WO2004096852A1

WO2004096852A1 - A RECOMBINANT HUMAN INTERFERON ϖ, THE METHOD FOR EXPRESSING IT AND THE USES OF IT

Info

Publication number: WO2004096852A1
Application number: PCT/CN2004/000374
Authority: WO
Inventors: Wei Chen; Lianquan Qi; Ling Fu; Changming Yu; Dazhi Lai
Original assignee: The Institute Of Microbiology And Epidemiology, Academy Of Military Medical Sciemces, Pla; Taiji Group Co., Ltd.
Priority date: 2003-04-25
Filing date: 2004-04-19
Publication date: 2004-11-11

Abstract

A recombinant human interferon ϖ, the method for expressing it and the uses thereof are disclosed. The interferon ϖ is a protein having the amino acids residuals of SEQ ID NO: 2 in the sequence listing, or a protein derived from the protein of SEQ ID NO: 2 by substitution, deletion or addition of one or several amino acids in the amino acid sequence and having the same activity. The experiment studies demonstrated the interferon ϖ is safe for human body, and helpful for preventing SARS infection effectively. The method for expressing interferon ϖ has given higher yields, expressed and purified simply and conveniently, lower costs.

Description

Recombinant human interferon and its expression method and application

The present invention relates to a recombinant human ω interferon and its expression method and application in the field of genetic engineering, in particular to a recombinant human ω interferon, an expression method of the interferon and its prevention and / or treatment caused by coronavirus Of medicines for diseases.

Background technique

Human ω interferon was discovered in 1985. It is a class of interferon molecules with similar functions to α interferon but different antigenicity (Hauptmann R, Swetly P. A novel class of human type I interferons [J]. Nucleic Acids Res, 1985 , 13 (13): 4739-4749.) _D. Using a standard antiviral test, the specific activity of human ω interferon has been determined to be 2.7- 4 X 108U / mg. Induced by Sendai virus, human peripheral blood leukocytes have been successfully used to produce and purify human omega interferon

(Adolf GR, Maurer-Fogy I, Kalsner I et al. Purification and characterization of natural human interferon omega 1. Two alternative fcleavage sites for the signal peptidase [J]. J Biol Chem, 1990, 265 (16): 9290-9295 .). In addition, using different foreign protein expression systems, recombinant human ω interferon was expressed in E. coli, insect cells and CH0 cells, respectively. These make in-depth research on the protein possible. In several mouse models of human tumors, including ovarian cancer, melanoma, and skin cancer, human omega interferons have been shown to have antitumor functions in vivo (Horton HM, Hernandez P, Parker SE, et al. Antitumor effects of interferon— omega: in vivo therapy of human tumor xenografts in nude mice [J]. Cancer Res, 1999, 59 (16): 4064-4068.). Using human liver cancer cell lines, Hagelstein J et al. (Hagelstein J, Kist A, Streramel W, et al. Antiviral potential of interferon- omega on hepatitis B virus replication in human hepatoma cells [J]. Arzneimittelforschung, 1998, 48 (3) : 343- 347.) Comparing the inhibitory effects of various interferons on the replication of hepatitis B virus, it was found that human ω interferon has a similar inhibitory effect on virus replication as interferon α, interferon Υ, and tumor necrosis factor α. In vitro experiments on HIV virus inhibition, it was found that human omega interferon has a stronger inhibitory effect on viral protein synthesis than alpha interferon. Because ω interferon has strong antiviral replication, anti-cell proliferation, and immune regulation effects, this cytokine has broad application prospects in the treatment of a variety of tumors, viral diseases, and patients resistant to α interferon . Pichia pastoris is a eukaryotic expression system established in recent years (Cereghino JL, Cregg J M. Heterologous protein expression in the methylotrophic yeast Pichia pastorisij. FEMS Microbiol Rev, 2000, 24 (1): 45-66.), Is one of the most successful expression systems for expressing foreign proteins. Because it has prokaryotic expression systems, such as the commonly used E. coli expression system, it has the characteristics of rapid reproduction, low cost and convenient operation, and it has the advantages of eukaryotic expression system that can correctly process, fold and moderate glycosylation of the expressed protein. It also has the advantage of easy purification of recombinant protein. It is therefore becoming more and more widely used for the large-scale expression of proteins. More than 200 proteins have been expressed in this expression system (Cregg JM, Cereghino JL, Shi JY, et al. Recombinant protein expression in Pichia pastoris [J]. Mol Biotechnol, 2000, 16 (1): 23- 52.).

The Pichia pastoris expression system includes two modes: intracellular expression and secretory expression. The secretory expression is highly expressed, the glycosylation is complete, the disulfide bond and the advanced structure are formed correctly, especially the subsequent isolation and purification is very popular. .

