WO2023155342A1

WO2023155342A1 - Atomized inhalation formulation for preventing and treating respiratory disease and use thereof

Info

Publication number: WO2023155342A1
Application number: PCT/CN2022/098315
Authority: WO
Inventors: 宋瑜丽; 唐旭东; 杨淑琼; 侯云德
Original assignee: 深圳市利云德生物技术有限公司
Priority date: 2022-02-15
Filing date: 2022-06-13
Publication date: 2023-08-24
Also published as: CN114533706B; CN114533706A

Abstract

The present invention discloses an atomized inhalation formulation for preventing and treating a respiratory disease and use thereof. The formulation comprises an antiviral active factor, mannitol, a solubilizer, and a buffer.

Description

A kind of atomized inhalation preparation for preventing and treating respiratory diseases and its application

This application claims the priority of the Chinese patent application submitted to the China Patent Office on February 15, 2022, with the application number 202210135755.7, and the title of the invention is "A nebulized inhalation preparation for preventing and treating respiratory diseases and its application", all of which The contents are incorporated by reference in this application.

technical field

The invention belongs to the technical field of atomized inhalation preparations, in particular to an atomized inhalation preparation for preventing and treating respiratory diseases and its application.

Background technique

At present, the commonly used drug administration methods for the treatment of respiratory diseases include inhalation, oral administration, intravenous, transdermal, etc., among which the action site of inhalation administration is in the lungs. Due to the physiological structure of the lungs, inhalation administration is more compatible with the respiratory system. The ingenious combination of physiological and histological characteristics has obvious advantages. At present, inhalation therapy has been recommended by many countries as the preferred method of drug administration for the prevention and treatment of asthma, COPD and other respiratory diseases. Inhalation preparations are liquid or solid preparations in which the raw drug is dissolved or dispersed in a suitable medium, delivered to the lungs in the form of aerosol or vapor, and exerts local or systemic effects.

There are many types of inhalation preparations, and the pharmacopoeias of various countries have different descriptions for their classification. "Chinese Pharmacopoeia" (2020 Edition, Part IV) classifies inhalation preparations into: inhalation aerosol, inhalation powder mist, inhalation spray, inhalation liquid preparation, and preparations that can be converted into steam. Inhalation preparations are basically prepared from the main drug and auxiliary materials (such as aerosols need to add propellants, powder sprays need to add carriers), the ratio of main drugs and corresponding auxiliary materials is very demanding, and slight differences will significantly affect the inhalation preparations. Stability and drug delivery uniformity. Strict control of drug particle size: The particle size of drug particles will significantly affect its lung deposition rate. The Chinese Pharmacopoeia pointed out that the particle size of raw materials in inhalation preparations should generally be controlled below 10 μm, and most of them should be below 5 μm. It is generally believed that the ideal drug particle size is between 1-5 μm.

