WO2020108428A1 - Recombinant human antiviral cytokine and preparation method therefor, composition thereof and use thereof - Google Patents

Abstract

Provided by the present invention are a recombinant human antiviral cytokine and a preparation method therefor, a composition thereof and a use thereof. The recombinant human antiviral cytokine has an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.2. The recombinant human antiviral cytokine according to the present invention may have significantly higher biological activity and stability while maintaining topnotch safety and efficacy.

Description

Recombinant human antiviral cytokine and its preparation method, composition and use Technical field

The invention belongs to the technical field of biotechnology medicines, and relates to recombinant human antiviral cytokines, preparation methods, compositions and uses thereof.

Background technique

Interferon (interferon, IFN) is a class of cytokine protein drugs with broad-spectrum antiviral, antitumor, and immunomodulatory effects, including type I, type II, and type III, which have different receptors and functions, respectively, are A key component of the body's natural immune system. Among them, type I IFN was discovered in 1957. It is an important antiviral substance produced by humans and animals after being infected by viruses. According to the difference of its genes and protein structures, it is divided into IFN-α, IFN-β, IFN-ε, and IFN- κ, IFN-ω, etc. Three subtypes of IFN-α have been approved for clinical use, namely IFN-α1b, IFN-α2a and IFN-α2b, all of which are currently genetically recombinant products. The IFN-α used abroad is mainly IFN-α2a and IFN-α2b, and its genes are derived from Western white people; the IFN-α used domestically is mainly IFN-α1b, and its genes are used by Chinese academician Hou Yunde in 1982 from healthy Chinese Obtained from cord blood leukocytes. Many years of research by the Institute of Virology, Chinese Academy of Preventive Medicine, showed that after being attacked by viruses, Chinese human leukocytes produced IFN-α1b interferon as the main type of interferon. Therefore, compared with similar products at home and abroad, genetically engineered IFN-α1b has the advantages of significant curative effect (the same obvious efficiency as foreign products), lower side effects, and difficulty in producing neutralizing antibodies. It is more suitable for Chinese people to use.

IFN-α1b injection is my country's first genetic engineering class I new drug with independent intellectual property rights. It has been widely used in the domestic antiviral field for more than 20 years, and has accumulated a large number of literature reports and clinical experience. Data from multiple multi-center clinical studies have shown that IFN-α1b is effective in treating respiratory syncytial virus (RSV) pneumonia, bronchiolitis, hand, foot and mouth disease (HFMD), and viral enteritis, with mild adverse reactions. "People's Republic of China Pharmacopoeia 2015 Edition (Part III)" contains recombinant human interferon α1b injection. The indications are viral diseases and certain malignant tumors. It is mainly used to treat chronic hepatitis B, chronic hepatitis C and hairy cell leukemia Wait. In addition, recombinant human interferon α1b is effective against condyloma acuminatum, chronic cervicitis, herpes keratitis, herpes zoster, epidemic hemorrhagic fever, and respiratory syncytial virus pneumonia in children. It is effective against other viral diseases and malignancies Tumors such as chronic myeloid leukemia, melanoma, and lymphoma also have good curative effects.

Compared with other types of interferon, IFN-α1b has less clinical adverse reactions, so it has achieved good results in the field of pediatric medicine and is one of the few preferred products available in the same category. A large amount of pediatric clinical medication experience and multi-center research data show that IFN-α1b given by intramuscular injection and inhalation of the respiratory tract has an important role in the treatment of viral infections in children, especially inhalation of IFN-α1b to treat viral infections, drugs It can directly act on the respiratory tract mucosa, has the advantages of strong targeting, high efficacy, good safety, easy operation, high compliance of children, etc., and can reach the lungs through bronchi and bronchioles, more concentrated in lung tissue, slow Blood transfusion is more durable than intramuscular administration. Therefore, inhaled IFN-α1b has been recommended for use by the National Standard Formulary "Guidelines for Standardized Management of Children's Atomization Center".

However, IFN-α1b has low specific activity and poor stability, which limits its further clinical application.

Summary of the invention

The primary object of the present invention is to provide a recombinant human antiviral cytokine, which can have significantly higher biological activity and stability than IFN-α1b on the basis of maintaining good safety and efficacy of IFN-α1b.

To achieve this objective, in a basic embodiment, the present invention provides a recombinant human antiviral cytokine having the amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

The recombinant human antiviral cytokine of the present invention has 93% amino acid homology with interferon α1b (IFN-α1b) and 85% amino acid homology with interferon α2b (IFN-α2b).

