2019827 0. 083921 0. 0273897 0. 02739 Dilution factor 3 U: 0.025163 0.0209125 0.010808 0.0108081 0.010808 Average inhibition rate 0.104175 1 0.118062 0.056531 C=> 0.02739 Average inhibition rate 0. 00425 0.010104 Ο CD 0.010808 Blank 0 Third inhibition rate CD <〇0. 090245 0. 082169 Blank 0 Third inhibition rate CD 〇>〇>〇> 0. 028287 Second inhibition rate 0.220869 0.212409 «〇<〇CD Second inhibition rate 0.01275 0.030313 ci> CD CD First inhibition rate 0.091655 0.1417767 0. 079349 o First inhibition rate Ο» Ο ο Ο 0.004137 Cell control 15602 »1城·17306 16252 14194 16340 14320 Cell Control 11843 tv Hi 贱12234 12350 15086 13020 11508 Ί城·12156 12288 18834 16034 17652 tv 11 sister 11692 11484 14696 12928 11984 tv 1 Hide 14172 13390 14364 15722 17504 1 12080 12840 12894 15032 11794 e antigen concentration (10,000 IU/ml) <Z>〇> CT» <〇〇> CO 〇〇33. 33333 11.11111 Surface antigen concentration (10,000 IU/ml) CD 〇> 03 Ο CD CO Ο CD 33.33333 11.11111

6CN 1328011 ICso FALSE Accumulated inhibition rate 0. 253290505 0. 046161005 0.005794856 C=> ICso false Accumulated inhibition rate 0.12751773 0.0490186 0.02144964 0.013796309 <〇上0.809633 1.74125 2.725365 3.725365 4.725365 Λ 0.958996 1.923709 2.913834 3. 859838 4. 859838 Dilution multiple 3 0 274635 0. 0842678 0.015885 CD cr> 1 Dilution factor 3 m 0.140162 0.0991581 0.063871 0.0539965 CZ> Average inhibition rate 0. 190367 0. 068383 0.015885 <〇: average inhibition rate 0.041004 '0. 035287 !〇. 009874 !〇. 053996 Blank 0 Third inhibition rate 0.183486 0.18527 «〇CD blank 0 Third inhibition rate 0.043187 Ο Ο 0.029935 CT5 Second inhibition rate 0.187564 〇0.047655 CD CD Second inhibition rate 0.043655 0.009355 ◦ 0.115529 CD First inhibition rate 0.200051 0.0198777 〇oo First Inhibition rate 0.036171 0.0965076 0. 029623 0.016526 CD Cell control 7848 tv 'Ί 觖6408 6394 8190 9682 7848 Cell control 11843 Nr 'Ί城·12274 13716 13982 12444 12828 ίν Ί Hide 6376 9092 7474 8144 7848 tv Ί Hide 12268 1 12708 13468 11346 1282 8 tv t城·6278 , 7692 8960 8530 ί848_ 1 stall 12364 11590 12448 12616 12828 e antigen concentration (10,000 IU/ml) CI5 〇><〇〇> CO CD CD 33.33333 11.11111 Surface antigen concentration (10,000 IU/ml )〇cr>〇> CO <=> Ο 33.33333 11.11111 1328011 螽驷莫Μ城 ICso FALSE cumulative suppression rate 1............. 0.201211735 1___ - ._ 0. 042176564 0.015663017 0.001341671 <=> ICso FALSE Accumulated inhibition rate 0.0191516796 Ο <3> CD 〇> 1 1-Accumulate 0.863049 1. 82696 2. 787683 3.782601 4.782601 1 _Accumulate 0.984083 1.984083 2. 984083 3.984083 4.984083 Dilution multiple 3 0.217399 0. 0804479 0. 044358 0.0050818 CD dilution factor 3 0.015917 Ο C3 average inhibition rate 0.136951 0. 03609 0. 039276 0.005082 〇 average inhibition rate 0.015917 〇>〇> CD G? CD third inhibition rate 0. 204393 0.108269 °·024289 cr&gt ; 〇 > blank 0 third inhibition rate 〇 >=> ο CD CD second inhibition rate 0.14186 CD CD o CD second inhibition rate 〇cz> ο Ο CD first inhibition rate 0. 064599 〇> 0. 09354 0.015245 〇First inhibition rate 0.04775 G5 〇> ο C=> Cell control 7740 Third hole 6158 6902 7552 8676 7740 Cell control 11602 'Ί 軚11902 11798 12546 12360 11602 Second hole 6642 8786 9726 18866 7740 ίν Ί Hide 11856 12896 13160 12458 11602 1 轶7240 11072 7016 7622 7740 1 11048 13454 12846 12680 11602 e antigen concentration (10,000 IU/ml) CD C=> 7 CD <0 CO CD CD 1 < 33.33333 11.11111 Surface antigen concentration (万Π1/ Ηι1) (=> CD CD Ο CD CD 33.33333 11.11111 甽铢筚0^φίοΰΙ 甽 鲽ο 埏踅οΰΙ Ίω ιε 1328011 rSIFN-co Preparation of lyophilized injection Preparation of recombinant high-efficiency complex interferon stock solution pH 7. 0 phosphate Buffer glycine