The aerosol inhalation for the treatment of respiratory diseases caused by viruses has been widely used in China. The IFNs approved for marketing in my country mainly include IFN-α2b, IFN-α2a and IFN-α1b. The dosage forms include injections, sprays, creams, suppositories, vaginal effervescent tablets and eye drops, but there are no atomized dosage forms. Nebulization therapy requires the use of special preparations, and the use of non-atomization preparations sometimes not only fails to achieve effective therapeutic purposes, but also may increase adverse reactions. For example, aerosols have large particle sizes and are usually trapped in the oropharynx or swallowed into the digestive tract, so they are not suitable for pulmonary inhalation therapy. Dosage forms such as creams and suppositories are also not suitable for atomization. In clinical practice, IFN injection is commonly administered by nebulization off-label. However, some IFN injections on the market contain preservatives such as benzyl alcohol, and preservatives can cause airway spasm, mucosal damage, and induce asthma and other adverse reactions after aerosol inhalation. In China, there are many clinical experiences of off-label nebulization of IFN injection, especially in the field of pediatrics. Since the outbreak of the new crown virus, experts have recommended trying IFN atomization. However, there are no aerosolized dosage forms in my country, and off-label use should follow the principle of "off-label drug use", and more attention should be paid to the adverse reactions of drugs, and appropriate drugs and atomization devices should be selected to ensure the effectiveness and safety of drugs and pharmaceutical monitoring . Of course, it is expected that pharmaceutical companies can develop aerosolized dosage forms of IFN to meet clinical needs, and ensuring the safety and effectiveness of medication for patients is one of the urgent clinical needs. Attempts on aerosol inhalation of IFN for viral pneumonia mainly originated from the cases of children in my country. However, after reviewing foreign literature, there were no reports of aerosol inhalation of IFNs in the treatment of respiratory viral infections. Only a few studies showed that aerosol inhalation of IFN -γ may contribute to the control of drug-resistant tuberculosis and the treatment of IPF (idiopathic pulmonary fibrosis), indicating that aerosol inhalation of IFNs may have a certain application prospect in the treatment of respiratory diseases. However, there is currently a lack of clinical research results on IFN aerosol inhalation for the treatment of COVID-19, and further research is needed on its effectiveness and safety. Adverse reactions of aerosol inhalation of IFN in the treatment of coronavirus pneumonia In general, aerosol inhalation of IFN has the advantages of rapid action, small dosage, and mild systemic adverse reactions, but its adverse reactions cannot be ignored. At present, all IFNs produced in China are injection preparations. Although there are literatures to support that their aerodynamics meet the requirements of aerosol preparations, their medication instructions do not mention that they can be used for aerosol inhalation, which belongs to the category of "off-label medication".

Biomacromolecules have a complex structure, and there are several factors that cause their degradation under inhalation conditions. How to ensure structural integrity and biological activity is a key factor in the successful development of inhalation formulations. Moreover, although inhalation preparations have the advantage of prolonging the exposure to the lungs, the safety of the inhalation preparations, especially the excipients used, are important aspects of drug development and clinical use. Currently, the number of excipients approved for inhalation formulations is limited, mainly some sugars, amino acids, lipids, salts, phospholipids and small molecule PEGs. Using unapproved excipients in some new inhalation formulations would be time-consuming, laborious, and risk rejection by regulatory agencies. This also partly explains the low number of inhalation preparations on the market. The limited excipients approved by the FDA are a great test for the innovation of inhalation preparations. In addition, prescription design, selection of excipients, processing technology, and selection of atomization equipment should all be considered systematically. Second, the tissue penetration and systemic adsorption of biomacromolecular drugs are limited by their hydrophilic properties. Therefore, it is one of the technical problems to be solved urgently in this field to develop an interferon biomacromolecule atomized inhalation preparation with significant effect and good stability to meet clinical needs and ensure the safety and effectiveness of medication for patients.

Contents of the invention

In view of this, the object of the present invention is to provide an interferon biomacromolecule atomized inhalation preparation with remarkable effect in preventing and treating respiratory diseases and good stability, which has the advantages of good activity retention and uniform particle size.

In order to realize the above-mentioned purpose of the invention, the present invention provides the following technical solutions:

The invention provides an atomized inhalation preparation for preventing and treating respiratory diseases, which comprises antiviral active factor, mannitol, solubilizer and buffer.

Preferably, the antiviral active factor includes interferon, and the interferon includes an interferon whose amino acid sequence is shown in SEQ ID No.1.

Preferably, the solubilizer includes sodium chloride, and the buffer includes disodium hydrogen phosphate hydrate and sodium dihydrogen phosphate hydrate.

Preferably, the concentration of the mannitol is 1-80 mg/mL, the concentration of the antiviral active factor is 0.001-200 μg/mL,

Preferably, the concentrations of the solubilizer and the buffer are as follows: disodium hydrogen phosphate hydrate 15.5-31 mg/mL, sodium dihydrogen phosphate hydrate 4.95-9.9 mg/mL, sodium chloride 8.7-17.4 mg/mL.