The second object of the present invention is to provide a polynucleotide encoding the aforementioned recombinant human antiviral cytokine to better encode the aforementioned recombinant human antiviral cytokine. On the basis of maintaining the good safety and efficacy of IFN-α1b, it has significantly higher biological activity and stability than IFN-α1b.

To achieve this objective, in a basic embodiment, the present invention provides a polynucleotide encoding the aforementioned recombinant human antiviral cytokine.

The third object of the present invention is to provide a method for preparing the aforementioned recombinant human antiviral cytokine to better prepare the aforementioned recombinant human antiviral cytokine, and the prepared recombinant human antiviral cytokine can maintain IFN -α1b has significantly higher biological activity and stability than IFN-α1b based on its good safety and efficacy.

To achieve this objective, in a basic embodiment, the present invention provides a method for preparing the aforementioned recombinant human antiviral cytokine, the method includes the following steps:

(1) Construction of recombinant human antiviral cytokine expression engineering bacteria;

(2) Fermentation of recombinant human antiviral cytokine expression engineering bacteria and separation and purification by chromatography (chromatography).

The fourth object of the present invention is to provide a pharmaceutical composition of the aforementioned recombinant human antiviral cytokine, which can compare with IFN-α1b medicine while maintaining the good safety and efficacy of the IFN-α1b pharmaceutical composition The composition has significantly higher biological activity and stability.

To achieve this objective, in a basic embodiment, the present invention provides a pharmaceutical composition of the aforementioned recombinant human antiviral cytokine, the pharmaceutical composition containing a therapeutically effective amount and a safe amount of the recombinant human antiviral Cytokines and a suitable amount of pharmaceutically acceptable carrier.

The fifth object of the present invention is to provide the use of the aforementioned recombinant human antiviral cytokine or pharmaceutical composition thereof in the preparation of a medicament for preventing or treating viral infectious diseases.

To achieve this objective, in a basic embodiment, the present invention provides the use of the aforementioned recombinant human antiviral cytokine or pharmaceutical composition thereof in the preparation of a medicament for the prevention or treatment of viral infectious diseases.

In a preferred embodiment, the present invention provides the use of the aforementioned recombinant human antiviral cytokine or pharmaceutical composition thereof in the preparation of a medicament for preventing or treating viral infectious diseases, wherein the viral infectious diseases are Japanese encephalitis, respiratory syncytial virus infection, or viral hepatitis.

The term "therapeutically effective amount and safe amount" used in the present invention means that when a pharmaceutical active ingredient is administered for the treatment or prevention of a disease, the amount of the pharmaceutical active ingredient is sufficient to achieve treatment or prevention of the disease without causing significant toxic side effects. The therapeutically effective amount and safe amount will vary depending on the active ingredient of the drug, the disease and its severity, and the age and weight of the patient being treated.

The beneficial effect of the present invention is that the recombinant human antiviral cytokine of the present invention can have significantly higher biological activity and stability than IFN-α1b on the basis of maintaining good safety and drug efficacy of IFN-α1b.

detailed description

The implementation of the present invention will be further described by the following examples, but the embodiments of the present invention are not limited to the following examples.

Example 1: Construction and expression sequence confirmation of recombinant human antiviral cytokine 1 expression engineering bacteria

The corresponding nucleic acid template is synthesized according to SEQ ID NO.1 of the sequence table, and a sufficient amount of nucleic acid is amplified by PCR.

The primers for the amplification reaction system are:

F: CATATGTGCGACCTGCCTCAAACTCA(SEQ ID NO.3)

R: CTCGAGTTAGCGTTCCTGCAGG(SEQ ID NO.4)

The amplification reaction system includes: dNTP 1μl, 10X pfu buffer 5μl, upstream and downstream primers 2μl, customer template 1μl, Pfu enzyme 0.4μl (5u/μl), ddH2O 38.6μl.

The amplification reaction conditions are: 95°C, 3 minutes, 95°C, 22 seconds, 68°C, 20 seconds, 72°C, 60 seconds, 72°C, 5 minutes. A total of 24 cycles. After the reaction is completed, it is separated by agarose gel electrophoresis, double digested with Nde I/Xho I, and the target DNA fragment of about 500 bp is recovered by electrophoresis.

