CN1740197B - Recombination interferon with new space conformation and enhanced effect, its preparing method and application - Google Patents

Abstract

The invention provides recombination interferon (rSIFN-co) or the functional analog with new space conformation, enhanced effect, and low side effect. It is showed by the external pharmacodynamics, it can not only restrain the DNA replication of the hepatitis b virus, but also restrain the exudation of the surface antigen (HBsAg) and e antigen (HBeAg). The cytology toxicity is 1/8 of the clinical interferon and the antiviral activity is 5-20 times to the clinical interferon and has a higher, a more board spectrum and longer time biological response reaction, and prevent the tumor hyperplasia and transmission. The invention also provides the synthetic gene code, gene carrier, expression system of the synthetic gene of the recombination interferon or the functional analog. Finally, the invention also provides the preparing method and application thereof.

Description

Have the enhanced recombinant interferon of brand-new space conformation and effect, its preparation method and application

Technical field

The present invention relates to bioengineering field.Particularly, the present invention relates to a kind ofly have that brand-new space conformation and effect strengthen, side effect is lower can heavy dose of recombinant interferon or its function equivalent that uses, and the compositions and the Pharmaceutical composition that contain described interferon or its function equivalent.The invention still further relates to the production method of described recombinant interferon or its function equivalent, the application in the medicine of preparation prevention and treatment viral disease and treatment tumor.

Background technology

Interferon is the soluble glycoprotein of antiviral, antitumor and immunoregulation effect widely that has by the various kinds of cell generation.Do not contain interferon in normal condition undertissue or the serum, only can lure just under the effect of some specific factor that cell produces interferon into.Composite factors such as generation cell, receptor and activity according to interferon are divided into 2 types with it: I type and II type.

The main inducer of I type interferon is the double-stranded RNA of virus and synthetic.I type interferon is called antiviral interferon again, and its biological activity has 3 kinds of forms based on antiviral: IFN α, IFN β, IFN ω.II type interferon is called immune interferon or IFN γ again, is mainly produced by the T cell, and its biological activity is to participate in immunomodulating, is important immunoregulatory factor in the body.

The biological activity of interferon has strict species specificity, and the antivirus action of I type interferon is stronger, multiple virus such as DNA viruses, RNA viruses are all had inhibitory action, but this effect is not directly, but cause by the effect to host cell.

In recent years, many companies in the world all are being devoted to the research of interferon, and many reports of this respect are also arranged.For example, United States Patent (USP) 4,695,623 and 4,897,471 disclose the Novel Human interferon polypeptides, and the aminoacid sequence of described interferon contains the common or dominant aminoacid of finding on each site of alpha-interferon isoform polypeptide of natural generation, and therefore described interferon is referred to as total interferon (IFN-con).Disclosed amino acid sequence called after IFN-con1, IFN-con2, and IFN-con3.The preparation and the expression of described gene in escherichia coli of the cydorge gene of coding IFN-con are also disclosed.Reorganization IFN-con with or the in vitro study relatively of LeIF or other reorganization I type interferon confirm that IFN-con shows significantly high antiviral, antiproliferative and natural killer cell activity.

United States Patent (USP) 5,372,808 disclose the method for using joint owner's interferon therapy disease.With the alpha-interferon of previous approved listing as

(IFN-α 2b, the refined company in Lingbao City of U.S. elder generation product) compared, and described joint owner's interferon produces lower side effect.U.S. food and Drug Administration (FDA) will have ratified the treatment that total interferon that U.S. Amgen (Amgen) produces is used for clinical hepatitis C patient the end of the year 1997, and its commodity are called Infergen (interferonalfacon-1).

Diagnosis to the hepatitis B patient, can be judged to be hepatitis B patient when detecting surface antigen (HBsAg) positive and the positive person of e antigen (HBeAg). adopted various types of human alpha type interferon that chronic hepatitis B patient is treated at present clinically, its mechanism of action is: interferon combines with the specific receptor of cell and brings into play its antiviral DNA and RNA anabolic effect, comprise some enzyme induction is stoped viral duplicating in the cell that is infected by the virus. but the external pharmacodynamics demonstration of all interferon all can only suppress viral DNA and RNA, can not directly suppress the secretion of HBsAg and HBeAg. and can not heavy dose of use because side effect is big.

Summary of the invention

One object of the present invention is to provide a kind of and has brand-new space conformation and effect strengthens, side effect is lower can heavy dose of recombinant interferon (hereinafter as the rSIFN-co of abbreviating) or its function equivalent that uses.

Another purpose of the present invention is to provide h coding's gene of this kind recombinant interferon or its function equivalent.

The carrier that provides one to contain the gene of recombinant interferon of the present invention or its function equivalent is provided still a further object of the present invention.

Still a further object of the present invention is to provide the expression system of the carrier of a gene that contains recombinant interferon of the present invention or its function equivalent.Described expression system for example can be an appropriate host cell.This host cell can be an eukaryotic cell, also can be prokaryotic cell, for example E.Coli.

Still a further object of the present invention is to provide the production method of recombinant interferon of the present invention, comprising being inserted in the suitable expression vector by the artificial gene sequence of codon-bias design, and be incorporated into suitable hosts, the step of culture expression and separation and purification recombinant interferon of the present invention under suitable condition.The present invention also comprises provides the recombinant interferon of producing by this method.

Still a further object of the present invention is to provide a kind of pharmaceutical composition that contains recombinant interferon of the present invention or its function equivalent and suitable pharmaceutical carrier.

Still a further object of the present invention is to provide recombinant interferon of the present invention or the application of its function equivalent in the medicine of preparation prevention and treatment viral disease and treatment tumor.

Another object of the present invention is to provide the method for a kind of prevention and treatment viral disease and treatment tumor.

A further object of the present invention is to provide the interferon of a kind of efficient or low side effect, and it is to obtain by the space conformation that changes this interferon.

For achieving the above object, the present invention specifically comprises following several aspect:

In a first aspect of the present invention, a kind of recombinant interferon or its function equivalent are provided, wherein said interferon has the aminoacid sequence shown in the sequence 2 in the sequence table, and it has the space conformation different with Infergen, and described Infergen has the aminoacid sequence shown in the sequence 2 in the sequence table equally.

The term of Shi Yonging " function equivalent " is meant a kind of based on the aminoacid shown in the sequence in the sequence table 2 in this article, according to the coded protein or the peptide of DNA of the optimizing codon of given expression system redesign, and on function the molecule similar to recombinant interferon of the present invention.Described given expression system includes but not limited to E.Coli expression system, yeast expression system, CHO expression system.It can be a kind of deletant, substitute or the derivant that is formed by former series jump.In addition, the present invention also attempts to contain the model molecule of recombinant interferon of the present invention.Model molecule can be a kind of peptide, polypeptide or micromolecular compound.

Recombinant interferon of the present invention (rSIFN-co) makes by gene recombination technology, and the dna encoding sequence of its aminoacid sequence according to escherichia coli (E.Coli) codon-bias wild-type sequence is adjusted and synthetic cDNA gets.

This recombinant interferon is considered to have unique space three-dimensional structure.In a specific embodiment, the circular dichroism spectra of recombinant interferon of the present invention in the 190-250nm scope significantly is different from the circular dichroism spectra of the Infergen that records under similarity condition.Circular dichroism spectra in the 250-320nm scope is also significantly different with the circular dichroism spectra of the Infergen that document is reported.See also accompanying drawing 6.

In addition, recombinant interferon of the present invention is in intramuscular injection after to give the body weight index be human body in the 20-27 scope, to the 2-5A oligonucleotide enzyme concentration in experimenter's body serum mapping, the peak area under the gained curve is significantly penetrated the peak area under the curve that Infergen obtains greater than making a bet in identical conditions with blood sampling time.Described curve generally shows as bimodal, though this bimodal form, highly, the peak separation between bimodal may be because of people's difference difference to some extent.Sometimes, the described peak separation and the difference in height at two peaks between bimodal is not remarkable especially, even its form approaches trapezoidal peak, but, in intramuscular injection after to give the body weight index be human body in the 20-27 scope, to the 2-5A oligonucleotide enzyme concentration in experimenter's body serum mapping, the peak area under the gained curve is significantly penetrated the peak area under the curve that Infergen obtains greater than making a bet in identical conditions with blood sampling time.In addition, it is longer in the intravital half-life of people than Infergen in the intravital half-life of people after human body is given in injection for interferon of the present invention.

The result of experiment of carrying out also confirms, and recombinant interferon of the present invention has the stronger effectiveness of other any interferon (comprising Infergen) than the clinical use of present input.Described effectiveness comprises at virus, also comprises at tumor.

Expect that recombinant interferon of the present invention is all effective to the virus of majority.Described virus comprises, but be not limited to hepatitis B virus, hepatitis C virus, wild type HIV or its persister, smallpox virus, SARS virus, Ebola virus, Epstein-Barr virus, cell melanin virus, herpes simplex virus, varicella zoster virus, other herpesvirus, cytomegalovirus, human papillomavirus, poxvirus, picorna virus, rhinovirus, adenovirus, RNA viruses, I type human T-cell leukemia virus, II type human T-cell leukemia virus or III type human T-cell leukemia virus, west nile virus, yellow fever virus, rotavirus, the variant of bird flu virus and infected person thereof, influenza virus, parainfluenza virus, Measles virus, human syncytial virus-1, human syncytial virus-2, peste loca virus, dengue fever, yellow fever, cloth tower Toro virus.Wherein, recombinant interferon of the present invention is very remarkable for the effectiveness of the variant of hepatitis B virus, hepatitis C virus, wild type HIV or its persister, smallpox virus, SARS virus, Ebola virus, herpes simplex virus, varicella zoster virus, influenza virus, bird flu virus and infected person thereof.For example, for hepatitis B virus, recombinant interferon of the present invention can not only suppress the dna replication dna of hepatitis B virus and can also suppress hepatitis B virus surface antigen and the antigenic secretion of e, and the effectiveness of inhibition hepatitis B virus core antigen dna replication dna is compared with Infergen and doubled.

Expect that recombinant interferon of the present invention is all effective to the tumor of majority.Described tumor comprises, but be not limited to, skin carcinoma, basal cell carcinoma and malignant melanoma, renal cell carcinoma, hepatocarcinoma, thyroid carcinoma, nasopharyngeal carcinoma, solid shape tumor, carcinoma of prostate, gastric cancer, esophageal carcinoma, rectal cancer, pancreas cancer, breast carcinoma, ovarian cancer, superficial bladder cancer, hemangioma, epidermoid carcinoma, cervical cancer, nonsmall-cell lung cancer, small cell lung cancer, glioma, leukemia, acute leukemia, chronic leukemia, hairy cell leukemia, chronic lymphocytic leukemia, lymphoma, multiple myeloma, Ka Boji sarcoma, erythrocyte be disease too much.Wherein, test verifiedly, recombinant interferon of the present invention shows significant effectiveness for tumors such as malignant melanoma, renal cell carcinoma, hepatocarcinoma, breast carcinoma, ovarian cancer, chronic lymphocytic leukemia, hairy cell leukemias.

In addition, no matter be used for prevention or treatment viral disease or be used for the treatment of tumor, confirmed that any interferon of recombinant interferon of the present invention and other (containing Infergen) compares and have higher antiviral activity and lower side effect.For example, recombinant interferon of the present invention not only has and is better than the clinical antiviral activity of now using 0 times of interferon alpha-2, and the antitumor proliferative effect that obviously is better than the recombination human alpha type interferon; It has also greatly reduced toxic and side effects and heavy dose that can safety is used (every dose consumption can＞1,000 ten thousand IU), makes the part viral disease that needs heavy dose of medication interferon or the successful treatment of tumor become possibility.

The external pharmacodynamics of recombinant interferon of the present invention shows that it can not only suppress the dna replication dna of hepatitis B virus, and can suppress the secretion of surface antigen (HBsAg) and e antigen (HBeAg), its cytology's toxicity only for clinical now with interferon 1/8 but antiviral activity is the clinical 5-20 that now uses interferon times, the biological answer-reply reaction that in human body, has simultaneously the higher more wide spectrum longer time, can obviously suppress the hypertrophy and the transfer of tumor. and, make the part viral disease of the heavy dose of medication of needs or the successful treatment of tumor become possibility owing to greatly reduce toxic and side effects.

In a second aspect of the present invention, a kind of DNA sequence is provided, it comprises the nucleotide sequence of aminoacid sequence shown in the sequence 2 in the code sequence tabulation, and this nucleotide sequence according to the e. coli codon preferences wild-type sequence is adjusted and synthetic cDNA gets.For being that this nucleotide sequence obtains expressing, can be placed under the suitable promoter control.Preferred described promoter includes, but are not limited to P _BADPromoter.The design artificial gene is a kind of known method.The description of several different methods has been arranged for synthesizing ribonucleotide sequence and other Protocols in Molecular Biology before this.As: Joseph Sambrook and Dayid W.Russell, Molecular Cloning (molecular cloning): A laboratory Manual, December 2000, published by Cold Spring HarborLaboratory Press. to the detailed spy opinion of codon-bias can be in United States Patent (USP) the 4695623rd the 6th hurdle, read in the 41st row-Di 7 hurdles the 35th row.Therefore, according to the aminoacid sequence of determining, utilize cDNA coded sequence and the synthetic of e. coli codon preferences redesign rSIFN-co.Sequence 1 in the sequence table and sequence 3 are exactly to design the also object lesson of this nucleotide sequence of synthetic according to the e. coli codon preferences.

In a third aspect of the present invention, a kind of carrier is provided, it contains the DNA sequence of the invention described above.Preferred this carrier is a kind of expression vector, more preferably a kind ofly can express target peptide or proteic expression vector in E.Coli.

A concrete example is the plasmid pHY-5 shown in Fig. 5.This plasmid pHY-5 be to use gene recombination technology the cDNA sequence clone of rSIFN-co is gone among the colibacillary efficient expression vector pBAD18 and.Plasmid pHY-5 induces/activates expression and regulation mechanism by L-arabinose, the strong P in the activated carrier _BADPromoter causes the rSlFN-co gene efficient expression in downstream.

This arabinose induces/activate the expression regulation system than systems such as the temperature control of being adopted in the common genetic engineering production, pH regulation and control, IPTG induce tangible advantage to be arranged: several regulator control systems that adopt usually (1) all are that the formal solution with " going resistance to meet " removes the inhibitory action to function on, thereby promoter can mediate the expression of downstream gene.Change temperature, pH value itself and adding IPTG inducer etc. and all promoter is not had direct activation.In the system that we adopt, arabinose has not only been removed P with after repressor protein (AraC) combines _BADThe inhibitory action of promoter, " arabinose-AraC complex " can directly activate P again simultaneously _BADThe expression of promoter mediation downstream gene.So regulator control system is induced/activated to arabinose is a kind of than more effective escherichia coli high-level expression system of other several systems; (2) P _BADThe L-arabinose dosage of activatory degree of promoter and adding is linear.Can directly regulate the expression of exogenous genes products like this by changing arabinose concentrations.This characteristic is very meaningful to the formation that changes inclusion body etc.Add arabinose than the expression of easier direct control exogenous genes products in escherichia coli such as change temperature/pH; (3) the L-arabinose source is abundant, inexpensive, avirulence, and this overcomes other inducer such as IPTG shortcoming in this respect.(Guzman，L.M et al：Tight regulation，modulation，and high-level express-ion by vectors containingthe arabinose P _BAD promoter.J.Bacteriol.1995，177：4121～4130.)。

Though the promoter that goes through in this article is P _BAD, as other inducible promoters known to one of ordinary skill in the art as: the heat shock promoter also may be used to the present invention.