Preferably, the pH value of the nebulized inhalation preparation is 5.5-7.6.

Preferably, the storage temperature of the nebulized inhalation preparation is -30°C to 27°C.

Preferably, the nebulized inhalation preparation is preferably a portable mesh nebulizer.

The present invention also provides an application of the above atomized inhalation preparation in the preparation of products for preventing and treating respiratory diseases.

Preferably, the respiratory diseases include respiratory diseases caused by virus infection.

Preferably, the viruses include respiratory syncytial virus, influenza virus and new coronavirus.

Beneficial effects of the present invention:

The atomized inhalation preparation provided by the present invention has no significant difference in activity before and after atomization, and the particle size produced during atomization is uniform and small, between 0.5-10 μm, which can be used for the prevention and treatment of respiratory diseases, especially The prevention and treatment effect on respiratory diseases caused by virus infection is remarkable, and there is no side effect. It is especially suitable for infants, children and the elderly, and is also suitable for people of other age groups.

In addition, the nebulized inhalation preparation of the present invention has broad-spectrum antiviral activity, and has significant preventive and treatment effects on various respiratory diseases caused by viral infection.

Description of drawings

Fig. 1 is the biological activity of different formulation samples, and * indicates that there is a significant change (p<0.05) compared with formulation 4;

Figure 2 is the particle size volume distribution of different formula samples, wherein when the particle size<3 μm, a-e respectively represent that compared with formula 1, formula 2, formula 3, formula 4, and formula 5, there is a significant change (p<0.05); 3 μm< When the particle size is less than 5μm, A-E represent significant changes compared with formula 1, formula 2, formula 3, formula 4 and formula 5 respectively (p<0.05); when the particle size is >5 μm, *, #, &, ¥, @ represent respectively compared with formula 1, formula 2, formula 3, formula 4, formula 5, there are significant changes (p<0.05);

Fig. 3 is the particle size volume quantity distribution of different formula samples, and the annotations of each letter in Fig. 3 are the same as Fig. 2;

Fig. 4 is the atomized particle size result of different antiviral activity factor concentration formulations;

Figure 5 is the biological activity of the preparation of Example 3 at different test temperatures and different pH values, where a, c, and e respectively represent that when the pH is 6.5, 7.0, and 7.5, there is a significant change compared with the 37°C storage condition ( p<0.05), b, d, and f respectively indicate that when the pH is 6.5, 7.0, and 7.5, compared with room temperature storage conditions, there are significant changes (p<0.05); , When stored at 2～8℃, -20℃, compared with the pH value of 7.0, there is a significant change (p<0.05);

Fig. 6 is the biological activity of the preparation of Example 2 at different test temperatures and different pH values, and the annotations of each letter in Fig. 6 are the same as Fig. 5;

Fig. 7 is the body weight change situation of experimental mice;

Figure 8 shows the change of virus titer in mouse lung tissue. Compared with group 1, NS indicates no statistical difference at p>0.05, and *** indicates extremely significant difference at p<0.001.

Detailed ways

The present invention has no special limitation on the specific sources of mannitol, solubilizer and buffer, and commercially available products in the field that meet medical raw materials can be used. In the present invention, the solubilizer is preferably sodium chloride, and the buffer is preferably PB buffer composed of disodium hydrogen phosphate hydrate and sodium dihydrogen phosphate hydrate. In the present invention, mannitol not only functions as a stabilizer but also as a solubilizer, and in addition, it can increase the hydration of secretions in the respiratory tract, which is more conducive to the diffusion of drugs.