34.5 Pg/ml 10 mraol/L 〇.4 mol/L

Preparation process: according to the prescription, 〇. 4 fliol / L filter with 0.22μιπ pore size membrane sterilization sterilized by water injection, sterilized pyrogen after inspection, sub-packaged vials, at 6::G $, sampling for sterility The mixture was placed in a lyophilizer and lyophilized. Early "in 0. 3 / bottle, or 〇. 5 / bottle. Preparation of aqueous injection injection recombinant high-efficiency composite interferon stock solution pH 7. 0 phosphate buffer sodium chloride preparation process: according to the prescription of bacteria filtration 0 . 22μπι aperture diaphragm 除 · · go to 7 勒, shield 仏 I am talking about eight Hi w ^ ___

34.5 Mg/ml 25 mmol/L

1. 1 mol/L bacteria filtration using 0.22μπι pore size membrane in addition to 'bacteria used in the original; ^ water dissolved, in addition to the pyrogen inspection after the separation in the closed volume mutnc 'sampling for aseptic packaging after the finished product set 2-UTC In the dark, medium early dose 1 〇. 3 / bottle, or 〇 · 5 / bottle, case six rSIFN-co acute toxicity test (phase = 3⁄43⁄43⁄4 complex (four), * acute toxicity and death. Gentleman quits ') Observed, no abnormalities in the animals within 2 weeks after the drug administration, after the death ^ transfer administration, 24 small organs did not see _ visible money. Yu shouted: each of the main ^ one death, in the first reaction, increased, and two _ weight increase value of the small mouse 32 1328011 autopsy of the main organs without visible lesions. 1. Experimental materials 1 · 1 test animal 'quality certificate: 40 adult KM mice in Sichuan, weighing 18~22g, male and female, SPF-level certificate: Chuan Shidong tube quality No. 6, qualified in 1998, use The implementation of the qualified operating pipe No. 5, qualified, medical ethics No. 24A00003, qualified. 1.2 Test Drugs Gaofufu Interferon was provided by Sichuan Bioengineering Research Center, sterile 〇. 15mg/ml, batch number: 981201 was prepared by using physiological saline for injection. 2. Test method

The rats were randomly divided into two groups according to their body weight and sex. They were normal saline 11 and 夂 two-effect interferon group (2 mice per group, ^ J 0丨. 'After one dose' The acute toxicity of mice was 2 荦i 2 and the negative control group mice weight value evolution value & test results human agent I interferon, equivalent to 〇 · (6), the results see. Differences (P> 33 1328011 ΐ 高 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ Efficient compound interferon group dose (UR/ks.) 0 150 ~ . —......... - V ^ -a V 8) The weight of the animal jade before the administration of SSS1~~^ is increased ^- IsL·^ (g) 20 20 19.8±1.7 19.4±1.7 30. 8±2. 8 ,32.1±3.3 11.0±2.9 12. 7+4.3 4. Conclusion Under the conditions of this experiment, 'one intramuscular injection of high-efficiency composite interferon 15 〇//g/kg small