In a fourth aspect of the present invention, provide a kind of host cell that contains the invention described above carrier.This host cell for example is E.Coli.

The invention the 5th aspect, a kind of pharmaceutical composition is provided, and it comprises recombinant interferon of the present invention or its function equivalent and any pharmaceutically useful carrier. and the term of Shi Yonging " pharmaceutically useful carrier " is meant the pharmaceutical carrier of any standard in this article. and for example known appropriate carriers includes but are not limited to phosphate buffer and various wetting agent. and other carrier may comprise and is used for tablet, the additive of granule and capsule etc. typical carrier often contains just like starch, emulsion, sugar, certain type clay, gelatin, stearic acid and its esters are as magnesium stearate or calcium stearate, Talcum, Vegetable oil lipoprotein, natural gum, ethylene glycol or other known excipient. the composition in these carriers can be modulated with known traditional method.

Correspondingly, pharmaceutical composition of the present invention can be made into various dosage forms.For example, recombinant interferon of the present invention can be prepared into common dosage form, such as: injection, spray, lyophilized preparation, slow releasing agent, durative action preparation, tablet, capsule, oral liquid, patch, suppository, pharmaceutical solutions, the dosage form of recommending is injection, spray, lyophilized preparation, administering mode can be subcutaneous, muscle or intravenous injection, or spray delivery such as nasal spray or use the respirator administration.

In a sixth aspect of the present invention, a kind of method for the treatment of disease is provided, this method comprises that the patient to the needs treatment uses recombinant interferon of the present invention or its function equivalent of effective dose.Described interferon can give by spraying apparatus, for example by the aerosol apparatus administration that is used for nasal-cavity administration shown in Figure 15, and also can be by the respirator administration or by passing through mucosal administration.The administering mode of other recommendation comprises injection system, for example by intravenous injection, intramuscular injection or subcutaneous injection administration.

Term used herein " effective dose " is meant that this individuality produces the interferon amount of the alleviating, alleviating of symptom or the needed minimum that takes a turn for the better after recombinant interferon of the present invention itself or the pharmaceutical composition that contains this recombinant interferon are administered to the individuality of being treated.This effective dose may be because of different by factors such as the length of the order of severity of the kind of treatment patient's age, body weight, disease, disease, sick time, physical conditions.Clinician or pharmacists can and rationally determine the scope of this effective dose in conjunction with content disclosed herein according to the situation of reality.For example, for injection system for adult administration, if be used for the treatment of viral disease, this effective dose is generally per injection 5 μ g-30 μ g, preferred 9 μ g-15 μ g, one the week 3 times, a course of treatment 24 Mondays; If be used for the treatment of tumor, this effective dose is generally per injection 9 μ g-50 μ g, preferred 9 μ g-30 μ g, a week 3 times, a course of treatment 24 Mondays.

In Therapeutic Method of the present invention, described interferon or its function equivalent also can be united use with other antitumor drug or antiviral drugs.Also can unite use with the method for other various treatment diseases.

In a seventh aspect of the present invention, the method for a kind of production recombinant interferon of the present invention or its function equivalent is provided, comprise the following steps:

(a) introduce the nucleotide sequence of aminoacid sequence shown in the sequence 2 in the code sequence tabulation in the suitable expression and described nucleotide sequence is placed under the control of suitable promoter;

(b) carrier that step (a) is made up is introduced the host, and expresses under suitable expression condition, obtains inclusion body;

(c) collect and inclusion body that purification step (b) obtains;

(d) inclusion body that step (c) is obtained carries out degeneration and renaturation; And

(e) product after the renaturation is dialysed and ion chromatography successively.

Prepare in the method for recombinant interferon in the present invention, preferred described ion chromatography steps in sequence comprises HS cation chromatography and copper ion chromatography.

As indicated above, the nucleotide sequence that uses in step (a) according to the e. coli codon preferences wild-type sequence is adjusted and synthetic cDNA gets, and preferably this sequence is the nucleotide sequence shown in the sequence 3 in the sequence table.Described suitable promoter includes but not limited to P _BAD. as an example, the expression vector that the present invention makes up is pHY-5, the host of this carrier is escherichia coli, its induced expression agent is an arabinose. by to the cultivation and fermentation of this bacterial strain under suitable condition, the results thalline, broken bacterium of ultrasound wave and cyclic washing get inclusion body, by degeneration, renaturation and the separation purifying technique of inclusion body, obtained a large amount of highly purified comparing and had that unique space conformation and effect strengthen, side effect is lower can be used for research of the present invention and clinical treatment by heavy dose of rSIFN-co that uses with all known disturbances elements.

As required, after described ion chromatography step, also can further comprise the step of the interferon freeze-drying of purification.

In a eighth aspect of the present invention, the application that provides recombinant interferon of the present invention or its function equivalent to be used for preventing and treat viral disease and to treat the medicine of tumor in preparation.Particularly, be included in application in the medicine of preparation treatment hepatitis B, tumor, severe acute respiratory syndrome (SARS) or the upper respiratory disease that causes by viral infection, disease that influenza virus causes, other target individual viral diseases of disease, acquired immune deficiency syndrome (AIDS) and treatment that Ebola (Ebola) virus causes.Described other target individual viral diseases comprise: the hepatitis of hepatitis A, hepatitis C, other type.

Expect that recombinant interferon of the present invention can also prepare the medicine that is used to prevent and treat down the disease that influenza virus causes: Epstein-Barr virus, cell melanin virus, herpes simplex virus, varicella zoster virus, other herpesvirus, cytomegalovirus, human papillomavirus, poxvirus, picorna virus, rhinovirus, adenovirus, RNA viruses, I type human T-cell leukemia virus, II type human T-cell leukemia virus or III type human T-cell leukemia virus, west nile virus, yellow fever virus, rotavirus, parainfluenza virus, Measles virus, human syncytial virus-1, human syncytial virus-2, peste loca virus, dengue fever, yellow fever, cloth tower Toro virus.

In the above-mentioned application provided by the invention at tumor comprise:

To help to understand better the present invention by following example.Yet, those skilled in the art will appreciate that the concrete grammar and the result that hereinafter discuss only are to illustration of the present invention, protection scope of the present invention is definite by claims, and is not subjected to the restriction of instantiation.

Description of drawings

Fig. 1 is rSIFN-co coded cDNA sequence and the deduced amino acid thereof according to the aminoacid sequence of rSIFN-co and the design of e. coli codon preferences.

Fig. 2 is the another kind of coded cDNA sequence of rSIFN-co of the present invention.

Fig. 3 is pLac T7 cloning vector plasmids figure.

Fig. 4 is pBAD18 expression vector plasmid figure.

Fig. 5 is the construction procedures figure of expression plasmid pHY-5.

Fig. 6-A is that the wave-length coverage of Infergen (interferon alfacon-1) is the circular dichroism spectrogram of 250nm-190nm.

Fig. 6-B is the circular dichroism spectrogram of the Infergen (interferon alfacon-1) of list of references " Journal of Interferon and Cytokine Research.16:489-499 (1996) " record.

Fig. 6-C is that the wave-length coverage of rSIFN-co of the present invention is the circular dichroism spectrogram of 320nm-250nm.

Fig. 6-D is that the wave-length coverage of rSIFN-co of the present invention is the circular dichroism spectrogram of 250nm-190nm.

That Fig. 7 shows is rSIFN-co crystal I of the present invention.

That Fig. 8 shows is rSIFN-co crystal II of the present invention.

What Fig. 9 showed is the X-ray diffracting spectrum of rSIFN-co crystal I of the present invention.

What Figure 10 showed is the comparisons of different interferon to hepatitis B virus gene expression and cAg gene inhibition.

Figure 11 is the curve chart that the different blood sampling with Infergen (interferon alfacon-1) of injection rSIFN-co of the present invention time ratio is done than oligonucleotide enzyme concentration (2-5A concentration).

Figure 12 A is after showing administration rSIFN-co of the present invention, experimenter's body temperature change curve.Experiment A is divided into two groups, A1 group (result is presented at Figure 12 A1) and A2 group (result is presented at Figure 12 A2).The result that the result of this figure is presented between A1 group and the A2 group does not have significant difference.

Figure 12 B is after showing the administration Infergen, experimenter's body temperature change curve.Experiment B also is divided into two groups, B1 group (result is presented at Figure 12 B1) and B2 group (result is presented at Figure 12 B2).The result that the result of this figure is presented between B1 group and the B2 group does not have significant difference.But, Figure 12 A and Figure 12 B result displayed are compared significant difference between the result of experiment A and experiment B, low about 0.5 degree centigrade of the body temperature of experiment A group ratio experiment B group.

What Figure 13 showed is that rSIFN-co of the present invention suppresses result of experiment to the influenza virus infectiousness.

What Figure 14-A showed is that rSIFN-co of the present invention suppresses result of experiment to wildness HIV infectiousness.

What Figure 14-B showed is that rSIFN-co of the present invention suppresses experimental result to variation drug resistance HIV infectiousness.

What Figure 15 showed is a kind of equipment and this spray equipment operation instruction that is used for nasal-cavity administration rSIFN-co spray of the present invention.

Figure 16 A-Figure 16 H shows is with the patient's 1 that describes in detail diagnostic report in the example 15 that hereinafter provides.The figure illustrates interferon of the present invention in conjunction with operation and chemotherapy means to cancer patient's significant curative effect.

The specific embodiment

Example one:

Aminoacid sequence data (Klein ML according to the Infergen of having delivered (interferon alfacon-1) DNA sequences encoding and deduction, Bartley TD, Lai PH, et al., Structural characterizationof recombinant consensus interferon-alpha.Journal of Chromatography, 1988; 454:205-215), see Fig. 1, we utilize escherichia coli preferentially to express codon, and (Inc.Copyright 1992 for The Wisconsin Package, byGenetics Computer Group, Medison, Wisconsin USA), is guaranteeing under the constant situation of aminoacid sequence, its dna encoding sequence has been carried out MOLECULE DESIGN, then its rSIFN-co full-length cDNA encoding gene of synthetic.

Be used for research and clinical treatment in order to obtain a large amount of highly purified rSIFN-co albumen, we adopt recombinant DNA technology that the rSIFN-co full length cDNA sequence is cloned in the escherichia coli high-level expression carrier and go, and utilize L-arabinose to induce/activate the rSIFN-co gene efficient expression in the strong PBAD promoter mediation downstream in the expression and regulation mechanism activated carrier then.

Synthesizing of escherichia coli cDNA sequence

The redesign of rSIFN-co cDNA sequence

In order in escherichia coli, to be efficiently expressed, aminoacid sequence according to the Infergen of having delivered adopts the preferential codon of escherichia coli that total length rSIFN-co nucleotide coding sequence is carried out MOLECULE DESIGN, infer that by newly-designed rSIFN-co cDNA sequence its encoding amino acid sequence and Infergen aminoacid sequence are in full accord, see Fig. 1.

Synthetic rSIFN-co cDNA sequence

Synthesizing of rSIFN-co cDNA 5 '-end and 3 '-end half point

With the directly synthetic rSIFN-co cDNA 5 ' of PCR method-end 280bp (I fragment) and 3 '-two cDNA half point of end 268bp (II fragment).3 of fragment I '-end has the overlapping complementation of nucleotide sequence of 41bp with 5 of fragment II '-end.

The following oligodeoxynucleotide fragment of chemosynthesis

Oligomer A：

5’ATGTGCGACCTGCCGCAGACCCACTCCCTGGGTAACCGTCGTGCTCTGATCCTGCTGGCTCAGATGCGTCGTATCTCCCCGTTCTCCTGCCTGAAAGACCGTCACGAC3’

Oligomer B：

5’CTGAAAGACCGTCACGACTTCGGTTTCCCGCAGGAGAGGTTCGACGGTAACCAGTTCCAGAAAGCTCAGGCTATCTCCGTTCTGCACGAAATGATCCAGCAGACCTTC3’

Oligomer C：

5’GCTGCTGGTACAGTTCGGTGTAGAATTTTTCCAGCAGGGATTCGTCCCAAGCAGCGGAGGAGTCTTTGGTGGAGAACAGGTTGAAGGTCTGCTGGATCATTTC3’

Oligomer D：

5’ATCCCTGCTGGAAAAATTCTACACCGAACTGTACCAGCAGCTGAACGACCTGGAAGCTTGCGTTATCCAGGAAGTTGGTGTTGAAGAAACCCCGCTGATGAAC3’

Oligomer E：

5’GAAGAAACCCCGCTGATGAACGTTGACTCCATCCTGGCTGTTAAAAAATACTTCCAGCGTATCACCCTGTACCTGACCGAAAAAAAATACTCCCCGTGCGCTTGGG3’

Oligomer F：

5’TTATTCTTTACGACGCAGACGTTCCTGCAGGTTGGTGGACAGGGAGAAGGAACGCATGATTTCAGCACGAACAACTTCCCAAGCGCACGGGGAGTATTTTTTTTCGGTCAGG3’

(2) PCR reaction

The synthetic rSIFN-co 5 ' of PCR reaction I-end half point: as template, two oligodeoxynucleotide fragments of A and C are as primer with oligodeoxynucleotide fragment B, and carrying out PCR reaction composition length is rSIFN-co 5 '-sub-product of end half point of 280bp.

PCRI reactant mixture: (unit: μ l)

Nuclease free sterilized distilled water 39 10 * Pfu reaction buffer (production of U.S. Stratagen company) 5 dNTP mixture (each dNTP concentration is 2.5mmol/L), 2 A fragment primers (25 μ mol/L) 1
	C fragment primer (25 μ mol/L) 1 B fragment template (1 μ mol/L) 1 Pfu archaeal dna polymerase (production of U.S. Stratagen company) (25U/ μ l) 1

(cumulative volume 50 μ l)

PCR I reaction time:

95 ℃ 2 ' → (95 ℃ of 45 " → 65 ℃ 1 ' → 72 ℃ 1 ') * 25 cycle → 72 ℃ 10 ' → 4 ℃

The synthetic rSIFN-co 3 ' of PCR reaction II-end half point: as template, two oligodeoxynucleotide fragments of D and F are as primer with oligodeoxynucleotide fragment E, and carrying out PCR reaction composition length is rSIFN-co 3 '-sub-product of end half point of 268bp.