Pichia yeast is a methanol nutritional yeast, which grows rapidly, has simple culture conditions, and can be continuously cultured at high density. Its genetic operation is similar to that of Saccharomyces cerevisiae, and its technology is quite mature. The promoter (pAOXl) is an inducible promoter, which is inhibited by glucose, and transcription and translation only begin after induction by methanol, which is very suitable for the expression of foreign genes.

PPIC9K is a multi-copy secreted expression vector introduced by Invitrogen. The size is 9.3 kb. The vector contains E. coli replication origin Col El, ampicillin, and kanamycin resistance genes. The kanamycin resistance gene can also make Pichia pastoris resistant to G418, which can be used for the screening of multiple copy insertions. . PPIC9K uses the secretion signal of alpha factor to secrete the target gene to the outside. Since Pichia yeast only secretes about 5% of the total protein to the outside, it is very convenient to isolate and purify the expressed protein. However, the exogenous protein expressed by the secretory expression vector PPIC9K will have incorrect N-terminus. These extra amino acid residues will affect and change the structure and function of the expressed protein (Goda S, Takano K, Yamagata Υ, et al. Effect of extra N-terminal residues on the stability and folding of human lysozyme expressed in Pichia pastoris [J]. Protein Eng, 2000, 13 (4): 299-307.). The invention of the present invention ^ «pPIC9K was hooked, and a new ¾¾ΜερΜΕχ9κ was tapped. And on May 20, 2002, he applied for the Chinese invention ^ lj, and the application if ^ was 02117906. 9 and the name was "Exogenous Induced Secretion Cellulose Fermentation" body ". Severe Acute Respiratory Syndrome (SARS), the pathogen of which is a newly emerged virus, is a variant of coronavirus, and has a homology of about 60% with the known coronavirus gene sequence, but its antigenicity There is no overlap between the two. So although the antibody-positive rate of coronavirus in the normal population is above 50%, there is no protective effect against this virus, which leads to the general susceptibility of the population. The virus causes severe respiratory diseases, and the case fatality rate currently reaches 4%, which seriously endangers human health. Finding effective prevention and treatment drugs for SARS virus has become a top priority for the medical community.

Invention Disclosure

The object of the present invention is to provide a recombinant human ω interferon and its coding gene.

The recombinant human ω interferon provided by the present invention is derived from human Homo sapiens) and is named rHuIFN-ω. It is a protein having the sequence of SEQ ID Ns: 2 amino acid residues in the sequence listing, or it is SEQ ID No _: 2 A protein derived from SEQ ID Na _: 2 after substitution, deletion or addition of one or more amino acid residues and having the same activity as the amino acid residue sequence of SEQ ID No _: 2.

Sequence 2 in the sequence listing is a protein consisting of 174 amino acid residues.

Recombinant human ω interferon coding gene, named rHuIFN-ω, it is one of the following nucleotide sequences:

1) SEQ ID Na: 1 in the sequence listing;

2) a polynucleotide encoding the protein sequence of SEQ ID No _: 2 in the sequence listing;

3) It has more than 90% homology with the DNA sequence defined by SEQ ID Na: 1 in the Sequence Listing, and encodes a DNA sequence of the same functional protein.

The DNA sequence of Sequence 1 in the Sequence Listing is composed of 525 bases, and the reading frame of the gene is from the 1st to 525th bases at the 5 'end.

Both the expression vector and the cell line containing the gene of the present invention belong to the protection scope of the present invention. Different recombinant expression vectors and engineering bacteria can be obtained by using existing molecular biology methods, such as the recombinant expression vector ρΜΕχ9Κ ω (the map is shown in Figure 1 ) And Pichia yeast GS115 containing the gene of the present invention.

A second object of the present invention is to provide a method for expressing recombinant human omega interferon.

The method for expressing recombinant human "interferon" provided by the present invention is to introduce a recombinant expression vector containing the above-mentioned recombinant human ω interferon-encoding gene into an expression host, and express the recombinant human ω interferon.

The host may be yeast, E. coli, mammalian cells, insect cells, Bacillus subtilis, Lactobacillus, etc., preferably yeast, particularly Pichia pastoris, and most preferably Pichia pastoris. Red yeast GS115.

In the Pichia pastoris culture supernatant, the content of the target protein reached the maximum 48-60 hours after induction, accounting for 20% -30% of the total protein in the culture supernatant. After four-step chromatography, the purity of the target protein can be more than 95%, and the recovery rate is more than 30%.

In this method, the expression vector for inserting the above-mentioned recombinant human ω interferon-encoding gene may be a vector expressed in the above host, such as pET, pQE, which can be expressed in E. coli, and pMEX9K, which can be expressed in Pichia yeast. And pPIC9K, among which pMEX9K is preferred. A recombinant expression vector containing the above-mentioned recombinant human ω interferon-encoding gene can be constructed according to a conventional method.

A third object of the present invention is to provide a medicament for preventing and / or treating a disease caused by a coronavirus.