See toxicity. Therefore, the maximum amount of highly effective interferon-injected mice is greater than 150 "g/kg, which is equivalent to 1000 times the human dose. The clinical effect of the recombinant high-efficiency complex interferon (rSIFN-co) of the present invention is mainly used for the treatment of viral diseases, follicular stomatitis. Virus, herpes simplex virus, measles virus, coronavirus, Epstein-Barr virus, etc. all have inhibitory effects. The antiviral activity was tested by the wish cell/VSV system, and the results were as follows: the domestic natural interferon was 〇. 9xl〇'8u/m INTR0N was 2. 0x10 U/mg, rSIFN-co was 9xl08U/mg, and its antiviral The activity is significantly higher than the former two. Since February 2003, it has been approved by the State Food and Drug Administration of China, and has done a multi-center, double-blind, randomized treatment of hepatitis B at the West China Hospital of Sichuan University, the Second Affiliated Hospital of Chongqing Medical University, and the First Affiliated Hospital of the University Medical College. The bed test's comparison with IFN-alb sinogold showed the following results: Comparison of the efficacy of recombinant high-efficiency complex interferon (rSIFN-co) and other interferon drugs (Sinogold) in the treatment of chronic active hepatitis B f: selected Standard: rSIFN-co (9pg) was the same as the selection criteria for sinogold. The 1-4 conditions were used, and the inclusion criteria of rSIFN-co (15 gg) were used, which met the 丨_5 condition. σ 1. Age 18~65 years old; 2. HBsAg persists 1% for at least 6 months 'jjBeAg positive, less than one PCR test HBV-DNA2105 copy number/mi during screening period; 3. ALT^2 times normal value Upper limit (ULN), 4. Has not been treated with interferon anti-HBV; if it has been treated with levaxidine before March, but no sputum 34 1328011 5. 士^ used some interferon 6 months ago (诵Or pass the treatment and dose anti-HBV treatment, but benefit or relapse. According to (10) conversion, the curative effect is divided into three levels, complete (3) ί ·: ϊ; ΐί, ί^ ΝΑ 转, HBeAg serological transformation ί5 knife should σ. ALT book, HBV-DNA negative or HBeAg Jk clear school sputum no response: ALT is not normal, HBV-DNA is not negative, HBeAg is not negative, clinical treatment effect comparison rSIFN-co and IFN-alb (sinogold) treatment of chronic active hepatitis B Table, treatment time grouping drug total number of cases, efficiency, % HBs antigen conversion rate % HBe antigen conversion rate % HBV-DNA conversion rate % liver function recovery rate (%) 8-12 weeks A rSIFN-co (9μβ) 32 46.88 (15) 9. 38 (3) 28. 12 (9) 37.50 (12) 84.38 (27) B IFN-α lb (5MU, 50μβ) 32 21.88 (7) 0.00 (0) 9. 38 (3) 15. 62 (5) 56.25 (18) 16-24 weeks A rSIFN-co (9μκ) 64 54. 69 (35) 7.81 (5) 25. 00 (16) 34. 38 (22) 90.62 (58) B IFN -α lb (5MU, 50ug) 64 25.00 (16) 0.00 (0) 9.38 (6) 18.75 (12) 78.13 (50) _ concurrent with this trial with clinically proven chronic active hepatitis B treated with rSIFN-co Use some interferon (3MU or 5MU) for the treatment and dosage according to SDA HBV treatment 'or invalid but 13 patients relapsed, each i5 # g subcutaneous injection, once every 48 hours, 24 weeks. As of the 12th week after treatment, 7 of the 13 patients (53.85%) were clinically effective, with HBs antigen negative (0%) and 3 HBe antigen negative (23.08%), 3 For example, HBe antibody was positive (23.08%), 7 cases of HBV-DNA were negative (53.85%), and 11 cases of liver function returned to normal (84.62%). Third, rSIFN-co and IFN-alb (sinogold) side effects compared interferon drugs have more side effects, including fever, nausea, muscle aches, loss of appetite, hair loss, white blood cells and thrombocytopenia, IFN-α lb The maximum clinical dose is 5 MIU each time, and 3 MIU is used every time. When using the conventional dose, about 90% of the patients show side-effects of the l-Π (WHO clinical grading standard), including below 38 °C. Mild fever, nausea, muscle aches, loss of appetite, etc. When using the most 35 1328011, the incidence of trafficking should be increased, but the degree of clinical symptoms is clear. The most outrageous amount is 2_ per ton, and the conventional use of μ helmet is less than 50% of the patients. It showed side effects of grade 11 (and 〇, Ϊ and Ϊ), including slight hair loss below 38 ° C, ° nausea, mild reduction of myocardium, etc. "The maximum dose of leukocytes and platelets returned to normal after a week of rest, safely follow the drug = a combination of dry aid (rSIFN_C〇) in the treatment of hepatitis C. 1 · Age 18 ~ 65 years old; 2. HCV antibody continues to be positive 3. ALT^l. 5 times the upper limit of normal value (then), and the criteria for judging hepatitis C for more than 6 months, according to the follow-up, - whether the blood smelting ALT level returns to normal, HCV_RNA The transition was divided into three levels, and the complete response and partial responders were judged to be effective cases: κ, complete response: ALT recurrence, HCV-RNA negative partial response, ALT recurrence, HCV-RNA non-negative no response: ALT Unrequited, HCV-RM is not negative, clinical treatment effect and treatment of hepatitis B test simultaneously with rSIFN-c〇 treatment of 46 cases of C, each time 9 / g g intramuscular injection, every 48 hours, continuous Netizen:;: Sense 26 patients have clinical effect (56. 52%), of which 12 cases of HCV-HAt (26.08%), 26 cases of liver function returned to normal (56.52%). 褥马^生 [Simple diagram Description] Ammonia phase and large intestine (four) cryptic preference design Figure 2. Another recombinant high-efficiency composite interferon sequence Figure 3. Plasmid map of pLac T7 cloning vector. Figure 4. Plasmid map of pHY-4 expression vector. Figure 5. Construction plot of expression plasmid pHY-5. Figure 6. Chromatogram range of dry complex circle. Wavelength range · 250nm - 190nm Sensitivity: 2 m °/cm 36 1^28011