PCR II reactant mixture: (unit: μ l)

Nuclease free sterilized distilled water 39 10 * Pfu reaction buffer (production of U.S. Stratagen company) 5 dNTP mixtures (each dNTP concentration is 2.5mmol/L), 2 D fragment primers (25 μ mol/L), 1 E fragment primers (25 μ mol/L), 1 F fragment templates (1 μ mol/L), 1 Pfu archaeal dna polymerases (production of U.S. Stratagen company) (25U/ μ l) 1

(cumulative volume 50 μ l)

PCR II reaction condition and cycle are with PCR I

The assembling of rSIFN-co full-length cDNA molecule

Adopt " overlapping-extension PCR " thus method is fitted together the synthetic I of above-mentioned PCR and II slice groups and obtains complete rSIFN-co cDNA full-length molecule sequence.And its 5 '-end and 3 '-hold and to introduce Nde I and Pst I restriction enzyme site respectively so that with rSIFN-co cDNA sequence clone in plasmid vector.

(1) chemosynthesis primer

Oligomer G：5’ATCGGCCATATGTGCGACCTGCCGCAGACCC3’

Oligomer H：5’ACTGCCAGGCTGCAGTTATTCTTTACGACGCAGACGTTCC3’

(2) " overlapping-extension PCR " reaction

PCR reactant mixture: unit (μ l)

38 nuclease free sterilized distilled waters, 10 * Pfu reaction buffer (production of U.S. Stratagen company), 5 dNTP mixture (each dNTP concentration is 2.5mmol/L), 2 primer G (25 μ mol/L), 1 primer H (25 μ mol/L) 1 *Fragment I PCR product (1 μ mol/L) 1 *Fragment II PCR product (1 μ mol/L) 1 Pfu archaeal dna polymerase (production of U.S. Stratagen company) (25U/ μ l) 1

(cumulative volume 50 μ l)

Annotate: the StrataPrep PCR purification kit of producing with U.S. Stratagen company carries out separation and purification earlier with the PCR product, is dissolved in the sterilized distilled water then.

PCR reaction condition and cycle are with aforementioned PCR I.

The clone of rSIFN-co gene and sequence analysis

Select for use pLac T7 plasmid as rSIFN-co cDNA gene cloning carrier.PLac T7 plasmid is to form through pBluescript II KS (+) plasmid (production of U.S. Stratagen company) transformation, and its plasmid map is seen Fig. 3.

To contain rSIFN-co full-length cDNA PCR product with StrataPrep PCR purification kit (production of U.S. Stratagen company) and carry out purification, carry out enzyme action with NdeI and PstI then; Simultaneously pLac T7 plasmid is carried out NdeI and the dual enzyme action of PstI.These two kinds of enzyme action dna fragmentations are carried out electrophoretic separation on 1% agarose gel, the Winzard DNA purification kit with U.S. Promoga company reclaims from glue then, rSIFN-co dna fragmentation that purification 507bp is long and the plasmid enzyme restriction dna fragmentation of 2.9kb.The two is connected into recombiant plasmid through the catalysis of T4 dna ligase.The coupled reaction mixture is transformed DH5 α competent cell (production of U.S. Gibco company).After 37 ℃ of incubated overnight, select positive reorganization bacterium colony, called after pHY-1.

Press dna sequence analysis test kit (SequiThermTM Cycle Sequencing Kit, available from U.S. Epicentre Technologies company) description carries out determined dna sequence reaction, wherein primer is general T7 and T3 primer, and the dna sequencing result shows that it conforms to Design Theory.

The reorganization rSIFN-co albumen of purification carries out terminal 16 determined amino acid sequences of N-, and measurement result is consistent with the theoretical sequence results of Fig. 1-terminal amino acid.Its result is:

N end Cys-Asp-Leu-Pro-Gln-Thr-His-Ser-Leu-Gly-Asn-Arg-Arg-Ala-Leu-

The methionine of its N-end (Met) is cut in maturation protein.

The structure of expression vector, conversion, enzyme action are identified and hereditary stability

The structure of expression vector, conversion

With coli expression carrier pBAD18 plasmid, see Fig. 4, earlier through Nde I enzymolysis, make plasmid linearization (Linearized), carry out abundant enzymolysis with Xba I then.Through 1% agarose gel electrophoresis, the QIAEX II test kit purification that reuse Germany QIAGEN company produces obtains the 4.8kb fragment of pBAD18 through NdeI and XbaI digestion.

Meanwhile the pHY-1 plasmid is carried out Nde I and Xba I double digestion, after 1% agarose gel electrophoresis separates, be purified into the sequence fragment of 715bp size equally.The pBAD18 fragment of above-mentioned 4.8kb and rSIFN-co and the pBAD18 endonuclease bamhi of 715bp are connected into recombiant plasmid under the catalysis of T4 dna ligase, its building process is seen Fig. 5.The coupled reaction thing is transformed DH5 α competent cell, then transformant is applied to the LB-Amp agar plate, put 37 ℃ of overnight incubation.

The screening of positive colony bacterial strain

Provoke single bacterial clump at random from above-mentioned LB flat board, use the Cobra venom endonuclease enzymolysis, the method screening of pcr analysis contains the recombiant plasmid bacterial strain of rSIFN-co complete encoding sequence.With the positive recombiant plasmid called after of one of them PCR pHY-5.The bacterial strain called after PVIII that will contain the pHY-5 plasmid, it is frozen standby in-80 ℃ that the amplification back adds the glycerol cryopreserving liquid.

RSIFN-co gene efficiently expressing in E.coli

In the pHY-5 plasmid, the rSIFN-co gene is in strong promoter P _BADRegulation and control among, and P _BADBe subjected to the proteic regulation and control of Ara C again.Ara C is the protein by the ara C gene code that is arranged in same plasmid.Under the situation that does not have arabinose to exist, Ara C dimer and O ₂And I ₂In conjunction with the ring that forms a 210bp.This structure causes the inhibition fully of transcribing.When adding arabinose, Ara C dimer and O ₂Break away from, and then and I ₁And I ₂In conjunction with, remove inhibition to transcribing.Arabinose in conjunction with inactivation, inhibition, and activate P _BADTranscribing of promoter, thus P stimulated _BADMediating high-caliber rSIFN-co expresses.The rSIFN-co expression can reach 50% of bacterial protein.

Example two

The separation and purification of recombinant interferon (rSIFN-co)

The fermentation of engineering bacteria

Engineering strain is seeded in the LB culture medium, 37 ℃, shake bottle vibration (200rpm) overnight incubation (about 18 hours), add 50% concentration in the inoculum and be 30% glycerol mixing and be distributed into every of 1ml ,-20 ℃ of preservations are as producing strain.

The production strain inserts LB culture medium (containing peptone 10g among the 1L, yeast extract 5g, sodium chloride 10g) in 1% ratio, and 37 ℃, the 200rpm overnight incubation is as I level kind daughter bacteria.In in 10% the ratio adding RM culture medium (containing casein 20g among the 1L, magnesium chloride 1mmol/L (0.203g), sodium hydrogen phosphate 4g, potassium dihydrogen phosphate 3g, sodium chloride 0.5g, ammonia chloride 1g), 37 ℃, pH 7.0, ferment to OD again for I level kind daughter bacteria ₆₀₀Value about 2.0 adds arabinose (20%) to final concentration 0.02% induces, and receives bacterium after 4 hours, centrifugal.Bacterial sediment weighs suspendible with appropriate amount of buffer solution A (100mmol/L Tris hydrochloric acid pH7.5-10mmol/L EDTA-100mmol/L sodium chloride), put-20 ℃ of freeze overnight, after taking out thawing, refiner breaks bacterium, centrifugal, twice of reuse buffer B (50mmol/L Tris hydrochloric acid pH 7.5-1mol/L carbamide-10mmol/L EDTA-0.5% Triton X-100), the washing precipitation of buffer C (50mmol/LTris hydrochloric acid pH 7.5-2mol/L carbamide-10mmol/L EDTA-0.5% Triton X-100) difference, the reuse distilled water wash once obtains inclusion body.

Degeneration and renaturation

Obtain muddy slightly degeneration liquid with 6mol/L guanidine hydrochloride (or carbamide) dissolving inclusion body, the 10000rpm high speed centrifugation is got the protein concentration that supernatant is measured degeneration liquid.By whole protein concentration 0.3mg/ml, divides in the renaturation solution (0.5mol/L arginine-150mmol/L Tris hydrochloric acid pH 7.5-0.2mmol/L EDTA) that three times the adding of degeneration liquid has been prepared, and spend the night 4 ℃ of continuous stirring (about 18 hours).Then, use PB buffer and the distill water dialysis of 10mol/L, the 5mol/L of 10 times of volumes successively.Dialysis finishes, and transfers pH with acetic acid-sodium acetate (pH 5.0) of 2mol/L, leaves standstill, and filters.

Purification

HS cation chromatography:

At first, cylinder is used acetic acid-sodium acetate (pH 5.0) balance of 20mmol/L earlier, with sample on the speed of 30ml/min, with the 20mmol/L acetic acid-sodium acetate (pH 5.0) of 20 column volumes, eluting foreign protein.Then, contain the 20mmol/L acetic acid-sodium acetate (pH 5.0) of 0.15mol/L sodium chloride, eluting foreign protein with 5 column volumes.Then, 3 column volumes of reuse contain the 20mmol/L acetic acid-sodium acetate (pH 5.0) of 0.18mol/L sodium chloride, eluting foreign protein.At last, target protein dissociates with the 20mmol/L acetic acid-sodium acetate (pH 5.0) that contains 0.25mol/L sodium chloride.

Copper ion affinity chromatograph (chelating sepharose ^TMFast flow):

Dissociate sodium chloride that protein liquid adds the PB buffer of 0.2mol/L, pH 6.6 and 4mol/L of HS is transferred to and is contained 1mol/L sodium chloride, behind the pH 6.0, be equipped with and go up sample.Cylinder is with 50mmol/L sodium hydrogen phosphate buffer (pH 5.5) balance that contains 1mol/L sodium chloride, with sample on the speed of 1ml/min.Then, with 50mmol/L sodium hydrogen phosphate buffer (pH 5.0), the eluting foreign protein; Reuse 50mmol/L sodium hydrogen phosphate buffer (pH 4.0), the eluting foreign protein; Then, reuse 50mmol/L sodium hydrogen phosphate buffer (pH 3.6), target protein dissociates.

Sample concentration: with chelate column 30 times of the target protein liquid dilutions of dissociating, and transfer HS on the pH 5.0, dissociate, collect and promptly get recombinant interferon stock solution of the present invention with the PB buffer (pH 7.0) that contains 0.5mol/L sodium chloride.Its physico-chemical parameter such as following table are listed.

In some cases, sample purity is higher to be further purified by molecular sieve (sephacryl S-100) if require.

Some physico-chemical parameters of gained protein stock solution

Test event	Method	The result
			The protein relative amount is measured	The Lowry method	99.43％
Lipidated protein is measured	Non-reduced SDS-PAGE (dodecyl sodium sulfate-polypropylene phase acrylamide gel electrophoresis) HPLC analyzes	99.9％
			Molecular weight determination	Reduced form SDS-PAGE electrophoresis	18.59-18.83 (Kda)
The residual mensuration of foreign DNA	With dna marker and detection kit	Be lower than 10ng/ dosage
			Antibiotic remains is measured	Undertaken by " biological product chemistry and other calibration methods "	Antibiotic-free is residual
Bacterial endotoxin is measured	Undertaken by " biological product bacterial endotoxin test rules "
			Isoelectric point determination	Isoelectric focusing electrophoresis	In the 5.5-6.5 scope
Space conformation	The circular dichroism spectrometry	See accompanying drawing 6-A～6-D

Annotate:

" biological product chemistry and other calibration methods ", " biological product pyrogen test rules ", " biological product bacterial endotoxin test rules " all can be at " Chinese biological goods rules ", Pan Zhengan, Zhang Xinghui, Duan Zhibing etc.; Chinese biological standard of articles committee; Chemical Industry Press; Find in the versions in 2000.

Example three

The space conformation difference of recombinant interferon of the present invention (rSIFN-co) and Infergen (interferon alfacon-1)

Utilize the circular dichroism spectrometry to compare the space conformation difference of recombinant interferon of the present invention (rSIFN-co) and Infergen (interferonalfacon-1).

Adopt circular dichroism spectrometer J-500C, setting and measuring sensitivity is 2m °/cm, and light path is 0.20cm, measures the circular dichroism spectra of Infergen sample in wave-length coverage is 190nm-250nm; Described Infergen sample contains 30 μ g/ml Infergens, 5.9mg/ml NaCl, 3.8mg/ml Na ₂PO ₄, pH 7.0.Its result as shown in Figure 6A.

Adopt circular dichroism spectrometer J-500C, setting and measuring sensitivity is 2m °/cm, and light path is 2cm, measures the circular dichroism spectra of recombinant interferon of the present invention (rSIFN-co) sample in wave-length coverage is 250nm-320nm; Described interferon sample contains 0.5mg/ml rSIFN-co, 5.9mg/ml NaCl, 3.8mg/mlNa ₂PO ₄, pH 7.0.Its result is shown in Fig. 6 C.

Adopt circular dichroism spectrometer J-500C, setting and measuring sensitivity is 2m °/cm, and light path is 0.20cm, measures the circular dichroism spectra of recombinant interferon of the present invention (rSIFN-co) sample in wave-length coverage is 190nm-250nm; Described interferon sample contains 30 μ g/ml rSIFN-co, 5.9mg/ml NaCl, 3.8mg/mlNa ₂PO ₄, pH 7.0.Its result is shown in Fig. 6 D.

Comparison diagram A-schemes D, and as can be seen, recombinant interferon of the present invention (rSIFN-co) has the different spaces three dimensional structure with Infergen (interferon alfacon-1).

Example four

Recombinant interferon (rSIFN-co) crystal growth and crystallographic parameter are measured

The crystal research of recombinant interferon of the present invention (rSIFN-co).The process system groping and testing, and has obtained two kinds of crystal at present, sees accompanying drawing 7, accompanying drawing 8.

1, crystal growth

RSIFN-co albumen is dissolved to final concentration 3mg/ml with pure water.The Hampton Research Crystal Screen I and II of Hampton company is used in initial crystallization condition search.Adopt meteorological hanging drop diffusion method, pond liquid 500 μ l, drop 1 μ l albumen+1 μ l pond liquid, temperature is 293K.Initial searches obtains two kinds of dissimilar small crystalss, is listed in the table below by the crystal condition after optimizing.

RSIFN-co albumen crystallization condition

Condition	I	II
			Buffer agent	0.1M Tris-Hel PH＝8.75	0.1M HEPES PH＝7.13
Precipitant	17.5％(w/v)PEG550 MME	10％(w/v)PEG6K
			Additive	0.1M Nacl	3％(w/v)MPD
Temperature	293K	293K
			Crystal size (mm)	0.2×0.2×0.1	0.6×0.02×0.02
Crystallogram	Fig. 7	Fig. 8

2, data acquisition and processing

Crystal I has been used for X-ray diffraction data collection and Preliminary Crystallographic analysis, and finishes crystallographic parameter and measure.Diffraction data is collected in room temperature to carry out, and crystal I (condition I) is enclosed in the thin-walled quartz ampoule.Use BrukerAXS Smart ccd detector, the CuK alpha ray that light source adopts Nonius FR591 rotating anode target x-ray generator to produce 2 kilowatts of light source powers (40kv * 50mA), wavelength

Time of exposure 60 seconds, Δ φ=2 °, crystal is 50mm to the distance between the detector.Date processing uses the Proteum program package of Bruker company.Crystalline diffracting spectrum (part) is seen accompanying drawing 9.Result sees the following form.