The medicament for preventing and / or treating diseases caused by coronavirus provided by the present invention, its active ingredient is recombinant human ω interferon.

Among them, the coronavirus is preferably a SARS virus. The recombinant human ω interferon is preferably glycosylated, such as a glycosylated recombinant human ω interferon expressed in a Pichia expression system. The Pichia pastoris expression system is preferably a secretory expression system, such as the expression vectors pMEX9K, pPIC9K.

When necessary, one or more pharmaceutically acceptable carriers may be added to the above medicine. The carrier includes conventional diluents, fillers, binders, humectants, absorption enhancers, surfactants, adsorption carriers, lubricants, etc., and if necessary, flavoring agents, sweeteners, and the like can be added. '

The medicament of the present invention can be administered by injection or mucosa, and can be made into various medicaments such as injections, sprays or nasal drops. The above various dosage forms can be prepared according to the conventional methods in the pharmaceutical field.

The dosage of the above drugs is generally 1000IU-4000IU of recombinant human ω interferon / kg body weight / day. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a schematic diagram of the construction process of recombinant human ω interferon expression vector

Figure 2 is an SDS-PAGE map of the Pichia transformant expression product

Figure 3 is an SDS-PAGE chart of recombinant human ω interferon after digestion with glycosidase PNGase F. Figure 4 is a photo of the protective effect of recombinant human ω interferon and IFN-β on SARS virus attacked VER0-E6 cells.

Figure 5 is a photo of spray administration Figure 6 is an anesthetic challenge photo

Figure 7a is a photo of lung lesions in the drug group on day 6 after challenge

Figure 7b is a picture of lung lesions in the placebo group on day 6 after challenge.

Figure 8a is a photo of lung lesions in the drug group on day 16 after challenge

Figure 8b is a photograph of the lung lesions in the placebo group on the 16th day after challenge, and Figure 9a is a photograph of the spleen tissue lesions in the drug group on the 16th day after challenge

Figure 9b is a photograph of spleen tissue lesions in the placebo group on day 16 after challenge.

Fig. 10a is a 50 X observation photo of the lung pathological tissue on the 16th day after challenge in the placebo group. Fig. 10b is a 50 X observation photo of the lung pathological tissue on the 16th day after the challenge in the drug group. 25 X observation photos of the spleen pathology on the 16th day after poisoning. Figure ib is the 25 X observation photos of the spleen pathology on the 16th day after challenge in the drug group. Figure 12 is a typical of the cell culture supernatant in the placebo group. Electron micrographs of SARS coronavirus particles. Figures 13-14 are electron micrographs of alveolar epithelial cells on day 6 after challenge in the placebo group.

Figure 15 is an electron micrograph of spleen lymphocytes on day 6 after challenge in the placebo group.

The best way to implement the invention

Material

Strains ''

E. coli DH5α, Pichia pastoris were purchased from Huamei Company.

Enzymes, vectors, primers and main reagents

Restriction enzymes, T ₄ DNA ligase, plasmid extraction and recovery kits and pGEMT vectors were purchased from Promega. The primers were synthesized by Shanghai Shengong Company. FICOLL, TRIZOL, and agarose were purchased from Huamei Company. YNB is a product of Difico. Low molecular weight standard protein is a product of Amersham Pharmacia. The glycosidase PNGase F was purchased from New England Biolabs. MEM medium and newborn bovine serum were purchased from Hyclone.

Medium

E. coli medium LB medium: 1% peptone, 1% sodium chloride, 0.5% yeast extract powder; LBAK medium: ampicillin and kanamycin were added to the LB medium to a final concentration of 100 g / mL.

Yeast medium YPD medium: 1% yeast extract powder, 1% peptone, 2% glucose. BMGY medium: 1% yeast extract, 1% peptone, 1. 34 YNB, 1% glycerol, 100ramol / L phosphate buffer pH6.0, 4X10- ^5% biotin. BMMY medium: 1% yeast extract powder, 1% peptone, 1.34% YNB, 1% methanol, 100mmol / L phosphate buffer pH 6.0, 4X10

— ⁵ % biotin.

Cell culture medium: MEM medium is used, and 3% -10% of newborn bovine serum is added.

Example 1.Expression of recombinant human ω interferon

1.HuIFN-ω gene disappeared

FIC0LL reagent was used to isolate white blood cells from human blood, total RNA was extracted with TRIZ0L, and the human ω interferon gene was amplified by conventional RT-PCR methods. The primer sequence for PCR amplification was

5 'CGGAATTCATGCTGGGCTGTGATCTG3', 5 'GCGTCGACTCAAGATGAGCCCAGG3'. The obtained amplified product was ligated into a pGEMT vector to obtain a recombinant plasmid pGEMTc plasmid. The sequencing results showed that the recombinant human ω interferon gene has a cDNA sequence as shown in Sequence 1 in the Sequence Listing, which encodes an amino acid residue sequence as shown in Sequence Listing 2.