In the present invention, the antiviral active factor preferably includes interferon, and the interferon preferably includes an interferon whose amino acid sequence is shown in SEQ ID No.1. In the nebulized inhalation preparation of the present invention, the concentration of the interferon whose amino acid sequence is shown in SEQ ID No.1 is preferably 0.001-200 μg/mL, more preferably 0.005-100 μg/mL. The amino acid sequence of the present invention is as shown in SEQ ID No.1. The molecular weight of the interferon is 18.3KD, and the isoelectric point is between 5.5 and 6.5. The present invention is not particularly limited to the preparation method of the interferon shown in SEQ ID No.1 for the amino acid sequence, in the specific embodiment of the present invention, the preparation method of the interferon shown in the amino acid sequence as SEQ ID No.1 is preferably by It is prepared by genetic engineering, specifically including steps such as synthesizing nucleotide sequences, selecting vectors, constructing engineering bacteria, large-scale fermentation, and separation and purification.

In the present invention, when the stabilizer, solubilizer and buffer are mannitol, sodium chloride, disodium hydrogen phosphate hydrate and sodium dihydrogen phosphate hydrate respectively, the concentration of the mannitol is preferably 1-80mg/ mL, more preferably 5-60mg/mL, the concentration of the sodium chloride is preferably 8.7-17.4mg/mL, more preferably 9.5-16.5mg/mL, the concentration of the disodium hydrogen phosphate hydrate is preferably 15.5 -31 mg/mL, more preferably 17.5-28 mg/mL, the concentration of the sodium dihydrogen phosphate hydrate is preferably 4.95-9.9 mg/mL, more preferably 5.5-8.5 mg/mL.

The pH value of the nebulized inhalation preparation of the present invention is preferably 5.5-7.6, more preferably 6.0-7.5. When using the nebulized inhalation preparation provided by the present invention to prevent and treat respiratory diseases, the present invention has no special limitation on the type of nebulizer, ultrasonic atomization, jet atomization, vibrating net atomization drug delivery device can be used, in the specific embodiment of the present invention Among them, a vibrating net atomizer is preferably used. The atomized inhalation preparation of the present invention is used in conjunction with a nebulizer to produce uniform tiny particles between 0.5-10 μm, and the drug enters the respiratory tract and lungs for deposition through breathing inhalation, thereby achieving the purpose of painless, rapid and effective treatment. The present invention ensures that the nebulized inhalation preparation of the present invention has significant biological stability through the selection of the type and dosage of the pharmaceutical excipients, the medicinal activity does not change significantly before and after nebulization, and the effect on the prevention and treatment of respiratory diseases caused by viral infection is remarkable. Side effects, especially suitable for infants, children and the elderly, but also suitable for people of other age groups. The storage temperature of the nebulized inhalation preparation of the present invention is preferably -30°C to 27°C, more preferably 2-8°C.

The present invention has no special limitation on the preparation method of the nebulized inhalation preparation, as long as the raw and auxiliary materials and dosages are prepared according to the present invention, sterilized, packaged and used according to the instructions.

In the present invention, the respiratory diseases preferably include respiratory diseases caused by virus infection. The present invention is not particularly limited to the type of virus. In a specific embodiment of the present invention, the virus preferably includes respiratory syncytial virus, influenza virus and new coronavirus, and the new coronavirus preferably includes COVID-19, SARS-COV- 2. The present invention has no special limitation on the types of products, including medicines.

The technical solutions provided by the present invention will be described in detail below in conjunction with the examples, but they should not be interpreted as limiting the protection scope of the present invention.

Example 1

The preparation of the interferon whose amino acid sequence is shown in SEQ ID No.1

Synthesize a corresponding nucleic acid template according to the amino acid sequence shown in SEQ ID No.1, and amplify a sufficient amount of nucleic acid by PCR.

The primers of the amplification reaction system are:

F: CATATGTGCGACCTGCCACA

R: CTCGAGTTAGTTGGTGCTCAGGC

The amplification reaction system includes: 1 μL of dNTP, 5 μL of 10X pfu buffer, 2 μL of upstream and downstream primers, 1 μL of template, 0.4 μL of Pfu enzyme (5u/μL), and 38.6 μL of ddH ₂ O.