The crystallographic parameter measurement result

Cell parameter

82.67

108.04

135.01

90.00

90.00

98.35

Space group P2 or P2 ₁

Resolution

Asymmetry unit molecular number 10

Solvent 57.6%

In addition, according to the crystallization condition of tens kinds of other interferon proteins having delivered, also attempted rSIFN-co is carried out crystallization, but all do not had crystal to grow.And the crystallization condition of (primary structure 87% homology) huIFN-α 2b the most close with rSIFN-co is very complicated, and resolution is during through three inoculation crystal length to 0.5 * 0.5 * 0.3mm

Space group also is P21, and structure cell is also very big, and an asymmetry unit has 6 molecules, solvent about 60%.

Example five

Recombinant interferon of the present invention (rSIFN-co) suppresses duplicating and HBsAg and HbeAg of HBV-DNA

1. test material

1.1 be subjected to reagent: recombinant interferon of the present invention (rSIFN-co), lyophilized formulations, protein content 9 μ g/ prop up, and are provided by Sichuan Prov. Biological Engineering Research Centre.Preserve in 4 ℃ of refrigerators.

Solvent and compound method: in every stock bottle, add the 0.5ml cell culture fluid when being subjected to the preparation of reagent thing, after the dissolving, allocate with the MEM culture fluid according to set various dose group concentration difference again.Matching while using.

1.2 positive control drug: the Infergen (interferon alfacon-1) that Amgen produces, 9 μ g/ prop up; The Recombinant Interferon (IFN-α 2b) that Ling Baoya company of elder generation produces, 30 μ g/ prop up.

1.3 2.2.15 cell: the 2.2.15 cell line of hepatitis B virus (HBV) dna clone transfection human liver cancer cell (Hep G2), U.S. Mount Sinai medical center makes up.

1.4 reagent: Eagles MEM dry powder, G-418 (Geneticin), yeast t-RNA, E.C. 3.4.21.64, U.S. GIBCO company product; Hyclone, U.S. Hyclone Lab company product; L-glutaminate, the import packing of Jing Ke chemical reagents corporation; HBsAg, HBeAg solid phase radioimmunoassay box is available from Beifang Inst. of Immune Reagents, Chinese Isotopes Co.; Kanamycin, North China Pharmaceutical Factory's product; Polyethylene Glycol, Sweden Fluka product; D- ³²P-dTCP, the inferior brightness biomedical engineering in Beijing company product; The carbon dioxide incubator, U.S. Shel-Lab product; γ-calculating instrument, German BECKMAN product; Scanner: MICROTEK product; Gel-pro analyzer software: MEDIA Product;

1.5 cell culture fluid and reagent preparation: MEM culture fluid 100ml: contain hyclone 10%, glutamine 0.03%, G418 380 μ g/ml, kanamycin 50U/ml.

2. test method

2.1 2.2.15 cell culture: add 0.25% pancreatin in the culture bottle that covers with the 2.2.15 cell, 37 ℃ digested 3 minutes, added culture fluid and dispelled, and went down to posterity at 1: 3, covered with in 10 days.

2.2 medicine pair cell toxicity test

Experiment divides no drug cell matched group and different pharmaceutical concentration medicine group.Cell dissociation is mixed with every milliliter of 100,000 cells, inoculated and cultured plate, the every hole 200 μ l of 96 orifice plates, 37 ℃ of 5%CO ₂Cultivated 24 hours, cell experimentizes after growing up to monolayer.Recombinant interferon of the present invention is mixed with 18 μ g/ml solution with culture fluid, and 2 times of dilutions add 96 porocyte culture plates, and same concentration liquid was changed in per 4 days in every concentration 3 holes, was index with the observation of cell pathological changes, 8 days microscopically observation of cell pathological changes, and destroying fully is 4; 75% is 3; 50% is 2; 25% is 1; Anosisly become 0.Calculate every concentration liquid average cell lesion degree and suppress %.Press the ReedMuench method and calculate the poisonous concentration (TC of half ₅₀) and maximal non-toxic concentration (TC ₀).

${\mathrm{TC}}_{50}=\mathrm{Anti}\log (B+\frac{50-B}{A-B}\×C)$

A=log＞50% drug level B=log＜50% drug level C=log extension rate

2.3 to HBeAg, HBsAg inhibition test

Test is established HBeAg, HBsAg positive controls, negative control group, cell matched group and different pharmaceutical concentration medicine group.2.2.15 700,000 every milliliter inoculations of cell 24 porocyte culture plates, every hole 1ml, 37 ℃ of 5%CO2 cultivated 24 hours, the following 3 times of dilutions of test medicinal liquid non-toxic concn, 5 dilution factors are respectively 9.0,3.0,1.0,0.33,0.11 and 0.056 μ g/ml, every concentration 1 hole, 37 ℃ of 5%CO ₂Cultivate, changed the original content medicinal liquid and cultivate results culture fluid in the time of the 8th day ,-20 ℃ of stored frozen in per 4 days.Test repeats three batches, measures HBsAg and HBeAg respectively.HBsAg and HBeAg measure and adopt Beifang Inst. of Immune Reagents, Chinese Isotopes Co.'s product, and the solid phase radioimmunoassay box is measured, and method is seen description, measures every hole cpm value with γ-calculating instrument.

Effect of drugs calculates: calculate cell contrast and every concentration c pm average and standard deviation, P/N value as inhibition percentage rate (%), medium effective concentration (IC ₅₀) and selection index (SI).

2. calculate medicine and suppress antigen medium effective concentration (IC ₅₀):

${\mathrm{TC}}_{50}=\mathrm{Anti}\log (B+\frac{50-B}{A-B}\×C)$

A=log＞50% drug level B=log＜50% drug level C=log extension rate

3. recombinant interferon of the present invention to the selection index (S1) of HBsAg and HBeAg, calculates by its pair cell toxicity index cytopathy (S1) in the 2.2.15 cell culture.

4. calculate the statistical significance of the difference of cpm between each dilution factor HBsAg, HBeAg and matched group with the t method of inspection.

2.4 the 2.2.15 cell DNA is suppressed experiment

2.2.15 HBV-DNA extracts in the cell conditioned medium: 700,000 every milliliter inoculations of 2.2.15 cell 6 porocyte culture plates, every hole 3ml, inoculate back 24 hours and add interferon, changing the original content medicinal liquid in per 4 days cultivates, cultivate after the dosing and collected supernatant on the 8th day, add polyethylene glycol precipitation, the centrifugal supernatant that goes adds the E.C. 3.4.21.64 cell lysis, add yeast t-RNA, equal-volume phenol: chloroform: isoamyl alcohol extracts 2 times, high speed 10, and 000g is centrifugal, get supernatant, add the dehydrated alcohol precipitate nucleic acids, vacuum is drained, and heavily is dissolved in the TE buffer making sample.

Dot blot hybridization: 1. point sample: get 20ul (dna content 25ug), add the degeneration of degeneration liquid, it is neutralized with neutralizer, and with 20XSSC buffer two-fold dilution to 1: 128 times are diluted on the nitrocellulose filter, film is put to be placed on after room temperature is dried to do in 80 ℃ of baking boxs and is baked, with fixed dna.2. prehybridization: nitrocellulose filter is loaded on adds prehybridization solution 6ml in the plastic bag, put in the water-bath prehybridization 2 hours.3. hybridization: add 5X10 ⁷Cpm α- ³²The degeneration HBV-DNA probe of p-dCTP labelling, hybridization is 14-18 hour in 42 ℃ of water-baths.4. wash film: wash film room temperature and 65 ℃ respectively with 0.1XSSC/0.1%SDS.5. radiate autoradiography: blot mobile moisture on the film, intermediate plate, exposure.With conventional method towards X-ray sheet developing.The scanner scanning mating plate is measured density with gel-pro software, calculates suppression ratio and IC ₅₀

2.2.15 HBV-DNA in the cell culture fluid

Southernblot: 1. HBV-DNA extracts in the 2.2.15 cell: cultivated 8 days after the dosing of 2.2.15 cell, absorb culture fluid and collect cell, add cell pyrolysis liquid, cell lysis, equal-volume phenol: chloroform: isoamyl alcohol extracting 2 times, high speed 10,000g is centrifugal, gets supernatant, adds the dehydrated alcohol precipitate nucleic acids, vacuum is drained, and heavily is dissolved in the 20 μ l TE buffer; 2. electrophoresis: add the 6XDNA sample buffer, sample is added on electrophoresis on 1.5% agarose gel, IV/em, constant voltage, 14-18 hour; 3. degeneration, hybridization: glue is dipped in respectively in HCl, degeneration liquid, the neutralizer; 4. change film: follow procedure goes to DNA on the Hybond-N film.Together bake film, hybridization, exposure with dot blot hybridization.The scanner scanning mating plate with gel-pro gel analysis software analysis relative density, calculates suppression ratio and IC ₅₀

3, statistics and analysis

Each organizes data with average (x) ± standard deviation (S) expression, respectively organizes the mean significance of difference with Student t inspection.Cell culture toxicity is pressed Reed Muench method and is calculated the poisonous concentration (TC of half ₅₀) and maximal non-toxic concentration (TC ₅₀).HBV-DNA is suppressed effect calculate, HBsAg and HBeAg are suppressed effect with gel-pro gel analysis software analysis mating plate relative density, calculate suppression ratio and IC by listed formula ₅₀

4, result of the test

4.1 the cytotoxicity in the 2.2.15 cell culture

Be to observe the toxicity of rSIFN-co, behind inoculation 2.2.15 cell 24 hours, add 2 times of dilute liquid medicines people's hepatocarcinoma 2.2.15 cell of hepatitis B virogene transfection.9,4.5,2.25,7 dilution factors of 1.13...... μ g/ml test begins from 18 μ g/ml:, changed medicine one time in 4 days, kept 8 days, used microscope observing cell pathological changes, microscopy CPE, TC on the 8th day ₅₀The result be respectively recombinant interferon of the present invention: 18 μ g/ml, Infergen: 9 μ g/ml, Recombinant Interferon: 3 μ g/ml.The results are shown in Table 1.

The toxicity of table 1 recombinant interferon of the present invention pair cell in the 2.2.15 cell culture

Two batches average 18 ± 09 ± 0

The toxicity of table 2 Infergen pair cell in the 2.2.15 cell culture

Two batches of average＞9 ± 0＞9 ± 0

The toxicity of table 3 Recombinant Interferon pair cell in the 2.2.15 cell culture

4.2 effect to HBsAg and HBeAg expression in the 2.2.15 cell culture

4.2.1 recombinant interferon of the present invention is in the effect to HBsAg and HBeAg

Recombinant interferon 9,3,1,0.33 of the present invention and 0.11 μ g/ml add in the 2.2.15 cell culture system, observe its expression effect to HBeAg and HBsAg on the 8th day.The results are shown in Table 4.

4.2.1.1 suppression ratio to HBeAg

Three batches of tests rSIFN- co 9,3,1,0.33 and each concentration group of 0.11 μ g/ml are respectively 46.0 ± 5.25%, 40.57 ± 6.08%, 19.8 ± 4.40%, 8.85 ± 9.44%, 5.73 ± 5.85% to the average suppression ratio of the 8th day supernatant HBeAg of 2.2.15 cells and supernatant.Recombinant interferon of the present invention is to the IC of HBeAg ₅₀Be respectively: 6.02,3.64,3.94 μ g/ml, average out to: 4.5 ± 1.32 μ g/ml.

4.2.1.2 suppression ratio to HBsAg

Three batches of tests rSIFN- co 9,3,1,0.33 and each concentration group of 0.11 μ g/ml to the average suppression ratio of the 8th day supernatant HBsAg of 2.2.15 cell culture be respectively 44.8 ± 6.6%, 27.9 ± 2.41%, 6.30 ± 5.46%, 2.57 ± 4.45%, 4.23 ± 6.90%. recombinant interferon of the present invention is to the IC of HBsAg ₅₀Be respectively: 6.42,6.12,6.94 μ g/ml, average out to: 6.49 ± 0.42 μ g/ml.To 2.2.15 cell TC ₅₀Be 18 μ g/ml, selection index SI is respectively 3.96 and 2.77.

Table 4 recombinant interferon of the present invention is to the effect of HBeAg and HBsAg

First experiment: HBeAg

Second crowd of experiment: HBeAg

The 3rd crowd of experiment: HBeAg

The average IC of HBeAg ₅₀Be 4.54 ± 1.32 μ g/ml, TC ₅₀Be 18 μ g/ml, selection index is 3.96

The average IC of HBsAg ₅₀Be 6.49 ± 0.42 μ g/ml, TC ₅₀Be 18 μ g/ml, selection index is 2.77

4.2.2 Infergen is to the effect of HBeAg and HBsAg

Add in the 2.2.15 cell culture system in multiple Tianjin 9,3,1,0.33 and 0.11 μ g/ml, measured culture fluid HBsAg and HBeAg titre on the 8th day, calculate and suppress effect, the results are shown in Table 5.

4.2.2.1 suppression ratio to HBeAg

Three batches of test Infergen each the concentration groups are respectively the average suppression ratio of the 8th day supernatant HBeAg of 2.2.15 cell culture: 9 μ g/ml suppress 14.37 ± 4.33%, 3 μ g/ml and suppress 7.4 ± 4.13%, 1 μ g/ml and suppress 3.7 ± 2.0%, 0.33 μ g/ml, 0.11 μ g/ml unrestraint.Maximum concentration 9 μ g/ml only suppress 14.37 ± 4.33%.

4.2.2.2 suppression ratio to HBsAg

Three batches of test Infergen each the concentration groups are respectively the average suppression ratio of the 8th day supernatant HBsAg of 2.2.15 cell culture: 9 μ g/ml suppress 2.0 ± 1.83%, 3 μ g/ml and suppress 4.5 ± 5.07%, 1 μ g/ml, 0.33 μ g/ml, 0.11 μ g/ml unrestraint.Maximum concentration 9 μ g/ml only suppress 2.0 ± 1.83%.

Table 5. Infergen is to the effect of HBeAg and HBsAg

First experiment

Second batch of experiment:

The 3rd batch of experiment:

4.2.3 Recombinant Interferon is to the effect of HBeAg and HBsAg

3 times of dilutions of Recombinant Interferon, 1,0.33,0.11 and 0.037 μ g/ml adds the 2.2.15 cell culture, measures culture fluid HBeAg and HBsAg titre on the 8th day, calculates and suppresses effect.Because the sample deficiency is only carried out a collection of experiment, the results are shown in Table 6.