The Xho I cleavage point was introduced by using the primer with sequence 3 (amplifying the 5 'end of human ω interferon in the sequence listing), and the CTG codons at positions 15-17 of 5 from the 5' end in sequence 3 encode the human ω interferon. A codon) and sequence 4 (amplify the 3 'end of human ω interferon, introduce the Eco RI cleavage point), the primers of the nucleotide sequence shown by PCR method from the plasmid carrying the human ω interferon gene The gene was amplified on pGEMTc. Xho I and EcoR \ digestion vector pMEX9K (Qi Lianquan, Chen Wei, Yu Changming et al. Construction of two new multi-copy Pichia expression vectors [J] .Journal of the Academy of Military Medical Sciences, 2002, 26 (4) : 264-266.) And the PCR product, and the digested product is recovered, ligated to obtain a recombinant plasmid pMEX9K ω, and the recombinant plasmid is transformed into E. coli DH5 by the TSS method. The plasmid was extracted from the transformants, and the extracted plasmid was sequenced, and digested with ¾oI and ^ oRI. The digestion identification and sequencing results showed that the recombinant vector ρΜΕχ9Κω was successfully constructed. The construction process of the recombinant vector is shown in Figure 1. In Figure 1, Kan + is a kanamycin resistance gene; rIFNW is a recombinant human ω interferon gene; and SS is an α-factor signal peptide. '

The above-mentioned plasmid DNA extraction, enzyme digestion, recovery, ligation and transformation are all based on references

(Sarabrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual [M]. New York: Cold Spring Harbor Laboratory Press, 1989, 16-56).

2.Efficient expression of recombinant human ω interferon

Recombinant plasmid ρΜΕχ9Κω DNA was digested with 5¾Π, separated, purified, recovered, and transformed by electrotransformation Pichia GS115. The transformed GS115 by MD (MD medium: 1. 34% YNB, 2% glucose, 4X 10- ^5% biotin) to give hi s ⁺ plate screening of recombinant clones, each clone in the MD while o'clock, plates bandit (Band culture medium: 1. 34% YNB, 0.5% methanol, 4X ^10-5 % biotin), culture at 30 ° C for 2-3 days, and determine the Mut phenotype of each strain. The three recombinant clones with higher expression levels were inoculated into 5ml BMGY, and cultured at 30 ° C and 300r / min to 0D ₆ . . It is 2.0-6. 0; centrifugation at room temperature of 6,000 r / min for 4 min. The cells were collected and diluted with 0D ₆ to BMMY suspension. . After 1.0, induction at 300 ° C / min at 30 ° C. Add methanol to 0..5% every 12h. The culture supernatant was collected 48 hours after induction, and protein expression was measured by SDS-PAGE and its biological activity was determined. The results of the activity assay showed that the supernatant activities of the three positive clones were 3.2 X 10 ⁶ , 1. 6 X 10 n 3. 0 X 10 ⁶ U / mL; the results of protein expression detected by SDS-PAGE are shown in Figure 2 The protein band at 22,000 is the target protein, and the molecular weight of the protein is larger than the theoretical molecular weight, which is speculated to be caused by glycosylation. (In the amino acid sequence of the target protein, there is a potential glycosylation site Asn80-Met81 -Thr82). In FIG. 2, lane ab c is the expression supernatant of the transformant after induction; lane if d is the expression supernatant of the transformant before induction; lane e is the target protein; lane m is a low molecular weight standard protein.

3. Isolation and purification of target protein

The bacterial solution 48 hours after induction in step 2 was centrifuged at 10,000 r / min for 10 minutes, and the supernatant was filtered through a 0.45Mm filter membrane and applied to a large particle cation chromatography column (SP Sepharose XL pre-equilibrated with sodium acetate). , Amersham Biosciences), the target protein peak was eluted with 0.5M sodium chloride; the target protein peak was loaded on a hydrophobic chromatography column (Phenyl HighSub, Amersham Biosciences), and the eluted peak was loaded on a small particle ion exchange column (Source 30S , Amersham Biosciences), 500 mol / L sodium chloride elutes the target protein peak; the target protein peak is loaded on a Superdex 75 gel filtration column, and the target protein is eluted with 20 mmol / L PBS, 150 mol / L sodium chloride, pH 7.2 peak. The results are shown in lane a in Figure 3. The target protein was well separated. It was found by thin-layer scanning that the target protein was more than 95% pure.