Optical path: 0. 20 on Instrument: Circular dichroism j-5〇〇C Contains 30 #g/ml IFN-conl, 5, 9 mg/ml Naa 3. 8 mg/ml Na2p()4, : \interferonalfacon-u, produced by American Amgen, also known as er〇n), as a treatment for adult chronic hepatitis C (HCV) ϊϋΐίί.丨 It is currently TM-approved – an interferon based on a reasonable drug. Moreover, there is clear information on the patients who can be used for dry heat “or recurrence. Intermune re-introduced in January 2002.” At the same time, an educational activity for American hepatologists was introduced, and the introduction of dry ί ί 确 确 确 确How to use it. This represents a new hope for patients who are currently ineffective in treating 50% of HCV patients. See http://www.intermune.xom/wt/itmn/infergen. August 27, 2003 Cowen. The chromatogram of the dry-recovery circle is “J_al Qf Interferon and Cytokine Research. 16:489-499 (1996)" 5. 9 mg/ml NaCl, 3. 8 mg/ml Na2P〇4, Figure 6-C. rSIFN-co Circular Dichroic Wavelength Range .320nm - 250nm Sensitivity: 2 m°/cm Optical Path: 2 cm Instrument: Circular Dichroic Chromatograph J-500C Sample: Contains 〇. 5 mg/ml IFN-conl pH 7.0 5· 9 mg/ml NaCl, 3. 8 mg/ml Na2P〇4, Figure 6-D. rSIFN-co circular dichroism wavelength range. 250nm - 19〇ηπι Sensitivity: 2 m°/cm Optical path: 0. 20 Cm instrument: round dichroline J-500C sample: containing 30 //g/ml IFN-conl pH 7.0 or the spectrum can be clearly seen that 'rSIFN-C0 and dry Fujin have different secondary 37 1328011 Supplementary Sequence Listing< 110>Sichuan Biotech Research Center (SICHUAN BI0TECHM0L0GY RESERACH CENTER) <120>Recombinant Highly Efficient Interferon (RECOMBINANT SUPER-COMPOUND INTERFERON) <130><140> 2003-08-29 <141> 092123846 <;1δ0><151〉