4.2.3.1 suppression ratio to HBeAg

Each concentration group of Recombinant Interferon has only 1 μ g/ml to suppress 6.87%, 0.33 μ g/ml, 0.11 μ g/ml and 0.037 μ g/ml unrestraint to the average suppression ratio of the 8th day supernatant HBeAg of 2.2.15 cell culture.Illustrate that Recombinant Interferon is faint to 2.2.15 emiocytosis HBeAg inhibitory action, maximum concentration 1 μ g/ml only suppresses 6.87%.

4.2.3.2 suppression ratio to HBsAg

Recombinant Interferon 1,0.33,0.11 and each concentration group of 0.037 μ g/ml are respectively the average suppression ratio of the 8th day 1,0.33 μ g/ml group of 2.2.15 cell culture supernatant HBsAg: 17.8%, 1.85%.0.11 μ g/ml, 0.037 μ g/ml unrestraint.Show that Recombinant Interferon is faint to 2.2.15 emiocytosis HBsAg inhibitory action, maximum concentration 1 μ g/ml only suppresses 17.8%.

Table 6. Recombinant Interferon in the 2.2.15 cell culture to the effect of HBeAg and HBsAg

4.3 inhibitory action to 2.2.15 cell culture supernatant HBV-DNA

4.3.1 recombinant interferon of the present invention HBV-DNA results of dot in the 2.2.15 cell culture supernatant sees Table 7.

Table 7. recombinant interferon of the present invention in the 2.2.15 cell culture supernatant to the effect of HBV-DNA

First experiment HBV-DNA spot density value:

IC ₅₀(calculating): 0.789 μ g/ml with the inhibition % that dilutes 1/2 couple of HBV-DNA

Second batch of experiment HBV-DNA spot density value:

Recombinant interferon of the present invention in the 2.2.15 cell culture supernatant to the effect of HBV-DNA, average IC ₅₀Be 0.766 ± 0.318 μ g/ml, TC50 is 18 μ g, and selection index is 23.5.

4.3.2 Infergen the 2.2.15 cell culture to supernatant in the effect of HBV-DNA see Table 8.

Table 8. Infergen in the 2.2.15 cell culture to supernatant in the effect of HBV-DNA

First is tested in the 2.2.15 cell culture supernatant dot blot hybridization HBV-DNA density value

IC ₅₀(calculating):＞9.0 μ g/ml with the inhibition % that dilutes 1/2 couple of HBV-DNA

The second batch of experiment in the 2.2.15 cell culture to supernatant dot blot hybridization HBV-DNA density value

Two batches of experiment Infergens do not have obvious inhibitory action, IC to HBV-DNA in the 2.2.15 cell conditioned medium liquid ₅₀Be＞9 ± 0 μ g/ml.Selection index is:＜1.

4.3.3 Recombinant Interferon in the 2.2.15 cell culture to supernatant in the effect of HBV-DNA see Table 9.

Table 9. Recombinant Interferon in the 2.2.15 cell culture to supernatant in the effect of HBV-DNA

First is tested in the 2.2.15 cell culture supernatant dot blot hybridization HBV-DNA density value

IC ₅₀(calculating): 0.0635 μ g/ml with the inhibition % that dilutes 1/2 couple of HBV-DNA

A collection of experiment interference can have obvious suppression effect, IC to HBV-DNA in the 2.2.15 cell ₅₀Be 0.0635 μ g/ml.TC ₅₀Be 3 μ g/ml, selection index is: 47.2.

4.4 be subjected to the inhibitory action of reagent HBV-DNA Southern Blot in the 2.2.15 cell

4.4.1 the Southern Blot inhibitory action of recombinant interferon of the present invention HBV-DNA in the 2.2.15 cell, two batches of experimental results see Table 10.

The inhibition data of table 10. recombinant interferon of the present invention HBV-DNA Southern Blot in the 2.2.15 cell

The result shows: total HBV-DNA Southern blot measurement result inlane inhibitory action is average in the recombinant interferon inoculating cell of the present invention: IC ₅₀Be 0.826 ± 0.294 μ g/ml, TC ₅₀Be 18 μ g/ml, SI is 21.79.

4.4.2 to the Southern Blot inhibitory action of HBV-DNA, two batches of experimental results see Table 11 to Infergen in the 2.2.15 cell.

Table 11. Infergen in the 2.2.15 cell to the inhibitory action of the Southern Blot of HBV-DNA

The result shows: total HBV-DNA Southern Blot measures in lane, inhibitory action, IC in the Infergen inoculating cell ₅₀: 5.63 ± 0.012 μ g/ml, TC ₅₀Be＞9 μ g/ml, SI is 1.60.

4.4.3 to the Southern Blot inhibitory action of HBV-DNA, a collection of experimental result sees Table 12. to the Schering Plough Recombinant Interferon in the 2.2.15 cell

The inhibitory action of table 12. Schering Plough Recombinant Interferon HBV-DNA Southern Blot in the 2.2.15 cell

The result shows: total HBV-DNA Southern Blot measures the inhibitory action average out to that in lane calculates: IC in the Schering Plough Recombinant Interferon inoculating cell ₅₀: 0.095 μ g/ml, TC ₅₀Be 3 μ g/ml, SI is 31.58.

5 conclusions

This experimental observation be subjected to the toxicity of reagent pair cell in the human liver cancer cell 2.2.15 of hepatitis B virus transfection cell line is cultivated, to HBeAg and HBsAg secretion and to the inhibitory action of HBV-DNA.Conclusion is as follows:

5.1 toxicity to the 2.2.15 cell culture

The recombinant interferon of the present invention of different dosing concentration added the 2.2.15 cell culture respectively 8 days, was index with the cytopathy, compared with Infergen and Recombinant Interferon, recombinant interferon half toxic concentration (TC of the present invention ₅₀) be 18 ± 0 μ g/ml, maximal non-toxic concentration (TC0) is 9 ± 0 μ g ml.Cmax 9 ± 0 μ g/ml avirulences of Infergen, half toxic concentration (TC ₅₀) and maximal non-toxic concentration (TC0) all be＞9 ± μ g/ml.Recombinant Interferon half toxic concentration (TC ₅₀) be 3 ± 0 μ g/ml, maximal non-toxic concentration (TC0) is 1.5 ± 0 μ g/ml.

5.2 in the 2.2.15 cell culture to the excretory inhibitory action of HBeAg and HBsAg

Each sample added the 2.2.15 cell culture 8 days with maximal non-toxic concentration, and recombinant interferon 9 ± 0 μ g/ml of the present invention are 46.0 ± 5.25% (P＜0.001) to the suppression ratio of HBeAg, IC ₅₀Be 4.54 ± 1.32 μ g/ml, selection index SI is 3.96, and obvious inhibitory action is arranged, and maximal non-toxic concentration 9 μ g/ml are 44.8 ± 6.6% to the suppression ratio of HBsAg, IC ₅₀Be 6.49 ± 0.42 μ g/ml, selection index SI is 2.77.Infergen and Recombinant Interferon to HBeAg and HBsAg inhibitory action a little less than, maximum concentration only suppresses below 20%.

5.3 in the 2.2.15 cell culture to the HBV-DNA inhibitory action

Each sample added the 2.2.15 cell culture 8 days with maximal non-toxic concentration, and recombinant interferon dot blot hybridization of the present invention and Southern Blot measure HBV-DNA result and be respectively IC ₅₀Be 0.766 ± 0.318 μ g/ml, SI is 23.5; The average IC of Southern BlotA result ₅₀Be 0.826 ± 0.294 μ g/ml, SI is 21.79.Two batches of experiments of Infergen dot blot hybridization IC ₅₀Be＞9 ± 0 μ g/ml, SI is＜1.The average IC of Southern Blot result ₅₀Be 5.63 ± 0.12 μ g/ml, SI is 1.60; The a collection of experiment dot blot hybridization of Recombinant Interferon IC ₅₀Be 0.0635 ± 0.294 μ g/ml, SI is 47.2, the average IC of Southern Blot result ₅₀Be 0.095 ± 0 μ g/ml, SI is 31.58.

Table 13. conclusive table

The interior HBV-DNA of cleer and peaceful cell also has obvious inhibitory action on the recombinant interferon pair cell of the present invention, but different with other interferon, high concentration 9 μ g/ml can suppress the secretion of HBeAg and HBsAg in the 2.2.15 cell.The Recombinant Interferon that Infergen that U.S. Amgen produces and U.S. Schering Plough company produce can not suppress the secretion of HBeAg and HBsAg in the 2.2.15 cell.

Example six

Recombinant interferon of the present invention (rSIFN-co) is tested the inhibition that hepatitis B virus gene is expressed and cAg is expressed

This experiment is chosen recombinant interferon of the present invention (rSIFN-co), Infergen (interferon alfacon-1) and Recombinant Interferon (IFN-α 2b) hepatitis B virus gene expression and cAg gene is suppressed experiment.

Hepatitis B virus (HBV) DNA has comprised the conservative binding sequence of trans-activator, and the active interferon that is subjected to of this proteic combination is regulated and control.Cause the inhibition of HBV gene expression with the hepatocyte of interferon processing HBV transfection.The purpose of this research is the influence of the different interferon of research to the HBV transcriptional control.With the report plasmid (reporter plasmid) of the luciferase gene under the control that contains HBV enhancer EnH I, EnH II and core promoter, transient transfection human hepatocytes cancerous cell.

One, material and method:

1. interferon: recombinant interferon of the present invention (rSIFN-co), Infergen (IFN-con1) and Recombinant Interferon (IFN-α 2b).

2. report plasmid: pcr amplification has comprised the DNA section of EnH I, EnH II and core promoter, end is cut flat, be cloned into pGL3-Basic (Promega, WI, USA) the Smal I site before the no enhancer and the luciferase gene of promoter, the reporter plasmid called after pGL3-HBV-Luc of generation.

3. cell culture and DNA change infection: in the DMEM culture medium, this culture medium is added 10%FBS with the HepG2 cell culture, the penicillin of 100U/ml and 100ug/ml streptomycin.Cell is positioned over 30 ℃ of temperature, contains in the incubator of 5% CO2.The lipofectamine box that uses Boehringer is with pGL3-HBV-Luc reporter plasmid transfectional cell.Through 18 hours, remove the culture medium that contains transfection reagent, inject the fresh culture that contains or do not contain interferon, cultivated again 48 hours.

4. luciferase assay: inject interferon after 48 hours, collect and smudge cells.The protein concentration of this cell lysates is detected by Bio-Rad quantification of protein test kit, and uciferase activity is measured the luciferase reporting detection system of using Promega, and the guide that provides according to manufacturer carries out.

Two, experimental result: see accompanying drawing 10.By shown in the accompanying drawing 10 as can be known, the Recombinant Interferon suppression ratio is 27%, the Infergen suppression ratio is 35%, the rSIFN-co suppression ratio is 68%.

Four, experiment conclusion:

Recombinant interferon of the present invention (rSIFN-co) exceeds about twice the suppression ratio that hepatitis B virogene is expressed and cAg is expressed the Infergen of the rejection ratio U.S. Amgen of hepatitis B virogene expression and cAg expression and the Recombinant Interferon of Schering Plough company.

Example seven

Recombinant interferon of the present invention (rSIFN-co) formulation examples prescription

Injection:

	Aqueous injection	Lyophilized injectable powder
			Recombinant interferon stock solution of the present invention	34.5μg/ml	34.5μg/ml
The phosphate buffer of pH7.0	25mmol/L	10mmol/L
			Glycine	---------	0.4mol/L
Sodium chloride	0.1mol/L	----------

Spray:

EDTA	0.01％
		Tween
80	0.05％
		Trisodium citrate	10mmol/L
Glycerol	1.26％
		Sodium chloride	0.03％
Benzyl alcohol	0.5％
		The human albumin	0.1％
Recombinant interferon of the present invention	10μg/ml

Example eight

Recombinant interferon of the present invention (rSIFN-co) preparation

The preparation of freeze dried injection

Recombinant interferon stock solution 34.5 μ g/ml of the present invention

The phosphate buffer 1 0mmol/L of pH7.0

Glycine 0.4mol/L

Preparation technology: by the prescription weighing, aseptic apyrogeneity injection water dissolving, 0.22 μ m aperture membrane filtration degerming is in 6-10 ℃ of preservation, sampling is done behind the aseptic and nonpyrogenic in the packing cillin bottle, 0.3/ bottle or 0.5/ bottle of single dose. be placed to lyophilization in the freeze dryer after the packing.

The preparation of aqueous solution injection

Recombinant interferon stock solution 34.5 μ g/ml of the present invention

The phosphate buffer 25mmol/L of pH7.0

Sodium chloride 0.1mol/L

Preparation technology: by the prescription weighing, aseptic apyrogeneity injection water dissolving, 0.22 μ m aperture membrane filtration degerming, in 6-10 ℃ of preservation, sampling is done to be sub-packed in the hermetic container behind the aseptic and nonpyrogenic, 0.3/ bottle or 0.5/ bottle of single dose, and finished product is put 2-10 ℃ of dark place and is preserved after the packing.

Example nine

The stability of recombinant interferon of the present invention (rSIFN-co) freeze-dried powder injection

We carry out stability test with three batches of each two kinds of specification samples of recombinant interferon lyophilized injectable powder of the present invention, test zero-time: in April, 2000.

One, sample source

Continuous three batches of each the two kinds of specification lyophilized injectable powders of recombinant interferon of the present invention are prepared by Sichuan Prov. Biological Engineering Research Centre, and middle test agent lot number is respectively: 990101,990102,990103, and criticize each two Asia.

Two, sample standard

Carrying out should meeting following table before each sampling test of this experiment requires:

Sample index before the test

Index	Prescription
			1. outward appearance 2. dissolution times 3. clarity 4.pH values 5. (IU/ props up) 6. moisture content of tiring	(in 2 minutes) are colourless or little rapidly is with opalescent clear liquid for water for injection dissolving under the white loose body room temperature, do not answer muddiness, contain foreign body or shake 80%～150% (9 μ g:450, ten thousand IU, 15 μ g:750, ten thousand IU)≤3.0% (W/W) of precipitation 6.5～7.5 labelled amounts of not loosing

Three, content of the test

1,2～8 ℃ of investigations that keep sample: sample to be investigated is placed 2～8 ℃ of refrigerators, be set in sampling in the 1st, 3,6,9,12,18,24,30,36 month respectively, measure These parameters, and perform record.

2,25 ℃ of investigations that keep sample: sample to be investigated is placed 25 ℃ of calorstats, be set in sampling in the 1st, 3,6,9,12,18,24,30 month respectively, measure These parameters, and perform record.

3,37 ℃ of investigations that keep sample: sample to be investigated is placed 37 ℃ of calorstats, be set in sampling in the 1st, 3,6,9,12,18,24 month respectively, measure These parameters, and perform record.

Four, result and discussion

1, three batches of (990101,990102,990103) each two specification samples of lyophilizing rSIFN-co are at 37 ℃ of reserved sample observings, detect every index in the different times sampling, relatively preceding with test, 6th month begins to tire on a declining curve, three batch samples are tired and are changed similarly, and all the other detect indexs and meet the requirements.