4. Deglycosylation of target protein

The purified target protein was digested with glycosidase PNGase F. The results are shown in Figure 3, which indicates that the molecular weight of the recombinant human ω interferon is about 20, 300 Daltons, indicating that the molecular weight of the target protein is greater than the theoretical molecular weight for glycosylation. Caused by. In Figure 3, lane a is the target protein purified in step 3; lane b is a recombinant human ω interferon obtained after digestion with PNGase F glycosidase; lane _c is a PNGase F glycosidase; lane m is a protein molecular weight standard. Mesh after PNGase F digestion The relative molecular mass of the protein determined by MALDI-TOF is basically consistent with the theoretical value (Matrix-assisted laser desorption time of flight (MALDI-TOF) mass spectrometry to determine the molecular weight of the target protein before and after PNGase F digestion is 22, 166. 10 and 20, 340. 71).

Example 2.Identification of recombinant human ω interferon

1.N-terminal amino acid sequence analysis of recombinant human ω interferon

Using the 491 protein sequence analyzer of PE company, and using the automatic Edman degradation method, the amino acid residues of the amino terminus of the recombinant human ω interferon were determined. The sequence is: LGCDLPQNHGLLSRN. It shows that the recombinant human ω interferon has the amino acid sequence of amino terminal which is consistent with the natural protein.

2.Measurement of the activity of recombinant human ω interferon

According to the literature (edited by China Biological Product Standardization Committee. Chinese Biological Product Regulation M. Beijing: Chemical Industry Press, 2000, 373-375.). The results of the activity measurement showed that after the three-step chromatography purification in Example 1, step 3, the recovery rate of the target protein was above 35%, and the specific activity of the final target protein reached 2.2 X 10 ⁸ U / mL, the same Literature (Horton HM, Hernandez P, Parker SE, et al. Antitumor effects of interferon— omega: in vivo therapy of human tumor xenografts in nude mice [J]. Cancer Res, 1999, 59 (16): 4064-4068.) Reported results are similar.

Example 3 Protective effect of the recombinant human ω-interferon of the present invention on SARS coronavirus attack Virus source: SARS Coronavirus BJ01 [J] (Qin Ede, Zhu Qingyu, Yu Man et al., Full sequence of SARS-associated virus (BJ01 strain) And its comparative analysis. Science Bulletin, 2003, 48 (11): 1127-1134), diluted 1:20 for use.

Cells: VER0-E6 cells

The recombinant human ω interferon used in this example is a recombinant human ω interferon glycoprotein expressed by Pichia pastoris GS115 in Example 1.

1. Comparison of the protective effects of the recombinant human ω interferon and IFN-β on SARS virus attack on VER0 cells

IFN-β is derived from Rebif, a recombinant product of CH0 cells marketed abroad. In order to clarify the difference in the ability of IFN-β and the recombinant human ω interferon (rHuIFN-ω) of the present invention to inhibit the SARS virus's intracellular replication, this was compared using the cytopathic inhibition (CPE) method. VER0-E6 cells at a concentration of 250 000 ml / 96 well plate were _{seeded, 5% C0 2, 37 °} C culture 4- 6hr, the recombinant human interferon ω or IFN- β culture of the present invention is added to the same concentration 20h, except Add 100 μ 1 virus to each well of HI- H6 The solution was cultured until the virus control was completely diseased, and crystal violet staining was performed. The results are shown in FIG. 4, which shows that the recombinant human ω interferon of the present invention and IFN-β have similar anti-SARS virus activity. In Figure ½, A1-G1 and A2-G2 add 10,000 IU / ml of the recombinant human ω interferon of the present invention to each well; the concentrations of the recombinant human ω interferon of the present invention added to A3-G3 and A4-G4 are A3 and A4 in this order. 10000IU / ml for B3 and B4; 5000IU / ml for B3 and B4; 2500IU / ml for C3 and C; 1250IU / ml for D3 and D4; 625IU / ml for E3 and E4; 312IU / ml for F3 and F4; 312IU / ml for G3 and G4; 156IU for G3 and G4 The concentration of the recombinant human ω interferon of the present invention added by A5-G5 and A6-G6 is 10000IU / ml in sequence of A5 and A6; 2000IU / ml of B5 and B6; 400IU / ml of C5 and C6; D5 and D6 80IU / ml; E5 and E6 are 16IU / ml; F5 and F6 are 3.2IU / ml; G5 and G6 are 0.64IU / ml; A7-G7 and A8-G8 add 10000IU / ml of IFN-β per well A9-G9 and A10-G10 are added with IFN-β, the concentration of which is A9 and A10 is 10000IU / ml; B9 and B10 are 5000IU / ml; C9 and C10 are 2500IU / ml; D9 and D10 are 1250IU / ml; E9 and E10 are 625IU / ml; F9 and F10 are 312IU / ml; G9 and G10 are 156IU / ml; An- G11 and A12-G12 are added with IFN-β, and their concentrations are All and A12 are 10000IU / ml in order; B11 Wo Mouth B12 is 2000IU / ml; C11 and C12 are 400IU / ml; D11 and D12 are 80IU / ml; E 11 and E12 are 16IU / ml; F11 and F12 are 3.2IU / ml; G11 and G12 are 0.64IU / ml; H7-H12 are virus control groups; H1-H6 are cell control groups.