The pET30a plasmid vector was double digested with Nde I/Xho I, recovered by agarose electrophoresis and ligated with the above-mentioned recovered DNA fragment. The ligation reaction conditions were: seamless cloning mixture, 8.5 μl, digested vector pET30a, 4 μl, purified PCR product, 7.5 μl. The above ligation mixture was placed in the PCR instrument at 37°C for 1 h.

Escherichia coli BLD21 competent cells were prepared, the above ligation products were transformed, coated with ampicillin plates, and cultured overnight at 37°C.

Pick a single colony as a template, and use the above designed primers F and R to amplify. The product was detected by agarose electrophoresis. The positive clone showed a specific band at about 486bp; take a small amount of positive clones for cultivation and extract the plasmid with Nde I/Xho I double digestion. Specific bands appeared at about 3kb and about 500bp, respectively, which was in line with the expected situation, and preliminary showed that the recombinant plasmid was successfully constructed. To further confirm its sequence, the ABI377 sequencer was sequenced fully automatically using T7 universal primers.

Example 2: Fermentation, purification and detection of recombinant human antiviral cytokine 1

The recombinant human antiviral cytokine 1 expression engineered bacteria constructed in the foregoing Example 1 was plated and activated, and single colonies were selected and inoculated into LB medium containing kanamycin with a final concentration of 30 μg/mL. 10g of peptone, 5g of yeast powder and 10g of NaCl were adjusted to adjust the pH to 7.0), and cultured in a shaker shaker at 37°C and 220 rpm to OD600nm of 0.6-0.8. Then inoculate 5% volume in 50L LB medium in 80L fermentor to carry out fermentation culture (containing 30μg/mL kanamycin), the culture temperature is 37℃, during the cultivation process, the pH is adjusted with ammonia Between 6.5 and 7.5, the dissolved oxygen value is controlled between 3-5% with the speed of rotation. After OD600nm reaches 1.0, add IPTG 10g according to the mass volume ratio of 1:5000 and continue the induction culture for 4 hours, the induction culture temperature is 37 ℃, and add LB medium to the fermentor during this process. After the induction culture time is reached, the cells are collected at a room temperature of 5000 rpm/separation center for 20 minutes. The resulting cells are washed with TE buffer (50mmol/L Tris-HCl, 5mmol/L EDTA, pH 8.0) and centrifuged twice to remove fermentation The main impurities in the liquid.

Take 40g of the bacterial cells obtained by the above treatment at a mass volume ratio of 1:15, add 600ml TE buffer solution and place it on the ultrasonic disruptor for ultrasonic disruption, the conditions are 5 seconds, 5 seconds rest, a total of 60 minutes, the resulting crushed liquid is 12,000 rpm at room temperature / Separate the core and discard the supernatant for 20 minutes. The precipitate was added with TE buffer at a mass volume ratio of 1:10, washed and centrifuged twice to separate the inclusion bodies.

The obtained 10g inclusion body was added into the inclusion body dissolution solution (8mol/L urea, 50mmol/L Tris-HCl, 300mmol/L NaCl, pH 8.0) at a mass volume ratio of 1:10 and then denatured for 2 hours under moderate stirring conditions After the inclusion body is completely dissolved, the precipitate is discarded at room temperature 12,000 rpm/separation core for 20 minutes, and the supernatant is renatured by dilution renaturation method. The composition of the renaturation solution is: 0.15mol/L sodium borate buffer, 3mmol/L oxidized Glutathione, 1mmol/L reduced glutathione, adjust the pH to 9.5. The renaturation process is carried out in a low temperature cold storage at 2-8°C. First, the supernatant is diluted 4 times with the renaturation solution, and after standing for 8 hours, it is then diluted 5 times with the renaturation solution to continue the renaturation for 6 hours.

After the dialysis, the renaturation solution was subjected to 12000 rpm at 4°C for 30 minutes, and then applied to a DEAE Sepharose FF column equilibrated with 25mmol/L Tris-HCl pH 8.0 solution. After loading the sample, first flush the column with equilibration buffer for 2-3 column volumes, and then elute with 25mmol/L Tris-HCl pH8.0 solution containing 0.3mol/L NaCl to collect the elution peak. The linear flow rate during the above loading, rinsing and elution should be controlled between 50-200cm/h.