2, three batches of (990101,990102,990103) each two specification samples of lyophilizing rSIFN-co, compare with test is preceding in the every index of different times sampling detection at 25 ℃ of reserved sample observings, and in 9 months, tiring changes not quite, and all the other detect the requirements of index symbol.

3, three batches of (990101,990102,990103) each two specification samples of lyophilizing rSIFN-co are at 2～8 ℃ of reserved sample observings, detect every index in the different times sampling, compare with test is preceding, it is stable to tire in 9 months, no significant change, every detection index meets the requirements.

Therefore, our suggestion: the freeze dried storage of recombinant interferon of the present invention, transportation should be appropriate with low temperature, do not reach under the situation of cryogenic conditions, in the short time (3 months) but room temperature place.

Example ten

Recombinant interferon of the present invention (rSIFN-co) spray

RSIFN-co has the broad-spectrum disease resistance toxic action, and its extracorporeal antivirus effect activity is 5-20 a times of existing other interferon.In vitro tests shows that recombinant interferon of the present invention has significant anti-SARS virus activity, recombinant interferon of the present invention is respectively 0.92 and 0.18 μ g/ml to the half-inhibition concentration (IC50) of 10000 and 1000 TCID50SARS viruses, and therapeutic index should be 151.28 and 773.32 mutually.See example 16 for details.

Recombinant interferon spray of the present invention, main active is rSIFN-co, and character is a colourless liquid, the visible insoluble matter of no naked eyes.Its antiviral mechanism is main by the interferon receptors combination of interferon with the target cell surface, induces multiple antiviral proteins such as 2 ' 5 '-A synzyme, protein kinase in the target cell, stops the synthetic of virus protein.And by inducing multiple antiviral protein, suppress virus and strengthen NK cytoactive and other immunoregulation effects intracellular duplicating, contain the generation of virus attack and infection effectively.In the toxicological test of recombinant interferon spray of the present invention, maximal dose vein or intramuscular injection mice are all strong deposits, and does not have death, does not measure LD50.By pharmacology, the toxicological study of rSIFN-co spray, prove that recombinant interferon spray of the present invention is applicable to prevention or the upper respiratory disease for the treatment of severe acute respiratory syndrome or being caused by viral infection.

The untoward reaction research of recombinant interferon spray of the present invention: do not see the report of recombinant interferon spray untoward reaction at present in the world as yet, generally can not cause stimulation, allergy and general reaction.The slight stimulation and gastrointestinal reaction appears in individual persons once in a while during the medication, if there are not other significant reaction, need not stop administration rSIFN-co spray, but spontaneous remission.

Recombinant interferon spray of the present invention is preserved under 4-8 ℃ of cold preservation lucifuge condition, and is not freezing.Use aerosol apparatus shown in Figure 15, its in accordance with the following methods with the use amount administration: every day early, middle and late each nostril each the spray once, throat is once.During each administration, take down medicine bottle plastic nozzle cover, extruding is sprayed and once (is seen accompanying drawing 15).Whenever pressing discharge rate is 0.1ml, and degree of atomization is 15.60-30.51 μ m (by quantitation nozzle atomizing ejection).The high 90mm of described aerosol apparatus, bottom width 25mm, top width 6mm, heavy 9g, every sprinkler body is long-pending: 0.1ml.

Example 11

Recombinant interferon of the present invention (rSIFN-co) acute toxicity test

This test is adopted once to mouse muscle injection recombinant interferon 150 μ g/kg of the present invention (be equivalent to be grown up per kilogram of body weight consumption 1000 times).2 all interior animal acute toxicities react and death condition after observing administration.The result shows: behind the intramuscular administration, and animal no abnormality seen situation in 24 hours, put to death the part animal and also become celestial through perusal: each main organs is not seen macroscopic pathological changes.Remaining mice is also no abnormality seen reaction in 2 weeks, and also none is only dead, and in the discovery of weighing in the 14th day, administration group and control group mice body weight all increased to some extent, and two groups of weight increase value no significant differences (P＞0.05).Put to death mice each main organs that becomes celestial and do not have macroscopic pathological changes.

One, experiment material

1, experimental animal

40 of adult healthy KM mices, body weight 18～22g, male and female half and half, the SPF level, the certification of fitness: No. 6, the real moving Guan Zhidi in river, 1998 are qualified, use and implement the quality certification: the real moving pipe in river 99-5 number, qualified, the doctor is moving to be learned 24A00003 number, qualified.

2, test drug

Recombinant interferon of the present invention is provided by Sichuan Prov. Biological Engineering Research Centre, sterile liquid, 0.15mg/ml, lot number: 981201

Being made into desired concn with the injection normal saline promptly uses.

Two, experimental technique

40 mices are divided into 2 groups at random by body weight, sex, be respectively normal saline negative control group and recombinant interferon group of the present invention (150 μ g/kg), every group of 20 mices, male and female half and half, give every mice intramuscular injection normal saline and relative medicine respectively, the administration volume is 0.1ml/10g, behind the single administration, observes each chmice acute toxic reaction.Each treated animal put to death half (male and female half and half) in 24 hours after administration, the main organs such as observing mouse core, liver, spleen, lung, kidney, adrenal gland, stomach, duodenum that become celestial have or not macroscopic pathological changes, if any then doing histopathologic examination.Remaining animal continues to observe, after administration the 14th day, the back of weighing is put to death animal and is become celestial, observe each mice main organs and have or not macroscopic pathological changes, if any then doing histopathologic examination, and administration group mice body weight change value and negative control group mice body weight value carried out the t check, judging has there was no significant difference.

Three, experimental result

The result shows that the mice intramuscular injection once gives recombinant interferon 150 μ g/kg of the present invention, is equivalent to 1000 times of human dosage, toxic reaction does not appear in mice, no abnormality seens such as in 14 days after the administration, each mice ingests, drinks water, activity, hair, defecation, also none dead mouse.The mice of putting to death and becoming celestial in 24 hours after the perusal administration, the result shows that each internal organs of mice do not have macroscopic pathological changes.The mice of after weighing in the 14th day after the administration, putting to death and becoming celestial, its each main organs does not all have macroscopic pathological changes yet, and administration group and negative control group mice body weight all increase to some extent, and its weight increase value and negative control group do not have significant difference (P＞0.05), the results are shown in following table.

Behind the recombinant interferon single administration of the present invention to the influence of mice body weight (X ± SD)

Four, experiment conclusion

Under this experimental condition, intramuscular injection recombinant interferon 150 μ g/kg mices of the present invention there is no toxic reaction.Therefore, the maximum tolerated dose of recombinant interferon intramuscular injection mice of the present invention is equivalent to 1000 times of human dosage greater than 150 μ g/kg.

Example 12

The test of recombinant interferon of the present invention (rSIFN-co) pharmacokinetics

For investigate human body to recombinant interferon of the present invention (rSIFN-co) in absorption by human body and metabolism situation, for the reference material of pharmacokinetics aspect is provided to clinical use this product, Sichuan Prov. Biological Engineering Research Centre has carried out the test of recombinant interferon of the present invention (rSIFN-co) pharmacokinetics in 2003 at Huaxi Hospital Attached to Sichuan Univ simultaneously.

One, inclusion criteria

1, signature Informed Consent Form;

2, general physical examination is normal, medical history and medication history Pass Test requirement;

3, the age: 20～30 years old male;

4, Body Mass Index (Body Mass Index=body weight (kilogram)/height (rice) in 20～27 scopes ²);

5, blood, urine, routine stool test and the heart, liver, kidney function test all belong to normal.

Two, exclusion standard

1, medicine, food anaphylaxis history person are arranged;

2, suffer from overweight patient before the test;

3, often medication, the person that has a liking for tobacco and wine;

4, psychotic;

5, participated in other medicines clinical trial person in 3 months;

6, used in 3 months known to the prejudicial medicine of certain internal organs or the person that uses the medicine at present;

7, there is other to influence factor persons such as drug absorption, distribution, metabolism and drainage.

Three, trial drug

Recombinant interferon of the present invention (rSIFN-co) is provided by Sichuan Prov. Biological Engineering Research Centre; The Infergen (interferon alfacon-1) that (Amgen) company produces is pacified into by the U.S..

Four, research method

The experimenter is divided into 2 groups.2 groups of experimenters test and accepted recombinant interferon 9 μ g of the present invention and Infergen 9 μ g subcutaneous injections the same day respectively in I clinical trial phase wards, and reach the blood sampling time point blood sampling 3ml that is scheduled to behind the injectable drug before injection is subjected to the reagent thing, take a blood sample altogether 14 times.Simultaneously, the doctor will carry out observing continuously in 48 hours, carry out multinomial lab testing, Electrocardioscopy before medication and after the medication on the 48th hour.

Five, result of study

Inject the different blood sampling time ratios of recombinant interferon of the present invention (rSIFN-co) and see accompanying drawing 11 than oligonucleotide concentration (2-5A concentration) with Infergen.By accompanying drawing 11 as can be known, recombinant interferon of the present invention (rSIFN-co) compares with Infergen, and recombinant interferon of the present invention (rSIFN-co) has the blood concentration peak twice, and its area under curve is greater than the area under curve of Infergen.Peak shape that Figure 11 demonstrates recombinant interferon of the present invention simultaneously and had and Infergen also inequality.

Example 13

Use the toxic and side effects and the body temperature of recombinant interferon of the present invention (rSIFN-co) to change research

The side reaction of existing interferons medicine is more, common reactant as: feel sick, muscular soreness, inappetence, alopecia, leukocyte and thrombocytopenia etc.

One, research method:

Choose two groups of experimenters of A, B.A group injection 9 μ g recombinant interferon of the present invention, B group injection 9 μ g Infergens.After the injection, clinical observation 48 hours.Inject and carry out the observed and recorded first time after 1 hour, after this once every 2 hours observed and recordeds.Situations such as that recorded content mainly comprises is weak, heating, whole body pain, drowsiness, anorexia and experimenter's body temperature.

Two, result of study:

The degree of most of untoward reaction is for slight and medium behind the injection rSIFN-co. and the symptom of similar influenza is modal in the side reaction as: headache, weak, fear of cold, myalgia, hyperhidrosis, arthralgia etc. and Infergen untoward reaction and side reaction are higher than recombinant interferon of the present invention. and what following table was listed is that 9 μ g recombinant interferon of the present invention contrasts record with 9 μ g Infergens injection back side reaction.

Routine number takes place in clinical experimenter's untoward reaction

Three, research conclusion

The record tabulation that routine number takes place by above clinical experimenter's untoward reaction as can be known, the side reaction of the side reaction behind the injection Infergen behind the injection recombinant interferon of the present invention.

Inject behind recombinant interferon of the present invention and the Infergen experimenter's body temperature situation of change and see accompanying drawing 12A-1,12A-2,12B-1,12B-2.

By accompanying drawing 12A-1,12A-2,12B-1,12B-2, can observe B group experimenter's body temperature and organize the experimenter apparently higher than A, prove that rSIFN-co has lower heating paresthesia and the degree of heat than Infergen.Simultaneously, recombinant interferon tolerance level of the present invention obviously is better than Infergen, and recombinant interferon of the present invention has better toleration.

Example 14

The clinical effectiveness of recombinant interferon of the present invention (rSIFN-co)

Recombinant interferon of the present invention (rSIFN-co) is mainly used in the treatment of viral disease, and stomatitis follicularis virus, herpes simplex virus, Measles virus, coronavirus, Epstein-Barr virus etc. are all had inhibitory action.Carry out antiviral activity with WISH cell/VSV system and detect, the result is respectively: homemade natural interferon is 0.9 * 108U/mg, and INTRON is 2.0 * 108U/mg, and rSIFN-co is 9 * 108U/mg, and its antiviral activity is apparently higher than the former two.

From in February, 2003, through state food and drug administration (SFDA) approval, do the clinical trial of the multicenter randomized control study treatment hepatitis B of recombinant interferon of the present invention (rSIFN-co) and Sai Nuojin (IFN-α 1b) in Huaxi Hospital Attached to Sichuan Univ, Hospital No.2 Affiliated to Chongqing Medical Univ., Zhejiang University Medical College The First Affiliated Hospital.Process of the test and result are as follows:

One, recombinant interferon of the present invention (rSIFN-co) compares with the curative effect of Sai Nuojin (IFN-α 1b) treatment chronic active hepatitis B

(1) inclusion criteria

Use rSIFN-co (9 μ g) identical, meet the 1-4 condition with the inclusion criteria of Sai Nuojin; Use the inclusion criteria of rSIFN-co (15 μ g), meet the 1-5 condition.

18～65 years old age;

The HBsAg lasting masculin is more than at least 6 months, the HBeAg positive, and at least PCR detects HBV-DNA 〉=105 copy numbers/ml in the screening phase;

ALT 〉=2 times normal value the upper limit (ULN);

Do not accept the anti-HBV treatment of interferon or accepted lamivudine therapy but invalid or recidivist before March;

Once adopted certain interferon (3MU or 5MU) to carry out before selected June by the SDA regulation course of treatment and the anti-HBV treatment of dosage, but invalid or recidivist.

(2) curative effect is judged

With reference to 2000 the tenth time national viral hepatitis and hepatopathy academic conference, whether recover normally according to following up a case by regular visits to when finishing Serum ALT levels, whether HBV-DNA turns out cloudy, and whether HBeAg serology conversion is taken place, and curative effect is divided into three grades:

Reply fully: ALT is normal again, the cloudy commentaries on classics of HBV-DNA, HBeAg serology take place transform

Part is replied: ALT is normal again, the cloudy commentaries on classics of HBV-DNA or HBeAg serology take place transform

No response: ALT is multiple normal, HBV-DNA cloudyly changes, HBeAg is cloudy changes

Wherein, reply fully with the part respondent and be judged as the produce effects case

Clinical therapeutic efficacy compares:

The curative effect comparison sheet of rSIFN-co and IFN-α 1b (Sai Nuojin) treatment chronic active hepatitis B

What test was carried out simultaneously therewith turns out to be the chronic active hepatitis B and used certain interferon (3MU or 5MU) to carry out by the SDA regulation course of treatment and the anti-HBV treatment of dosage through clinical with the rSIFN-co treatment, but patient's 13 examples invalid or recurrence, each 15 μ g subcutaneous injections, per 48 hours 1 time, injected for 24 weeks continuously.The treatment back is by the 12 week, the clinical produce effects of 7 examples (53.85%) patient is arranged in 13 examples, 0 routine s antigen turn out cloudy (0%) wherein, 3 routine e antigens turn out cloudy (23.08%), 3 routine HBe antibody transfer the positive (23.08%) to, 7 routine HBV-DNA turn out cloudy (53.85%), 11 routine liver power recoveries normal (84.62%).

(3) side reaction of rSIFN-co and Sai Nuojin relatively

The side reaction of interferons medicine is more, comprise heating, feel sick, muscular soreness, inappetence, alopecia, leukocyte and thrombocytopenia, the clinical maximum using dosage of IFN-α 1b is each 5MIU, conventional each 3MIU that uses, when adopting conventional using dosage, the clinical side reaction that has 90% patient to show I-II level (WHO clinical scale standard) approximately comprises slight heating below 38 ℃, feels sick, muscular soreness, inappetence etc.When adopting maximal dose, the incidence rate of side reaction does not have obvious rising, but various clinical symptoms degree obviously increases the weight of.