&lt;160&gt; 15 &lt;210> 1 &lt;211&gt; 167 &lt;212> PRT &lt; 213 &gt; 213 &gt; Artificial Sequence <220> &lt;223&gt; sequence for a recombinant human interferon &lt;400&gt;

Met Cys Asp Leu Pro Gin Thr His Ser Leu Gly Asn Arg Arg Ala 5 10 15

Leu He Leu Leu Ala Gin Met Arg Arg lie Ser Pro Phe Ser Cys 20 25 30

Leu Lys Asp Arg His Asp Phe Gly Phe Pro Gin Glu Glu Phe Asp 35 40 45

Gly Asn Gin Phe Gin Lys Ala Gin Ala lie Ser Val Leu His Glu 50 55 60

Met lie Gin Gin Thr Phe Asn Leu Phe Ser Thr Lys Asp Ser Ser 65 70 75

Ala Ala Trp Asp Glu Ser Leu Leu Glu Lys Phe Tyr Thr Glu Leu 80 85 90

Tyr Gin Gin Leu Asn Asp Leu Glu Ala Cys Val lie Gin Glu Val 1328011 95 100 105

Gly Val Glu Glu Thr Pro Leu Met Asn Val Asp Ser lie Leu Ala 110 115 120

Val Lys Lys Tyr Phe Gin Arg lie Thr Leu Tyr Leu Thr Glu Lys 125 130 135

Lys Tyr Ser Pro Cys Ala Trp Glu Val Val Arg Ala Glu lie Met 140 145 150

Arg Ser Phe Ser Leu Ser Thr Asn Leu Gin Glu Arg Leu Arg Arg 155 160 165

Lys Glu 167 &gt;&gt;&gt;&gt; 0 12 3 - -&lt; - Η lx -* 2 2 2 2 &lt;&lt;&lt;&lt;

4 A t ο N Γ 2 5 D A e c n e Qu e s --A a .1 &lt;220&gt;

&Lt; 221 &gt; CDS &lt; 223 &gt; coding for a recombinant human interferon <400> 2 atgtgcgacc tgccgcagac ccactccctg ggtaaccgtc gtgctctgat cctgctggct 60 cagatgcgtc gtatctcccc gttctcctgc ctgaaagacc gtcacgactt 120 caggaagaat tcgacggtaa ccagttccag aaagctcagg ctatctccgt tctgcacgaa 180 atgatccagc agaccttcaa cctgttctcc accaaagact cctccgctgc ttgggacgaa 240 tccctgctgg aaaaattcta caccgaactg cggtttcccg taccagcagc tgaacgacct ggaagcttgc 300 gttatccagg aagttggtgt tgaagaaacc ccgctgatga acgttgactc catcctggct 360 gttaaaaaat acttccagcg tatcaccctg tacctgaccg aaaaaaaata ctccccgtgc 420 gcttgggaag ttgttcgtgc tgaaatcatg cgttccttct ccctgtccac caacctgcag 480 gaacgtctgc gtcgtaaaga ataa, 504

&lt;210> 3 &lt;211> 504 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence 1328011 &lt;220〉

&Lt; 221> CDS &lt; 223 &gt; coding for a recombinant human interferon <400> 3 tacacgctgg acggcgtctg ggtgagggac ccattggcag cacgagacta ggacgaccga 60 gtctacgcag catagagggg caagaggacg gactttctgg cagtgctgaa gccaaagggc 120 gtccttctta agctgccatt ggtcaaggtc tttcgagtcc gatagaggca agacgtgctt 180 tactaggtcg tctggaagtt ggacaagagg tggtttctga ggaggcgacg aaccctgctt 240 agggacgacc tttttaagat gtggcttgac Atggtcgtcg acttgctgga ccttcgaacg 300 caataggtcc ttcaaccaca acttctttgg ggcgactact tgcaactgag gtaggaccga 360 caatttttta tgaaggtcgc atagtgggac atggactggc ttttttttat gaggggcacg 420 cgaacccttc aacaagcacg actttagtac gcaaggaaga gggacaggtg gttggacgtc 480 cttgcagacg cagcatttct tatt 504

&lt;210&gt; 4 <211> 120 &lt;212&gt; PRT &lt;213&gt; Artificial Sequence &lt;220&gt;&lt;223&gt; sequence for a recombinant human interferon &lt;400&gt;