The DEAE Sepharose FF elution peak was diluted with a 50 mmol/L acetic acid-sodium acetate pH 4.5 buffer at a volume ratio of 1:10, and then applied to a CM Separate FF column equilibrated with the same buffer. After the sample loading is completed, the chromatographic column is continuously rinsed with 2-3 column volumes, and then the main impurity peak is eluted with 25mmol/L acetic acid-sodium acetate pH4.5 buffer containing 0.1-0.15mol/L NaCl Then elute with 25mmol/L acetic acid-sodium acetate pH4.5 buffer containing 0.5mol/L NaCl to collect the target peak. The linear flow rate during the above loading, rinsing and elution should be controlled between 50-200cm/h.

The purity of recombinant human antiviral cytokine 1 separated by the above CM Sepharose FF column was detected by SDS-PAGE electrophoresis plus Coomassie brilliant blue staining method and size exclusion HPLC method, and the results were all above 97%. Using the "Interferon Activity Assay" and "Protein Assay" prescribed in the "People's Republic of China Pharmacopoeia 2015 Edition (Part Three)" to determine its specific activity is 3.64×10 ⁷ IU/mg, the specific activity of the control IFN-α1b is 1.32×10 ⁷ IU/mg, the former is about 2.8 times that of the latter.

Example 3: Construction of recombinant human antiviral cytokine 2 expression engineering bacteria and confirmation of expression sequence

According to SEQ ID NO. 2 of the sequence table, the corresponding nucleic acid template is synthesized, and a sufficient amount of nucleic acid is amplified by PCR.

The primers for the amplification reaction system are:

F: CATATGATGGTTTCTACCTGC(SEQ ID NO.5)

R: CTCGAGCGTGAACAGCTTAACT(SEQ ID NO.6)

The amplification reaction system includes: dNTP 1μl, 10X pfu buffer 5μl, upstream and downstream primers 2μl, customer template 1μl, Pfu enzyme 0.4μl (5u/μl), ddH2O 38.6μl.

The amplification reaction conditions are: 95°C, 3 minutes, 95°C, 22 seconds, 68°C, 20 seconds, 72°C, 60 seconds, 72°C, 5 minutes. A total of 24 cycles. After the reaction is completed, it is separated by agarose gel electrophoresis, double digested with Nde I/Xho I, and the target DNA fragment of about 500 bp is recovered by electrophoresis.

The pET30a plasmid vector was double digested with Nde I/Xho I, recovered by agarose electrophoresis and ligated with the above-mentioned recovered DNA fragment. The ligation reaction conditions were: seamless cloning mixture, 8.5 μl, digested vector pET30a, 4 μl, purified PCR product, 7.5 μl. The above ligation mixture was placed in the PCR instrument at 37°C for 1 h.

Escherichia coli BLD21 competent cells were prepared, the above ligation products were transformed, coated with ampicillin plates, and cultured overnight at 37°C.

Pick a single colony as a template and use the primers F and R designed above to amplify. The product was detected by agarose electrophoresis. The positive clones showed specific bands around 495bp; take a small amount of positive clones for cultivation and extract the plasmid with Nde I/Xho I double digestion. Specific bands appeared at about 3kb and about 500bp, respectively, which was in line with the expected situation, and preliminary showed that the recombinant plasmid was successfully constructed. To further confirm its sequence, the ABI377 sequencer was sequenced fully automatically using T7 universal primers.

Example 4: Fermentation, purification and detection of recombinant human antiviral cytokine 2

The recombinant human antiviral cytokine 2 expression engineered bacteria constructed in the foregoing Example 3 was activated by plating, and single colonies were selected and inoculated into LB medium containing kanamycin with a final concentration of 30 μg/mL (per liter). Peptone 10g, yeast powder 5g, NaCl 10g, adjusted pH 7.0), 37 ℃, 230 rpm shaker shake flask culture to OD600nm 0.6-0.8. Then inoculate 5% volume in 50L LB medium in 80L fermentor to carry out fermentation culture (containing 30μg/mL kanamycin), the culture temperature is 37℃, during the cultivation process, the pH is adjusted with ammonia Between 6.5 and 7.5, the dissolved oxygen value is controlled between 3-5% with the speed of rotation. After OD600nm reaches 1.0, add IPTG 10g according to the mass volume ratio of 1:5000 to continue the induction culture for 4.5 hours, the induction culture temperature is 37 ℃, and add LB medium to the fermentor during this process. After the induction culture time is reached, the cells are collected at a room temperature of 5000 rpm/separation center for 20 minutes. The resulting cells are washed with TE buffer (50mmol/L Tris-HCl, 5mmol/L EDTA, pH 8.0) and centrifuged twice to remove fermentation The main impurities in the liquid.