The clinical maximum using dosage of rSIFN-co is each 24 μ g, conventional each 9 μ g that use, the side reaction that the clinical patient that less than 50% arranged approximately shows I-II level (WHO clinical scale standard) when adopting routine dose comprises slight heating below 38 ℃, feels sick, muscular soreness, inappetence, leukocyte and platelet are slight reduces etc.Have 50% patient leukocyte to occur after 15 days and platelet slightly reduces when using maximal dose (＞2,000 ten thousand IU) approximately in medication, but 1 week of drug withdrawal the back leukocyte and platelet recovery normal, can continue medication safely.

Two, the observation of curative effect of recombinant interferon of the present invention (rSIFN-co) treatment hepatitis C

(1) inclusion criteria

1. 18～65 years old age;

2.HCV antibody lasting masculin;

3.ALT 〉=1.5 times of normal value upper limits (ULN), and continue more than 6 months.

(2) curative effect is judged

With reference to the criterion of Infergen treatment hepatitis C, whether recover normally according to following up a case by regular visits to when finishing Serum ALT levels, whether HCV-RNA turns out cloudy, and curative effect is divided into three grades:

Reply fully: ALT is normal again, the cloudy commentaries on classics of HCV-RNA

Part is replied: ALT is normal again, HCV-RNA is not cloudy changes

Multiple normal, the cloudy commentaries on classics of HCV-RNA of no response: ALT

Wherein, reply fully with the part respondent and be judged as the produce effects case.

(3) clinical therapeutic efficacy

With treatment hepatitis B test carry out simultaneously with rSIFN-co treatment hepatitis C patients 46 examples, each 9 μ g intramuscular injection per 48 hours 1 time, injected for 24 weeks continuously.Treatment back 26 patients have clinical effectiveness (56.52%), and wherein 12 routine HCV-RNA transfer feminine gender (26.09%) to, 26 routine liver power recoveries normal (56.52%).

Example 15

Recombinant interferon of the present invention (rSIFN-co) is used for the example of clinical therapy of tumor

The tumor class examining report list that patient 1 provides on July 14th, 2004 according to West China second hospital, change of serum C A-125＞600U/ml of an ovary gala adenocarcinoma patient, CA-153＞250U/ml, and detect the ascites of 2000ml, July 16, look in patient's ascites and see malignant cell and poorly differentiated adenocarcinoma cell, mammary gland is looked into and is seen cancerous cell and sphacelus simultaneously.This patient begins to accept rSFIN-co intramuscular injection treatment, July 14, and July 16, July 18, July 20 and injected the rSFIN-co of 15 μ g respectively on July 22, and accepted chemotherapy July 22.August 3, the patient accepts abdominal operation, according to clinical experience, estimates to have in the abdominal cavity ascites above 2000ml, but only detects the ascites of 200ml.August 4, the tissue slice inspection was a serous cystadenocarcinoma of ovary after the patient underwent surgery, the ovary left and right sides and lymph node canceration, and other organs are normal, and postoperative is treated in conjunction with chemotherapy with rSFIN-co, and mammary gland does not undergo surgery.The single change of serum C A-125 that shows of the tumor class audit report that December was provided on the 27th drops to 5U/ml, and CA-153 then is reduced to 13U/ml.The patient accepts PET on February 25th, 2005 at attached big level ground hospital of Third Military Medical University PET center and checks, the district is increased or lowers in report diagnosis demonstration patient's whole body and brain FDE-PET video picture no abnormality seen FDG metabolism, the mammary gland aura disappears, and returns to normal level fully, does not see and shifts and recurrence.Detailed diagnostics about this patient is reported the result, and sees also accompanying drawing 16A to 16H.

Use the tumor class examining report forms data contrast before and after the rSFIN-co treatment and the diagnostic result contrast of pathological replacement list by this ovary gala adenocarcinoma patient, provable: cancerous cell does not shift and recurs after imposing rSFIN-co and treating.

2 one patients of patient are diagnosed as after the renal carcinoma in the two weeks, have accepted the rSFIN-co injection of 3 times 9 μ g and the rSFIN-co of 3 times 15 μ g and have injected.Behind this two weeks, he accepts the rSFIN-co injection of 24 μ g every day, continues 45 days altogether.Through after the treatment of this course of treatment, renal biopsy shows that cancerous cell does not shift.The patient every half a year, accepts one month rSFIN-co intramuscular injection after carrying out the Comprehensive Treatment rehabilitation by modes such as operations again, injects altogether 15 times, and each 15 μ g, alive so far, do not see recurrence.

Example 16

One, the external anti-SARS virus test of novel gene recombinant interferon of the present invention (rSIFN-co)

One, experiment material:

1, medicine: novel gene recombinant interferon of the present invention, every 9 μ g.Sichuan Huiyang Life Science and Technology Corp. provides, lot number 20020501;

2, cell: African green monkey kidney cell (Vero E6) is provided by Molecular Biology Research Lab of Microbiology and Epidemic Disease Inst., Academy of Military-Medical Sciences (C;

3, virus: SARS virus, the BJ-01 strain is provided by Microbiology and Epidemic Disease Inst., Academy of Military-Medical Sciences (C Viral Laboratory;

4, cell culture fluid: the DMEM culture fluid that contains 10% hyclone.

Two, Shi Yan primary condition: virus is determined at three grades of laboratorys of bio-safety.

Three, experimental technique:

1, the CPE method is measured virus to Vero-E6 cell half toxic concentration (TCID50)

Vero E6 cell inoculation is in 96 orifice plates, and every hole 100 μ l contain 2 * 104/hole of cell, cultivates 24h for 37 ℃, and cell grows up to monolayer, adds the virus-culturing fluid of 9 concentration of 10 times of dilutions, every concentration 4 holes, and 37 ℃, the 5%CO2 incubator is cultivated.Use microscope observing cell pathological changes (CPE) every day.Cytopathy below 25% is being+, the 26-50% pathological changes is ++, the 51-75% pathological changes is +++, the 76-100% pathological changes is ++ ++.Record cytopathy degree (CPE).Calculate viral 50 3nfective dose (TCID50) with the Reed-Muench method.

2, the toxic mensuration of medicine pair cell:

Vero E6 cell inoculation is in 96 orifice plates, and every hole 100 μ l contain 2 * 104/hole of cell, cultivates 24h for 37 ℃, and cell grows up to monolayer.Medicine is established i.e. 36,18,9,4.5, the 2.259 μ g/ml (final concentration) of 5 concentration, every concentration 4 holes.If normal cell contrast.Observe administration group cytopathy every day, observe 5 days, determine the non-toxic concn of medicine.

3, the CPE method is measured the medicine antiviral activity:

Vero E6 cell inoculation is in 96 orifice plates, and every hole 100 μ l contain 2 * 104/hole of cell, cultivates 24h for 37 ℃, and cell grows up to monolayer.With 5 concentration of the medicine two-fold dilution below the maximal non-toxic concentration, add in the cell plates respectively, every hole 100 μ l, 37 ℃, the 5%CO2 incubator adds different dilution virus (10-3 respectively after cultivating 24h again, 10-4,10-5), co-cultivation 48-72h, observation of cell pathological changes CPE (cytopathy below 25% is being+, 26-50% is ++, 51-75% is +++, 76-100% is ++ ++, normal cell is-), each dilution factor is established 4 holes, and establishes the normal cell contrast, medicine contrast and different dilution factor (10-3,10-4, virus control 10-5), observe every day, when treating that the obvious pathological changes of cell appears in virus control, judge the effect of interferon anti-reflecting virus.Test repeats 1 time.Calculate the medium effective concentration IC50 of medicine with the Reed-Muench method.

Four, experimental result:

1, virus virulence is measured: the TCID50 of virus is 10-8.

2, the toxic mensuration of medicine pair cell: the non-toxic concn of recombinant interferon pair cell of the present invention is 18g/ml, and cellular morphology is identical with normal control under this concentration, pathological changes do not occur.

3, the antivirus action of medicine: result of the test sees Table 1 and table 2.

Table 1, recombinant interferon of the present invention are to the effect (experiment one) of SARS virus

Table 2, recombinant interferon of the present invention are to the effect (experiment two) of SARS virus

Five, conclusion:

The non-toxic concn of recombinant interferon pair cell of the present invention is 18g/ml.When virus concentration was 10-5 (1000TCID50), 10-4 (10000 TCID50) and 10-3 (100000 TCID50), the ICS0 of interferon was respectively 1.27,2.25 and 4.04 μ g/ml (table 3).

Table 3, interferon are to the medium effective concentration of variable concentrations virus

The viral dilution degree	IC50 g/ml
		10 -3	4.04
10 -4	2.25
		10 -5	1.27

Two, the external anti-SARS virus test of recombinant interferon of the present invention (rSIFN-co) and injection Interferon Alpha-2b

1. experiment material:

Medicine: recombinant interferon of the present invention, Sichuan Huiyang Life Science and Technology Corp. provides, 618 μ g/ml; Recombinant Interferon (injection Interferon Alfa-2b), Tianjin Hualida Biological Engineering Co., Ltd.'s product, 30 μ g/ prop up (3,000,000 IU/ of unit prop up), lot number 20030105.

Cell: African green monkey kidney cell (Vero E6) is provided by Molecular Biology Research Lab of Microbiology and Epidemic Disease Inst., Academy of Military-Medical Sciences (C;

Virus: SARS virus, the BJ01 strain is provided by Microbiology and Epidemic Disease Inst., Academy of Military-Medical Sciences (C Viral Laboratory;

The primary condition of experiment: virus is determined at three grades of laboratorys of bio-safety.

2. experimental technique:

2.1.CPE method is measured virus Vero E6 cell half is infected concentration (TCID50)

Vero E6 cell inoculation is in 96 orifice plates, and every hole 100 μ l contain 2 * 104/hole of cell, cultivates 24h for 37 ℃, and cell grows up to monolayer, adds the virus-culturing fluid of 9 concentration of 10 times of dilutions, and the cell contrast is established in every concentration 4 holes, and 37 ℃, the 5%CO2 incubator is cultivated.Use microscope observing cell pathological changes (CPE) every day.Cytopathy below 25% is being+, the 26-50% pathological changes is ++, the 51-75% pathological changes is +++, the 76-100% pathological changes is ++ ++.Record cytopathy degree.Calculate viral 50 3nfective dose (TCID50) with the Reed-Muench method.

2.2.MTT method is measured the half toxic concentration (TC50) of interferon pair cell:

Vero E6 cell inoculation is in 96 orifice plates, and every hole 100 μ l contain 2 * 104/hole of cell, cultivates 24h for 37 ℃, and cell grows up to monolayer.Supernatant is removed in suction, adds two kinds of interferon of different diluted concentrations respectively, and the cell contrast is established in every concentration 4 holes.Observe and add MTT dyeing 4h after 5 days, inhale and go liquid to add DMSO dissolving 0.5h, enzyme connection detector is measured the OD570nm absorption value, calculates TC50 with the Reed-Muench method.

2.3.MTT method is measured the antiviral activity of interferon:

Vero E6 cell inoculation is in 96 orifice plates, and every hole 100 μ l contain 2 * 104/hole of cell, cultivates 24h for 37 ℃, and cell grows up to monolayer.Medicine is from the downward 5 times of dilutions of maximal non-toxic concentration totally 5 concentration, every concentration 4 holes, add in the cell plates, every hole 100 μ l, 37 ℃, after the 5%CO2 incubator is cultivated 24h, inhale and remove interferon liquid, add different dilution viruses (10000,1000,100TCID50), each dilution factor adds 4 holes, and establish normal cell contrast, medicine contrast and different dilution factors (10000,1000, virus control 100TCID50), 37 ℃, 5%CO2 cultivates 48～72h, when treating that the obvious pathological changes of cell appears in virus control, record cytopathy result (cytopathy below 25% is being+, 26～50% are ++, 51～75% are +++, 76～100% are ++ ++, normal cell is-), the MTT staining is measured cytoactive, judges the effect of interferon anti-reflecting virus.Test repeats 3 times, calculates the medium effective concentration IC50 of medicine with the Reed-Muench method.

3. experimental result:

3.1. viral TCID50 measures: the TCID50 of SARS virus Vero E6 cell is 10-7.

3.2. interferon is to the mensuration of Vero E6 cell half toxic concentration (TC50): the non-toxic concn of recombinant interferon of the present invention is 100 μ g/ml, the non-toxic concn of injection Interferon Alfa-2b is 12.5 μ g/ml, and cellular morphology is identical with normal control under this concentration; The TC50 of recombinant interferon of the present invention is 139.18 μ g/ml, and the TC50 of injection Interferon Alfa-2b is 17.18 μ g/ml, the results are shown in Table 1.

Table 1, interferon are to Vero E6 cell half toxic concentration (TC50) measurement result

3.3. the antiviral activity of interferon is measured: two kinds of interferon all have a protection cell anti-SARS virus activity external, and three times experimental result sees Table 2, and therapeutic index (TI) the results are shown in Table 3.

Table 2, interferon anti-SARS virus determination of activity result

Table 3, interferon anti-SARS virus determination of activity result

4. conclusion:

Experiment in vitro shows that recombinant interferon of the present invention and injection Interferon Alfa-2b all have protective effect to Vero E6 cell, have the anti-SARS virus activity.Three measuring recombinant interferons of the present invention are respectively 0.92,0.18 and 0.10 μ g/ml to the half-inhibition concentration (IC50) of 10000,1000 and 100 TCID50 SARS virus, and therapeutic index is 151.28,773.32 and 1391.80; The injection Interferon Alfa-2b is respectively 4.75,1.16 and 0.28 μ g/ml to the half-inhibition concentration (IC50) of 10000,1000 and 100 TCID50 SARS virus, and therapeutic index is 3.62,14.78 and 61.36.

Importantly, more than two experiments (seeing above routine 11A and 11B) though all the anti-SARS using dosage of proof rSIFN-co be 1/5 of the Interferon Alpha-2b that uses clinically, its therapeutic index (TI) is 50 times of Interferon Alpha-2b.(seeing: recombinant interferon of the present invention and the external anti-SARS virus of injection Interferon Alpha-2b test-Microbiology and Epidemic Disease Inst., Academy of Military-Medical Sciences (C)

Existing 30,000 rSIFN-co sprays are used for a line nurse, doctor and the high-risk group in Sichuan Province, and none nurse of Sichuan Province and doctor infect SARS as a result.

Example 17

Recombinant interferon of the present invention (rSIFN-co) is tested the influenza virus inhibitory action

Detect the inhibition of recombinant interferon of the present invention (rSIFN-co) with cytopathic-effect inhibition assay to influenza virus.