Met Cys Asp Leu Pro Gin Thr His Ser Leu Gly Asn Arg Arg Ala 5 10 15

Leu lie Leu Leu Ala Gin Met Arg Arg lie Ser Pro Phe Ser Cys &quot;20 25 30

Leu Lys Asp Arg His Asp Phe Gly Phe Pro Gin Glu Glu Phe Asp 35 40 45

Gly Asn Gin Phe Gin Lys Ala Gin Ala lie Ser Val Leu His Glu 50 55 60

Met lie Gin Gin Thr Phe Asn Leu Phe Ser Thr Lys Asp Ser Ser 65 70 75

Ala Ala Trp Asp Glu Ser Leu Leu Glu Lys Phe Tyr Thr Glu Leu 80 85 90

Tyr Gin Gin Leu Asn Asp Leu Glu Ala Cys Val lie Gin Glu Val 1328011 95 100 105

Gly Val Glu Clu Thr Pro Leu Met Asn Val Asp Ser lie Leu Ala 110 115 120 &gt;&gt;&gt;&gt; 0 12 3 1L lx -* 222 2 &lt;&lt;&lt;&lt; 3 360

DNA

Artificial Sequence &lt;220&gt;

&Lt; 221> CDS &lt; 223 &gt; coding for a recombinant human interferon &lt; 400 &gt; 5 atgtgtgatt tacctcaaac tcattctctt ggtaaccgtc gcgctctgat tctgctggca 60 cagatgcgtc gtatttcccc gtttagctgc ctgaaagacc gtcacgactt cggctttccg 120 caagaagagt tcgatggcaa ccaattccag aaagctcagg caatctctgt actgcacgaa 180 atgatccaac agaccttcaa cctgttttcc actaaagaca gctctgctgc ttgggacgaa 240 agcttgctgg agaagttcta Cactgaactg tatcagcagc tgaacgacct ggaagcatgc 300 gtaatccagg aagttggtgt agaagagact ccgctgatga acgtcgactc tattctggca 360

&lt;210> 6 &lt;211&gt; 360 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;

&Lt; 221> CDS &lt; 223 &gt; coding for a recombinant human interferon &lt; 400 &gt; 6 tacacactaa atggagtttg agtaagagaa ccattggcag cgcgagacta agacgaccgt 60 gtctacgcag cataaagggg caaatcgacg gactttctgg cagtgctgaa gccgaaaggc 120 gttcttctca agctaccgtt ggttaaggtc tttcgagtcc gttagagaca tgacgtgctt 180 tactaggttg tctggaagtt ggacaaaagg tgatttctgt cgagacgacg aaccctgctt 240 tcgaacgacc tcttcaagat Gtgacttgac atagtcgtcg acttgctgga ccttcgtacg 300 cattaggtcc ttcaaccaca tcttctctga ggcgactact tgcagctgag ataagaccgt 360

&lt;210> 7 &lt;211&gt; 108 &lt;212&gt; DNA 4 1328011 &lt;213&gt; Artificial Sequence &lt;220〉 &lt;223&gt; Synthetic primer &lt;400〉 7

Atgtgcgacc tgccgcagac ccactccctg ggtaaccgtc gtgctctgat cctgctggct 60 cagatgcgtc gtatctcccc gttctcctgc ctgaaagacc gtcacgac 108 &lt;210> 8 &lt;211&gt; 107 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;&lt;223&gt; Synthetic primer &lt;400&gt; 8 ctgaaagacc Gtcacgactt cggtttcccg caggagaggt tcgacggtaa ccagttccag 60 aagctcaggc tatctccgtt ctgcacgaaa tgatccagca gaccttc 107 &gt;&gt;&gt;&gt; 0 12 3 ti r --&lt; Ί — 1 1A 22 2 2 &lt;&lt;&lt;&lt; 103

DNA

Artificial Sequence &lt;220&gt;&lt;223> Synthetic primer &lt;400> 9 gctgctggta cagttcggtg tagaattttt ccagcaggga ttcgtcccaa gcagcggagg 60