Take 40g of the bacterial cells obtained by the above treatment at a mass volume ratio of 1:15, add 600ml TE buffer solution and place it on the ultrasonic disruptor for ultrasonic disruption, the conditions are 5 seconds, 5 seconds rest, a total of 60 minutes, the resulting crushed liquid is 12,000 rpm at room temperature / Separate the core and discard the supernatant for 20 minutes. The precipitate was added with TE buffer at a mass volume ratio of 1:10, washed and centrifuged twice to separate the inclusion bodies.

The obtained 10g inclusion body was added into the inclusion body dissolution solution (8mol/L urea, 50mmol/L Tris-HCl, 300mmol/L NaCl, pH 8.0) at a mass volume ratio of 1:10 and then denatured for 2 hours under moderate stirring conditions After the inclusion body is completely dissolved, the precipitate is discarded at room temperature 12,000 rpm/separation core for 20 minutes, and the supernatant is renatured by dilution renaturation method. The composition of the renaturation solution is: 0.15mol/L sodium borate buffer, 3mmol/L oxidized Glutathione, 1mmol/L reduced glutathione, adjust the pH to 9.5. The renaturation process is carried out in a low temperature cold storage at 2-8°C. First, the supernatant is diluted 5 times with the renaturation solution. After standing for 8 hours, the supernatant is diluted 5 times with the renaturation solution to continue the renaturation for 6 hours.

After the dialysis, the renaturation solution was subjected to 12000 rpm at 4°C for 30 minutes, and then applied to a DEAE Sepharose FF column equilibrated with 25mmol/L Tris-HCl pH 8.0 solution. After loading the sample, first flush the column with equilibration buffer for 2-3 column volumes, and then elute with 25mmol/L Tris-HCl pH8.0 solution containing 0.35mol/L NaCl to collect the elution peak. The linear flow rate during the above loading, rinsing and elution should be controlled between 50-200cm/h.

The elution peak of DEAE Sepharose FF was diluted with 50mmol/L acetic acid-sodium acetate pH4.5 buffer at a volume ratio of 1:10, and then was applied to a CM Sepharose FF column equilibrated with the same buffer. After the sample loading is completed, the chromatographic column is continuously rinsed with 2-3 column volumes, and then the main impurity peak is eluted with 25mmol/L acetic acid-sodium acetate pH4.5 buffer containing 0.1-0.15mol/L NaCl Then elute with 25mmol/L acetic acid-sodium acetate pH4.5 buffer containing 0.5mol/L NaCl to collect the target peak. The linear flow rate during the above loading, rinsing and elution should be controlled between 50-200cm/h.

The purity of the recombinant human antiviral cytokine 2 separated by the CM Sepharose FF column was detected by SDS-PAGE electrophoresis plus Coomassie brilliant blue staining method and size exclusion HPLC method, and the results were all above 97%. Using the "Interferon Activity Assay" and "Protein Assay" prescribed in the "People's Republic of China Pharmacopoeia 2015 Edition (Part Three)" to determine its specific activity is 3.24×10 ⁷ IU/mg, and the specific activity of the control IFN-α1b is 1.32×10 ⁷ IU/mg, the former is about 2.45 times that of the latter.

Example 5: Stability test of recombinant human antiviral cytokines 1 and 2

The recombinant human antiviral cytokine 1 purified in the foregoing Example 2 and the recombinant human antiviral cytokine 2 purified in Example 4 were placed at room temperature (25°C) for 3 months. During this process, regular sampling was performed to observe the appearance Changes, and detect changes in the main quality control indicators such as purity and biological activity (using the "Interferon Activity Assay Method" specified in the "Pharmacopoeia of the People's Republic of China 2015 Edition (Part Three)"). The results are shown in Tables 1 and 2 below . The corresponding 25°C stability test results of IFN-α1b are shown in Table 3.

Table 1 Stability test results of recombinant human antiviral cytokine 1 at 25℃

Table 2 25℃ stability test results of recombinant human antiviral cytokine 2

Table 3 25°C stability test results of IFN-α1b

Example 6: Cellular efficacy test of recombinant human antiviral cytokines 1 and 2

(1) Materials

1. Cells

WISH (Human Passage Amniotic Membrane) cells, provided by the Department of Microbiology, New York University School of Medicine;

Vero (green monkey kidney) cells, provided by the Institute of Viral Diseases, Chinese Center for Disease Control and Prevention.