One, experiment material

10 age in days chick embryo allantois theca cells are provided for oneself

Recombinant interferon of the present invention Sichuan Prov. Biological Engineering Research Centre

Influenza virus

DMEM GIBCO

Newborn calf serum Lanzhou Ming Hai life

96 porocyte culture plate NUNC

CO ₂Incubator

Clean bench

Be inverted the photograph biological microscope

Two, experimental technique

In 10 age in days chick embryo allantois theca cells of exponential phase, with 0.25% trypsinization collecting cell, tongue is expected blue dyeing counting, and transferring cell concentration with DMEM is that 2.5 * 105/ml is standby.

In 96 porocyte culture plates, add above-mentioned cell suspension 100 μ l/ holes, put 37 ℃, 5%CO ₂Cultivate, promptly be grown to monolayer next day.

Abandon supernatant, every hole adds the variable concentrations recombination high efficiency compound interferon 100 μ l/ holes of diluting through in advance, establishes noiseless plain contrast and cell contrast simultaneously.Put 37 ℃, 5%CO ₂Cultivate about 18～20Hr.

Experimental port and noiseless plain control wells, every hole all add the variable concentrations influenza virus liquid 100 μ l/ holes of diluting through in advance, and cell control well does not add viral liquid DMEM 100 μ l/ holes, only add and put 37 ℃, 5%C0 ₂Cultivate about 24Hr.

Be inverted the photograph of photograph biology microscope sem observation after cultivating 24Hr.

Three, experimental result

Mirror is observed down and is found that obvious cytopathy feature appears in noiseless plain matched group porocyte, as the garden contract, refractivity descends, companion's obscission etc.; And the experimental port cell is when recombination high efficiency compound interferon concentration 〉=10ng/ml, then acellular characteristics of lesion; The cell control well cell does not have the pathological changes feature.See accompanying drawing 13.

Four, experiment conclusion

Recombinant interferon of the present invention (rSIFN-co) can suppress influenza virus to the chick chorioallantoic membrane cell infection.RSIFN-co has fabulous inhibitory action to influenza virus.

Example 18

Recombinant interferon of the present invention (rSIFN-co) is tested Ebola virus (Ebola) inhibitory action

The Ebola virus zaire virus can cause serious hemorrhagic fever, and very high mortality rate is arranged, and does not still have effective treatment means at present.

One, experiment material

1, experimental animal: BALB/c mouse, 60.

2, test drug: recombinant interferon of the present invention (rSIFN-co) is provided by Sichuan Prov. Biological Engineering Research Centre.

Two, experimental technique

With 60 BALB/c mouse random packet, every group 10, totally 6 groups, be respectively behind the viral infection same day, the 1st, the 2nd, the 3rd, the 4th day beginning administration recombinant interferon group of the present invention and matched group, be numbered for successively above group: group 1, group 2, group 3, group 4, group 5, group 6. is given every injected in mice Ebola virus respectively. and the the the 1st, the 2nd, the 3rd, the 4th day begins to give respectively to organize 1 behind the injection Ebola virus same day and injecting virus, group 2, group 3, group 4, organize 5 administration rSIFN-co, administering mode, subcutaneous injection, dosage, 1 μ g, successive administration 6 days.

Three, experimental result

The result shows, all control group mice are died from Ebola virus and infected, and all behind injecting virus the same day and the 1st, the 2nd day administration rSIFN-co mice all survive, do not observe toxic reaction.The the 3rd, the 4th talent beginning administration rSIFN-co behind injecting virus, then medicine does not have complete protective effect.

Example 19

Recombinant interferon of the present invention (rSIFN-co) is tested the HIV (human immunodeficiency virus) (Human Immunodeficiency Virus) inhibitory action

One, experiment material

Wild-type HIV (wildness HIV virus)

Drug Resistant HIV (variation drug-resistant HIV)

The 293-CD4-CCR5 cell

DMEM GIBCO

Hyclone GIBCO

Recombinant interferon of the present invention Sichuan Prov. Biological Engineering Research Centre

96 porocyte culture plate NUNC

CO ₂Incubator

Clean bench

Spectrofluorophotometer

Ultraviolet spectrophotometer

Two, experimental technique

Get the 293-CD4-CCR5 cell that is in exponential phase, with 0.25% trypsinization collecting cell, tongue is expected blue dyeing counting, and transferring cell concentration with DMEM is that 2.0 * 105/ml is standby.

In 96 porocyte culture plates, add above-mentioned cell suspension 100 μ l/ holes, put 37 ℃, 5%CO ₂Cultivate, inferior day growth reaches about 70% of hole floor space.

Abandon supernatant, every hole adds variable concentrations recombination high efficiency compound interferon 100 μ 1/ hole of diluting through in advance, establishes noiseless plain contrast (PBS contrast) simultaneously. and cell contrast (nutritional solution contrast).Put 37 ℃, 5%CO ₂Cultivate about 18～20Hr.

Experimental port and noiseless plain control wells add respectively through the type wild type HIV and the drug-resistant HIV liquid 100 μ l/ holes of variable concentrations of dilution in advance, and cell control well does not add viral liquid and only adds DMEM 100 μ l/ holes, puts 37 ℃, 5%CO ₂Cultivate about 24Hr.

Detect relevant worm fluorescin enzymatic activity routinely.Measure the protein concentration of cell breakage supernatant simultaneously, uciferase activity is represented with RLU/mg.

Three, experimental result

With the uciferase activity that is detected is vertical coordinate, and recombinant interferon concentration of the present invention is abscissa, makes the bar diagram analyzing and processing with EXCEL software.The experimental group uciferase activity is starkly lower than PBS and nutritional solution matched group when finding recombinant interferon concentration of the present invention 〉=4ng/ml, and is dose-dependence.Result of the test is seen accompanying drawing 14-A, 14-B.

Recombinant interferon anti-hiv activity measurement result of the present invention

Four, experiment conclusion

Recombinant interferon of the present invention (rSIFN-co) has fabulous inhibitory action to wildness HIV virus and variation drug-resistant HIV.

Sequence table

＜110〉Huiyang Tech USA Inc.

Sichuan Prov. Biological Engineering Research Centre

＜120〉a kind of interferon and application thereof

<130>FI-0500-59

<160>11

<170>PatentIn version 3.2

<210>1

<211>504

<212>DNA

<213>Artificial

<220>

＜223〉nucleotide sequence of the aminoacid sequence of a kind of known total interferon of coding (Infergen)

<400>1

atgtgcgacc tgccgcagac ccactccctg ggtaaccgtc gtgctctgat cctgctggct 60

cagatgcgtc gtatctcccc gttctcctgc ctgaaagacc gtcacgactt cggtttcccg 120

caggaagaat tcgacggtaa ccagttccag aaagctcagg ctatctccgt tctgcacgaa 180

atgatccagc agaccttcaa cctgttctcc accaaagact cctccgctgc ttgggacgaa 240

tccctgctgg aaaaattcta caccgaactg taccagcagc tgaacgacct ggaagcttgc 300

gttatccagg aagttggtgt tgaagaaacc ccgctgatga acgttgactc catcctggct 360

gttaaaaaat acttccagcg tatcaccctg tacctgaccg aaaaaaaata ctccccgtgc 420

gcttgggaag ttgttcgtgc tgaaatcatg cgttccttct ccctgtccac caacctgcag 480

gaacgtctgc gtcgtaaaga ataa 504

<210>2

<211>167

<212>PRT

<213>Artificial

<220>

＜223〉aminoacid sequence of a kind of total interferon (Infergen)

<400>2

Met Cys Asp Leu Pro Gln Thr His Ser Leu Gly Asn Arg Arg Ala Leu

1 5 10 15

Ile Leu Leu Ala Gln Met Arg Arg Ile Ser Pro Phe Ser Cys Leu Lys

20 25 30

Asp Arg His Asp Phe Gly Phe Pro Gln Glu Glu Phe Asp Gly Asn Gln

35 40 45

Phe Gln Lys Ala Gln Ala Ile Ser Val Leu His Glu Met Ile Gln Gln

50 55 60

Thr Phe Asn Leu Phe Ser Thr Lys Asp Ser Ser Ala Ala Trp Asp Glu

65 70 75 80

Ser Leu Leu Glu Lys Phe Tyr Thr Glu Leu Tyr Gln Gln Leu Asn Asp

85 90 95

Leu Glu Ala Cys Val Ile Gln Glu Val Gly Val Glu Glu Thr Pro Leu

100 105 110

Met Asn Val Asp Ser Ile Leu Ala Val Lys Lys Tyr Phe Gln Arg Ile

115 120 125

Thr Leu Tyr Leu Thr Glu Lys Lys Tyr Ser Pro Cys Ala Trp Glu Val

130 135 140

Val Arg Ala Glu Ile Met Arg Ser Phe Ser Leu Ser Thr Asn Leu Gln

145 150 155 160

Glu Arg Leu Arg Arg Lys Glu

165

<210>3

<211>507

<212>DNA

<213>Artificial

<220>

＜223〉nucleotide sequence of a kind of rSIFN-co that encodes

<400>3

atgtgtgatt tacctcaaac tcattctctt ggtaaccgtc gcgctctgat tctgctggca 60

cagatgcgtc gtatttcccc gtttagctgc ctgaaagacc gtcacgactt cggctttccg 120

caagaagagt tcgatggcaa ccaattccag aaagctcagg caatctctgt actgcacgaa 180

atgatccaac agaccttcaa cctgttttcc actaaagaca gctctgctgc ttgggacgaa 240

agcttgctgg agaagttcta cactgaactg tatcagcagc tgaacgacct ggaagcatgc 300

gtaatccagg aagttggtgt agaagagact ccgctgatga acgtcgactc tattctggca 360

gttaaaaagt acttccagcg tatcactctg tacctgaccg aaaagaaata ttctccgtgc 420

gcttgggaag tagttcgcgc tgaaattatg cgttctttct ctctgtctac taacctgcag 480

gagcgtctgc gccgtaaaga ataatag 507

<210>4

<211>108

<212>DNA

<213>Artificial

<220>

＜223〉be used for PCR and synthesize 5 ' of rSIFN-co-segmental forward primer of end 280bp

<400>4

atgtgcgacc tgccgcagac ccactccctg ggtaaccgtc gtgctctgat cctgctggct 60

cagatgcgtc gtatctcccc gttctcctgc ctgaaagacc gtcacgac 108

<210>5

<211>108

<212>DNA

<213>Artificial

<220>

＜223〉be used for synthetic rSIFN-co cDNA 5 '-segmental template of end 280bp

<400>5

ctgaaagacc gtcacgactt cggtttcccg caggagaggt tcgacggtaa ccagttccag 60

aaagctcagg ctatctccgt tctgcacgaa atgatccagc agaccttc 108

<210>6

<211>103

<212>DNA

<213>Artificial

<220>

＜223〉be used for PCR and synthesize 5 ' of rSIFN-co-segmental reverse primer of end 280bp

<400>6

gctgctggta cagttcggtg tagaattttt ccagcaggga ttcgtcccaa gcagcggagg 60

agtctttggt ggagaacagg ttgaaggtct gctggatcat ttc 103

<210>7

<211>103

<212>DNA

<213>Artificial

<220>

＜223〉be used for PCR and synthesize 3 ' of rSIFN-co-segmental forward primer of end 268bp

<400>7

atccctgctg gaaaaattct acaccgaact gtaccagcag ctgaacgacc tggaagcttg 60

cgttatccag gaagttggtg ttgaagaaac cccgctgatg aac 103

<210>8

<211>106

<212>DNA

<213>Artificial

<220>

＜223〉be used for PCR and synthesize 3 ' of rSIFN-co-segmental reverse primer of end 268bp

<400>8

gaagaaaccc cgctgatgaa cgttgactcc atcctggctg ttaaaaaata cttccagcgt 60

atcaccctgt acctgaccga aaaaaaatac tccccgtgcg cttggg 106

<210>9

<211>112

<212>DNA

<213>Artificial

<220>

＜223〉be used for PCR and synthesize 3 ' of rSIFN-co-segmental template of end 268bp

<400>9

ttattcttta cgacgcagac gttcctgcag gttggtggac agggagaagg aacgcatgat 60

ttcagcacga acaacttccc aagcgcacgg ggagtatttt ttttcggtca gg 112

<210>10

<211>31

<212>DNA

<213>Artificial

<220>

＜223〉be used for rSIFN-co 5 '-section 280bp fragment and primer that rSIFN-co 3 '-section 268bp fragment couples together

<400>10

atcggccata tgtgcgacct gccgcagacc c 31

<210>11

<211>40

<212>DNA

<213>Artificial

<220>

＜223〉be used for rSIFN-co 5 '-section 280bp fragment and primer that rSIFN-co 3 '-section 268bp fragment couples together

<400>11

actgccaggc tgcagttatt ctttacgacg cagacgttcc 40

Claims (9)

1. a recombinant interferon is used for the treatment of application in the medicine of viral disease in preparation, wherein said recombinant interferon has the aminoacid sequence shown in the sequence 2 in the sequence table, and it has the space conformation different with Infergen, and described Infergen has the aminoacid sequence shown in the sequence 2 in the sequence table equally; Described recombinant interferon is to prepare by the method that comprises the following steps:

(a) DNA sequence shown in sequence in the sequence table 1 or 3 is introduced in the suitable expression and described DNA sequence is placed under the control of suitable promoter;

(b) carrier that step (a) is made up is introduced the host, and expresses under suitable expression condition, obtains inclusion body;

(c) collect and inclusion body that purification step (b) obtains;

(d) inclusion body that step (c) is obtained carries out degeneration and renaturation; And

(e) product after the renaturation is dialysed and ion chromatography successively;

Described recombinant interferon is in intramuscular injection after to give the body weight index be human body in the 20-27 scope, to the 2-5A oligonucleotide enzyme concentration in experimenter's body serum mapping, the peak area under the gained curve is significantly penetrated the peak area under the curve that Infergen obtains greater than making a bet in identical conditions with blood sampling time;

Wherein

Described viral disease is selected from the disease that Ebola virus causes, disease or the acquired immune deficiency syndrome (AIDS) that influenza virus causes.

2. application according to claim 1, the DNA sequence shown in the sequence 1 or 3 in the wherein said sequence table places P _BADUnder the control of promoter.

3. application according to claim 1 and 2, wherein said expression vector is pHY-5.

4. application according to claim 1 and 2, wherein said host is escherichia coli.

5. application according to claim 1 and 2, wherein said ion chromatography steps in sequence comprises HS cation chromatography and copper ion chromatography.

6. application according to claim 1 and 2, the preparation method of wherein said recombinant interferon also further comprise the lyophilizing step of the interferon of purification.

7. application according to claim 1 and 2, the curve of wherein said recombinant interferon are bimodal curve.

8. application according to claim 1 and 2, the circular dichroism spectra of wherein said recombinant interferon in the 190-250nm scope significantly is different from the circular dichroism spectra of the Infergen that records under similarity condition.

9. application according to claim 1 and 2, the external pharmacodynamics of wherein said recombinant interferon show the dna replication dna that it can not only suppress hepatitis B virus and can also suppress hepatitis B virus surface antigen and the antigenic secretion of e.

Images