Agtctttggt ggagaacagg ttgaaggtct gctggatcat ttc 103 &lt;210> 10 &lt;211> 103 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence <220> &lt;223&gt; Synthetic primer &lt;400&gt; 10 1328011 atccctgctg gaaaaattct acaccgaact gtaccagcag ctgaacgacc tggaagcttg 60 cgttatccag Gaagttggtg ttgaagaaac cccgctgatg aac 103

&lt;210&gt; 11 <211> 106 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence <220> &lt;223&gt; Synthetic primer &lt;400&gt; 11 gaagaaaccc cgctgatgaa cgttgactcc atcctggctg ttaaaaaata cttccagcgt 60 106 &lt;210&gt; 12 &lt;211&gt 112 &lt;212> DNA &lt;213&gt; Artificial Sequence &lt;220> &lt;223&gt; Synthetic primer &lt;400&gt; 12 atcaccctgt acctgaccga aaaaaaatac tccccgtgcg cttggg ttattcttta cgacgcagac gttcctgcag gttggtggac agggagaagg aacgcatgat 60 ttcagcacga acaacttccc aagcgcacgg ggagtatttt ttttcggtca gg 112

&lt;2i0&gt; 13 &lt;211&gt; 31 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;&lt;223&gt; Synthetic primer &lt;400&gt; 13 atcggccata tgtgcgacct gccgcagacc c 31 6 1328011

&lt;210&gt; 14 &lt;211> 40 &lt;212&gt; DNA &lt;213&gt; Artificial Sequence &lt;220&gt;&lt;223&gt; Synthetic primer &lt;400&gt; 14 actgccaggc tgcagttatt ctttacgacg cagacgttcc 40 &gt;&gt;&gt;&gt; 0 12 3 lx 11 li Ί I 2 2 2 2 &lt;&lt;&lt; /\ 15 15

PRT

Homo sapiens &lt;400&gt; lb

Cys Asp Leu Pro Gin Thr His Ser Leu Gly Asn Arg Arg Ala Leu 15 10 15

Claims (1)

'曰修(更)本本's patent application scope: Interferon, in which high-efficiency complex interferon has enhanced per-sequence code to reduce side effects and low biotoxicity, and is a recombinant high-efficiency complex interferon as described in the nuclear '2_ item, which has Changed to three: the two gas group high, dry, prime, characterized by its gene is based on the large intestine 'its is and artificial synthesis. ^ and = dry heart horse preference to adjust the wild-type sequence. 5. Recombinant high-efficiency complex interferon, characterized by the recombinant high-efficiency complex interferon described in item 6, wherein said 绐, 广 在 在; Cell melanoma virus, herpes simplex virus, other RNf:: butyl venom, poxvirus, picornavirus, adenovirus, #^ in Π 7. Recombinant high-efficiency complex interferon according to item 1, characterized It is the DNA replication of 8 inflammatory viruses and the secretion of e antigens and s antigens. An artificial cause of the recombinant Newcomposite interferon as described in claim 1 of the patent patent scope. 9. An artificial base carrier as described in claim 8 of the patent application.巧♦ A performance system for the carrier described in clause 9 of the patent. 11. A host cell having the vector of claim 9 of the invention. 12. A method for producing a recombinant high-efficiency complex interferon, such as a patent, which comprises: introducing a human king gene synthesized by the selected genomic code into a host, and cultivating the injured host cell in an appropriate culture condition The recombinant interfering complex interferon is cultured and expressed as a composite interferon' harvest performance. 1328011 The slaves mentioned in item 2, the towel includes extracting the internal effect interferon from the fermentation broth, purifying the inclusion body, and the square according to item 12 of the patent scope of the patent === use special characteristics/chen Degree of 5 agents, and maintain high activity of high-efficiency complex interferon. 15. The method of claim 13, wherein the separation and purification of the highly efficient complex interferon is included. 16. The method of claim 13, wherein the method comprises lyophilizing the purified high-efficiency complex interferon. 17. The method described in item 13 of the H-Current Patent Range includes a liquid preparation for the production of highly effective complex interferon. 18·ιΐ$ The pharmaceutical composition of the recombinant high-efficiency complex interferon and the appropriate carrier described in claim 1 of the patent application.