The amplification reaction conditions are: 95° C. for 3 minutes, 95° C. for 22 seconds, 68° C. for 20 seconds, 72° C. for 60 seconds, and 72° C. for 5 minutes. A total of 24 cycles. After the reaction is completed, use agarose gel electrophoresis to separate, use Nde I/Xho I double enzyme digestion, and electrophoresis to recover the target DNA fragment of about 500bp.

The pET30a plasmid vector was digested with Nde I/Xho I, recovered by agarose electrophoresis and ligated with the recovered target DNA fragment. The ligation reaction conditions are: seamless cloning mixture, 8.5 μL, enzyme-cut vector pET30a, 4 μL, purified PCR product, 7.5 μL, and the above ligation mixture is placed in a PCR instrument at 37°C for 1 hour.

Prepare Escherichia coli BLD21 competent cells, transform the above ligation products, coat kanamycin plates, and culture overnight at 37°C.

Pick a single colony as a template, amplify with the primers F and R designed above, and the product is detected by agarose electrophoresis, and the positive clone has a specific band at about 500 bp; the positive clone is cultured in small quantities, and the plasmid is extracted with Nde I/Xho I double digestion. Specific bands appeared at about 3kb and 500bp respectively, which were in line with the expected situation, preliminarily indicating that the recombinant plasmid was successfully constructed. In order to further confirm its sequence, the ABI377 sequencer was used for automatic sequence determination with T7 universal primers.

Fermentation, purification and detection of interferon with amino acid sequence as shown in SEQ ID No.1

After the expression engineered bacteria of the novel interferon obtained by constructing is plated and activated, a single colony is selected and inoculated in the LB medium containing kanamycin with a final concentration of 30 μg/mL (10 g of peptone, 5 g of yeast powder, chlorine Prepared with 10 g of sodium chloride, adjusted to a pH of 7.0), cultured in a shaker flask at 37°C and 235 rpm until the OD600nm was 0.6-0.8. Then inoculate in the LB substratum of 50L with the volume inoculum of 5% and carry out fermentation culture (contain the kanamycin of 30 μ g/mL) in 80L fermenter, culture temperature is 37 ℃, adjusts pH with ammoniacal liquor in the cultivation process Between 6.5-7.5, use the speed to control the dissolved oxygen value between 3-5%. After OD600nm reached 1.0, 10 g of IPTG was added at a mass volume ratio of 1:5000 to continue the induction culture for 4.5 hours. The induction culture temperature was 37 °C, and LB medium was appropriately added to the fermenter during this process. After the induction culture time is over, put the tank at room temperature at 5000 rpm and centrifuge for 20 minutes to collect the bacteria, and the resulting bacteria are washed and centrifuged twice with TE buffer (50mmol/L Tris-HCl, 5mmol/L EDTA, pH8.0) to remove The main impurity in the fermentation broth.

Take 40 g of the bacteria obtained from the above treatment and add 600 mL of TE buffer solution at a mass volume ratio of 1:15 to put it on an ultrasonic breaker for ultrasonic crushing. The conditions are to beat for 5 seconds and rest for 5 seconds for a total of 60 minutes. Centrifuge for 20 minutes to discard the supernatant, add TE buffer to the precipitate at a mass volume ratio of 1:10, wash and centrifuge twice to separate inclusion bodies.

The obtained 10 g of inclusion bodies were dissolved in inclusion body solution (8 mol/L urea, 50 mmol/L Tris-HCl, 300 mmol/L sodium chloride, pH 8.0) at a mass volume ratio of 1:10, and denatured under moderate stirring conditions 2 After the inclusion body is completely dissolved, centrifuge at room temperature at 12,000 rpm for 20 minutes and discard the precipitate. The supernatant is refolded by dilute refolding method. The refolding solution is composed of: 0.15mol/L sodium borate buffer, 3mmol/L oxidation Type glutathione, 1mmol/L reduced glutathione, adjust pH to be 9.5. The renaturation process is carried out in a low-temperature freezer at 2-8°C. First, the supernatant is diluted 6 times with the renaturation solution, left for 8 hours, and then diluted 5 times with the renaturation solution to continue renaturation for 6 hours.