2. Protective effect of the recombinant human IFN-ω spray of the present invention on SARS virus attacking cynomolgus monkeys To investigate the effect of the recombinant human ω interferon spray of the present invention on the prevention and treatment of SARS, a primate model of SARS was explored And SARS virus attack protective experiments. The specific method is as follows: Ten macaque monkeys (3-5 years old) provided by the Animal Center of the Academy of Military Medical Sciences were randomly divided into a placebo group and a drug group, 4 placebo groups, and 6 drug groups. Two days before the challenge, the animals in the drug group received a recombinant human ω interferon spray nasal spray (Figure 5). The dose was the same as that for human use, namely 2 million IU / 8ml, and the left and right nostrils were 0.1 ml, once a day, and then Anesthesia challenge (Figure 6), nasal spray once a day after challenge; placebo group was given the same dose of spray dilution. The challenge strain was BJ01, and the challenge dose was 1 ml (10 ⁷ TCID ₅ o / ral). Animals were dissected on days 6 and 16 after challenge.

(1) Gross anatomical results

Placebo group: On the 6th day after challenge, the dissection revealed that the lungs were dark pink, the surface of the lung was uneven, and large lobules or large patches of bleeding spots were seen on the apex of multiple lungs (Figure 7b); on the 16th day after challenge, Pulmonary apical bleeding It is more obvious, the bleeding is wider, the lungs are dark red, the surface of the lungs is uneven, and the alveoli with emphysema can be seen protruding from the surface of the lung (Figure 8b); the splenomegaly is obvious, dark brown, the edges are blunt, There were white hyperplastic spleen body nodules (Figure 9b); no other organs showed significant changes.

Drug group: On the 6th day (Figure 7a) and the 16th day (Figure 8a) after challenge, the lungs were dark pink and no bleeding spots were seen; the spleen was slightly enlarged, and a few white splenic body hyperplasia nodules were visible on the surface (Figure 9a).

(2) Histopathological observation

Lungs: On the _6th day after challenge, the cynomolgus monkeys in the placebo group had moderately dilated and congested capillaries in the lung interstitial space and alveolar septum, showing interstitial pneumonia; On the 16th day after challenge, pneumonia was more pronounced and the lung interstitial Capillaries are highly dilated and hyperemic, with a large number of lymphocytes and macrophages infiltrating. The alveolar space is widened and the alveolar cavity is squeezed and narrowed. Severe inflammatory sites are characterized by severe exudative inflammation, manifested by necrosis and shedding of alveolar and small bronchial epithelial cells, a large number of lymphocytes, alveolar macrophages, neutrophil infiltration, and a large number of red blood cells in the alveolar space, occasionally mixed fibrin The proteinous exudate, the entire lung tissue structure was destroyed, adjacent alveolar compensatory emphysema, multiple alveolar cavities were ruptured, and merged into a large cavity (Figure 10a). On the 6th day after challenge, the cynomolgus monkey's pulmonary interstitial capillaries were slightly dilated and congested, and the symptoms of pneumonia were mild. On the 16th day, the pulmonary interstitial capillaries and alveolar capillaries were congested with a small amount of lymphocytes and macrophages. Infiltration (Figure 10b).

Lymph nodes: On the 6th day after challenge, the lymph node lymphocytes of the cynomolgus monkeys in the placebo group slightly proliferated and the number of lymphatic follicles increased; On the 16th day after the challenge, the lymph node lymphocytes proliferated more prominently, and the lymphocytes were dense and the lymphoid follicles The number increases. Lymph node lymphocytes in cynomolgus monkeys in the drug group also proliferated, but they were not as significant as those in the challenge group over the same period.

Spleen: The cynomolgus monkey in the placebo group was erythrocytes and sinus congestion on the 6th day after challenge, and the spleen body lymphocytes were slightly proliferated; on the 16th day after challenge, the spleen body lymphocyte proliferation was more obvious, and the number of spleen bodies The number of lymphocytes in the germinal center of the spleen was increased, and the lymphocytes were arranged closely (Figure 11a). The spleen lymphocytes of the drug group showed mild hyperplasia (Figure lib).

Liver: After the challenge, the lobular liver structure of the cynomolgus monkey in the drug group was intact, and hepatocyte granule degeneration and vesicular degeneration were seen in the lobule, and a few hepatocytes were fatty degeneration; while in the placebo group, the cynomolgus monkey's hepatocyte granules were degenerated, and central vein congestion in the manifold area Occasionally, thrombosis was observed, and a transparent membrane was also formed in the central vein of the hepatic manifold area. A small amount of lymphocytes infiltrated in the manifold area, and the Kupffer cells of the liver slightly proliferated.