All subcultured cells were subcultured according to conventional methods.

2. Virus

The Follicular Stomatitis Virus (VSV) Indiana strain was provided by the National Engineering Laboratory of Viral Genes and introduced by the US ATCC;

The measles virus MA strain, herpes simplex virus types I and II (HSV-I, HSV-II), adenovirus type 7 (Ad7), Cox B1 and Sindβis viruses were provided by the Center for Viral Diseases of the Chinese Center for Disease Control and Prevention;

Attenuated Japanese encephalitis virus-28 strain (JBEV-28), which is an adaptive strain of human lung diploid cells, provided by the encephalitis laboratory of the Institute of Virology;

Respiratory syncytial virus (RSV) is isolated from my country.

The above viruses are routinely passed on to their respective sensitive cells.

3. Interferon

Natural human leukocyte interferon (nIFN-Le) is induced and isolated from human peripheral blood leukocytes by NDV.

The specific activities of all kinds of interferons are all> 10 ⁶ IU/mg.

(2) Method: Determination of antiviral activity of interferon

After the above-mentioned cells form a monolayer, interferon of different concentrations is added, and the control group replaces the interferon with nutrient solution. After incubating at 37°C for 24 hours, the interferon solution was decanted and challenged with the above virus 100 TCID50, and the incubation was continued at 37°C. After the cells in the control group were completely damaged, the result was judged, and the relative antiviral activity was calculated from the concentration of interferon added. When comparing the sensitivity of interferon to different viruses on the same cell culture, VSV was used as a control, and the antiviral activity of interferon was determined by lesion inhibition method. The results obtained are shown in Table 4-6 below.

Table 4 Comparison of relative antiviral activity of recombinant human antiviral cytokines 1 and 2 and other interferons against different viral infections

Table 5 Inhibitory effect of recombinant human antiviral cytokines 1 and 2 and other interferons on human diploid cells against Japanese encephalitis

Table 6 Inhibitory effects of recombinant human antiviral cytokines 1 and 2 and other interferons on HeLa cells against respiratory syncytial virus

The above results indicate that the antiviral titers of recombinant human antiviral cytokine 1 and recombinant human antiviral cytokine 2 on different cell lines to different viruses are less than IFN-α1b, indicating that whether it is recombinant human antiviral cytokine 1 or recombinant The antiviral effect of human antiviral cytokine 2 is significantly better than IFN-α1b under the same conditions.

Example 7: Acute toxicity test of recombinant human antiviral cytokines 1 and 2 in mice

Forty-five mice weighing about 20 g were divided into 3 groups, 15 in each group. Group 1, Group 2 and Group 3 were injected with a single subcutaneous injection of the recombinant human antiviral cytokine purified in Example 2 and the recombinant human antiviral cytokine 2 and IFN-α1b purified in Example 4. After 14 days of continuous observation after injection, the three groups did not show any abnormal performance, indicating that the maximum tolerance of mice to recombinant human antiviral cytokine 1 is above 6.4mg/Kg, which is equivalent to 3840 times the clinical dosage of humans; The maximum tolerance of mice to recombinant human antiviral cytokine 2 is above 6.2mg/Kg, which is equivalent to 3720 times the clinical dosage of humans. Recombinant human antiviral cytokines 1, 2 and IFN-α1b are equally safe.

Claims (6)

1. The recombinant human antiviral cytokine has the amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.2.
2. The polynucleotide encoding the recombinant human antiviral cytokine of claim 1.
3. The method for preparing recombinant human antiviral cytokines according to claim 1, wherein the method for preparing includes the following steps:

   (1) Construction of recombinant human antiviral cytokine expression engineering bacteria;

   (2) Fermentation and chromatographic separation and purification of recombinant human antiviral cytokine expression engineering bacteria.
4. The pharmaceutical composition of the recombinant human antiviral cytokine according to claim 1, wherein the pharmaceutical composition contains a therapeutically effective amount and a safe amount of the recombinant human antiviral cytokine and an appropriate amount of Pharmaceutical carrier.
5. Use of the recombinant human antiviral cytokine according to claim 1 or the pharmaceutical composition according to claim 4 in the preparation of a medicament for preventing or treating viral infectious diseases.
6. The use according to claim 5, characterized in that the viral infectious disease is Japanese encephalitis, respiratory syncytial virus infection or viral hepatitis.