The refolding solution after dialysis was centrifuged at 12000 rpm at 4°C for 30 minutes and then equilibrated with a DEAE Sepharose FF column with 25mmol/L Tris-HCl pH8.0 solution. After loading the sample, continue to wash the chromatographic column for 2-3 column volumes with equilibration buffer, and then elute with 25 mmol/L Tris-HCl pH8.0 solution containing 0.35 mol/L sodium chloride to collect the elution peak.

The linear flow rate during the above sample loading, washing and elution process should be controlled between 50-200cm/h.

The eluted peak of DEAE Sepharose FF was diluted with 50mmol/L acetic acid-sodium acetate pH4.5 buffer at a volume ratio of 1:10, and then loaded onto a CM Sepharose FF column equilibrated with the same buffer. After loading the sample, continue to wash the column with equilibration buffer for 2-3 column volumes, and then elute with 25mmol/L acetic acid-sodium acetate pH4.5 buffer containing 0.1-0.15mol/L sodium chloride to remove the main Impurity peaks were eluted with 25 mmol/L acetic acid-sodium acetate pH4.5 buffer solution containing 0.5 mol/L sodium chloride to collect the target peaks. The linear flow rate during the above sample loading, washing and elution process should be controlled between 50-200cm/h.

SDS-PAGE electrophoresis plus Coomassie brilliant blue staining and molecular exclusion HPLC were used to detect the purity of the novel interferon alpha separated by the CM Sepharose FF chromatographic column, and the results were all above 97%. The specific activity is determined to be not less than 3.0×10 ⁸ IU/mg by using the "Interferon Activity Assay Method" and "Protein Content Assay Method" stipulated in the "Pharmacopoeia of the People's Republic of China 2020 Edition (Part Three)".

Example 2

The interferon with the amino acid sequence as shown in SEQ ID No.1 prepared in Example 1 is formulated into an aerosol inhalation preparation for preventing and treating respiratory diseases, wherein mannitol is 45 mg/mL, and the amino acid sequence is as shown in SEQ ID No.1 Interferon 30μg/mL, disodium hydrogen phosphate hydrate 15.5mg/mL, sodium dihydrogen phosphate hydrate 4.95mg/mL, sodium chloride 8.7mg/mL. (Formulation 1) (Formulation A)

Example 3

The amino acid sequence prepared in Example 1 is prepared as the interferon shown in SEQ ID No.1 to be formulated into an aerosol inhalation preparation for preventing and treating respiratory diseases, wherein mannitol is 45 mg/mL, and the amino acid sequence is shown in SEQ ID No.1 Interferon 50 μg /mL, disodium hydrogen phosphate hydrate 15.5mg/mL, sodium dihydrogen phosphate hydrate 4.95mg/mL, sodium chloride 8.7mg/mL. (Formulation B)

Example 4

The amino acid sequence prepared in Example 1 is prepared as the interferon shown in SEQ ID No.1 to be formulated into an aerosol inhalation preparation for preventing and treating respiratory diseases, wherein mannitol is 1 mg/mL, and the amino acid sequence is shown in SEQ ID No.1 Interferon 0.001 μg /mL, disodium hydrogen phosphate hydrate 31mg/mL, sodium dihydrogen phosphate hydrate 9.9mg/mL, sodium chloride 17.4mg/mL.

Example 5

The amino acid sequence prepared in Example 1 is prepared as the interferon shown in SEQ ID No.1 to be formulated into an aerosolized inhalation preparation for preventing and treating respiratory diseases, wherein mannitol is 80 mg/mL, and the amino acid sequence is shown in SEQ ID No.1 Interferon 200 μg /mL, disodium hydrogen phosphate hydrate 20mg/mL, sodium dihydrogen phosphate hydrate 6.5mg/mL, sodium chloride 9.2mg/mL.

Example 6

The difference from Example 2 is that the amino acid sequence is as shown in SEQ ID No.1 and the concentration of interferon is 80 μg/mL, and the rest are the same as in Example 2.