Myocardium: The cynomolgus monkeys in the placebo group were congested under the myocardial fibers of the myocardium, and the focal granular degeneration of the myocardial fibers was more pronounced, especially in the epicardium and subendocardium. transsexual.

Kidney: In the placebo group, the renal tubule epithelial cells of the cynomolgus monkey degenerate or necrosis, and the epithelial cells fall off; in the drug group, the renal tubular epithelial cells of the cynomolgus monkey degenerate.

Other organs: No obvious change.

(3) negative staining

SARS coronavirus was isolated from homogenates of the lungs of cynomolgus monkeys on the 6th and 16th day after challenge. Typical coronavirus particles were seen in the cell culture supernatant. The diameter of the virus particles was about 120nm, and there were typical corona fibroids on the periphery (Figure 12, bar = 100 dishes).

(4) Ultrastructure observation

On the 6th day after challenge, the cytoplasmic endoplasmic reticulum of alveolar epithelium and spleen lymphocytes of cynomolgus monkeys in the placebo group expanded, coronavirus particles sprouted from the endoplasm, and a large number of coronavirus particles were seen in the cytoplasm of the cells. The diameter of the virus particles 80-120nm, the electron density at the center of the virion is low (Figure 13-15, bar = 100 dishes). Mitochondria swell and nuclear chromatin condenses. In Figure 15, the lower right corner is partially enlarged, showing a typical coronavirus particle. In the drug group, cynomolgus monkey lung epithelial cells and spleen lymphocytes occasionally swelled mitochondria, increased cytoplasmic vacuoles, and no typical coronavirus particles were seen.

In this example, the cynomolgus monkey in the placebo group was inoculated with BJ01 strain of coronavirus. On the 6th and 16th days, it was found that there were large rice grains or large bleeding spots on the apex of multiple lung lobules. Histopathological observation showed that cynomolgus monkeys developed interstitial pneumonia. Severe inflammatory sites are characterized by severe exudative inflammation, manifested by necrosis and shedding of alveolar and small bronchial epithelial cells, a large number of lymphocytes, alveolar macrophages, neutrophil infiltration, and a large number of red blood cells in the alveolar space, occasionally mixed fibrin Proteinaceous exudate. A large number of coronavirus particles, 80-120 nm in diameter, were observed in the alveolar epithelial cells and spleen lymphocyte cytoplasm. A typical coronavirus is isolated from the lungs. This is consistent with the pathological changes in human SARS patients, indicating that cynomolgus monkeys can be used as animal models for studying SARS pathology.

The cynomolgus monkey in the drug group was also inoculated with a large dose of BJ01 strain of coronavirus. Due to the application of the recombinant human omega interferon spray of the present invention, compared with the placebo group, the animals in the drug group had less pathological damage to the lungs. Coronavirus particles were observed and no coronavirus was isolated from the viscera. It shows that the recombinant human ω interferon of the present invention can effectively inhibit the proliferation of SARS virus in the body and reduce the damage to the body.

Industrial applications

The recombinant human ω interferon of the present invention has a potential glycosylation site A _S n80-Met81- Thr82, Recombinant human ω interferon expressed by Pichia pastoris is a glycosylated protein with good thermal stability. The validity period is more than 6 months at room temperature, which is very convenient for medical personnel to carry and use in specific environments. In addition, compared with other biological immune preparations, the recombinant human IFN-ω spray has the characteristics of safety and effectiveness, no stimulation, and low cost, and is suitable for large-scale general population applications. The nasal administration of recombinant human IFN-ω as a spray makes full use of the rich microvilli and porous capillaries on the nasal mucosa, allowing the interferon to be well absorbed through the nasal mucosa, and activating the nasal mucosa and adjacent tissues. Body system to achieve antiviral effects. VER0 cell experiments show that the recombinant human ω interferon of the present invention and IFN-β have similar anti-SARS virus activity; animal experiments show that the recombinant human ω interferon of the present invention can effectively inhibit the proliferation of SARS virus in cynomolgus monkeys and reduce Damage to the body. During the SARS epidemic, clinical studies on the prevention of SARS virus infection by recombinant human ω interferon were conducted in six provinces, municipalities and autonomous regions in Beijing, Ningxia, Hebei, Chongqing, Sichuan, and Tianjin, China. Among them, a total of 14,061 people were studied, of which 8395 were rHuIFN- The omega drug group includes: 4314 medical staff (high-risk population) in designated hospitals for SARS treatment, 2,181 urban residents in SARS-affected areas, and 1,900 migrant workers returning from the affected areas. The results show that the use of recombinant human omega interferon in the population is Safe and effective in preventing SARS virus infection.

The recombinant human ω interferon expression method of the invention has the characteristics of high yield, simple expression and purification, low cost, convenient expansion of production, and the like, and has broad market prospects.

Claims

Claim

1. A recombinant human ω interferon, which is a protein having the sequence of the _SE Q ID No _: 2 amino acid residue in the sequence listing, or a sequence in which the amino acid residue sequence of SEQ ID No _: 2 is passed through one or several amino acid residues substitution, deletion or addition and having SEQ ID _No: activity same amino acid residue sequence 2 by SEQ ID _No: 2 derived proteins.

2. The protein according to claim 1, wherein the recombinant human ω interferon is a protein having the sequence of the amino acid residues of SEQ ID No _: 2 in the sequence listing.

3. The coding gene of the recombinant human ω interferon is one of the following nucleotide sequences-1) SEQ ID No _: 1 in the sequence listing;

2) a polynucleotide encoding the protein sequence of SEQ ID o: 2 in the sequence listing;

3) A DNA sequence with more than 90% homology to the DNA sequence defined by SE ID NO _: 1 in the sequence listing, and a DNA sequence encoding the same functional protein.

The coding gene according to claim 3, characterized in that: the coding gene of the recombinant human ω interferon is a polynucleotide of SEQ ID Nfl: 1 in the sequence listing.

5. A recombinant expression vector containing the coding gene according to claim 3 or 4.

6. The recombinant expression vector according to claim 5, wherein the vector is pMEX9Kω.

7. A cell line containing a coding gene according to claim 3 or 4.

The cell line according to claim 7, wherein the cell line is a Pichia pastoris GS115 containing the recombinant human ω interferon-encoding gene.

9. A method for expressing recombinant human ω interferon, which comprises introducing a recombinant expression vector containing the above-mentioned recombinant human ω interferon-encoding gene into an expression host, and expressing the recombinant human ω interferon; the gene encoding the recombinant human ω interferon; Is one of the following nucleotide sequences: 1) SEQ ID Na in the Sequence Listing: 1; 2) a polynucleotide encoding the SEQ ID Na _: 2 protein sequence in the Sequence Listing; 3) and SEQ ID Nfi in the Sequence Listing: The DNA sequence defined in 1 has more than 90% homology and encodes a DNA sequence of the same functional protein.

10. The method according to claim 9, wherein the host is yeast, E. coli, mammalian cells, insect cells, Bacillus subtilis, and Lactobacillus.

11. The method according to claim 10, wherein the host is Pichia pastoris.

12. The method according to claim 11, wherein the Pichia yeast is Pichia yeast GS115.

13. The method according to claim 9 or 10, characterized in that: the expression vector for inserting the recombinant human ω-interferon coding gene is pET, pQE, pMEX9K or pPIC9K.

14. The method according to claim 13, wherein the expression vector is pMEX9K.

15. The method according to claim 9, characterized in that: the expressed recombinant human ω interferon is purified by the following method: a large particle cation chromatography column, and the target protein peak is eluted with 0.5M sodium chloride ; The target protein peak was loaded on a hydrophobic chromatography column, the elution peak was loaded on a small particle ion exchange column, and the 500 mol / L sodium chloride was used to elute the target protein peak; the target protein peak was loaded on a gel filtration column to obtain a purified protein.

16. A medicament for the prevention and / or treatment of diseases caused by a coronavirus, the active ingredient of which is recombinant human omega interferon. '

17. The medicament according to claim 16, wherein the coronavirus is a SARS virus.

18. The medicament according to claim 16 or 17, wherein the recombinant human ω-interferon is glycosylated.

The medicament according to claim 18, wherein the recombinant human ω interferon is a glycosylated recombinant human ω interferon expressed in a Pichia pastoris expression system.

The medicament according to claim 19, wherein the Pichia pastoris expression system is a secretory expression system.

The medicament according to claim 20, wherein: the secretory expression system is an expression vector pMEX9K or pPIC9K. '

22. The medicament according to claim 16 or 17, wherein the medicament is administered by injection or mucosa.

23. The medicament according to claim .22, wherein the medicament is in the form of an injection, a spray or a nasal drop.

24. Use of the recombinant human omega interferon according to claim 1 or 2 in the manufacture of a medicament for the prevention and / or treatment of a disease caused by a coronary virus.

25. The application according to claim 24, wherein the coronavirus is a SARS virus.

26. The application according to claim 24 or 25, wherein: the recombinant human ω interferon is glycosylated.

27. The application according to claim 26, wherein the recombinant human ω interferon is a glycosylated recombinant human ω interferon expressed in a Pichia yeast expression system.

28. The application according to claim 27, wherein the Pichia pastoris expression system is a secretory expression system.

29. The application according to claim 28, characterized in that: the secretory expression system is an expression vector pMEX9K or pPIC9K.

30. The application according to claim 24 or 25, characterized in that the medicine is administered by injection or mucosa.

31. The application according to claim 30, wherein the medicine is in the form of an injection, a spray or a nasal drop.