Example 7

The difference from Example 2 is that the amino acid sequence is as shown in SEQ ID No.1 and the concentration of interferon is 100 μg/mL, and the rest are the same as in Example 2.

Comparative example 1

The difference from Example 2 is that PEG600 is used to replace mannitol, and the rest are the same as Example 2. (Recipe 2)

Comparative example 2

The difference from Example 2 is that mannitol is replaced with albumin, and the rest are the same as Example 2. (Recipe 3)

Comparative example 3

The difference from Example 2 is that mannitol is replaced with chitosan, and all the other are the same as Example 2. (Recipe 4)

Comparative example 4

The difference from Example 2 is that mannitol is replaced with medium molecular weight hyaluronic acid, and the rest are the same as Example 2. (Recipe 5)

Example 8

Measure the biological activity and sample particle size of embodiment 2 and comparative example 1-4 respectively, wherein the biological activity detection method is: use the "interferon activity assay method" stipulated in "The Pharmacopoeia of the People's Republic of China 2020 Edition (Three, Four)" "Determination, the detection method of sample particle size is: Utilize laser particle size tester (model Winner311XP, measuring mileage 0.1-100 μm), under the condition of environmental temperature and humidity: 25 ℃, 69% RH, carry out mist on the above formula After atomization (the atomizer is a vibrating net atomizer), the particle size is tested. The results are shown in Figure 1-3.

As can be seen from Figures 1-3, compared with other atomized inhalation preparations that do not contain mannitol, the atomized inhalation preparation of the present invention has higher biological activity and is more uniform, more suitable, and more conducive to atomized inhalation particle size, and the volume distribution and number distribution of particle size <3μm account for a large proportion.

Example 9

Measure the sample particle diameter of embodiment 2 and embodiment 3 respectively, the detection method of sample particle diameter is the same as embodiment 8. Each group was repeated three times, and the average value was finally drawn. Taking the preparation buffer as a control (that is, the control group does not add the interferon with amino acid sequence as shown in SEQ ID No.1), the median particle size of the preparation buffer test is: 3.201 μm. Example 2 The median particle size Xv50=3.188 μm after the test of the nebulized inhalation preparation, the number distribution data: <3 μm accounted for 96.548%, and <5 μm accounted for 99.417%, meeting the requirements for medical atomization. The results are shown in Figure 4, from which it can be seen that the atomized inhalation formulation of the present invention has a more uniform particle size and a particle size more in line with the respiratory tract atomized inhalation when used.

Example 10

Under the conditions of 2-8°C, -20°C, 37°C and pH6.5, pH7.0, pH7.5 respectively, the activity stability of the nebulized inhalation preparations of Example 2 and Example 3 were tested, The results are shown in Figure 5 and Figure 6.

From the results in Figures 5 and 6, it can be seen that the nebulized inhalation preparation of the present invention has the best activity at pH 7.0, can be stored for a long time at 2-8°C and -20°C, and has the best biological activity stability.

Example 11

The vibrating net nebulizer is used in combination with the nebulized inhalation preparation of Example 3, and the biological activity before and after nebulization of the nebulized inhalation preparation of Example 3 is measured by the cytopathic method. The results are shown in Table 1, indicating that this The biological activity of the inventive nebulized inhalation preparation has little change before and after nebulization, and there is no statistical difference.

Table 1 Changes in biological activity before and after atomization

类别category	生物学活性(×10 ⁶IU/ml) Biological activity (×10 ⁶ IU/ml)
雾化前Before atomization	5.49±0.165.49±0.16

After atomization

5.45±0.34

Example 12

During January 10-18, 2020, 35 BALB/c mice were divided into 5 groups, with 7 mice in each group, male and female were randomly distributed, and the above animal groups were respectively instilled with respiratory syncytial virus (RSV) A2 strain Perform infection modeling. The administration samples were as follows: vehicle (blank control): 20mM phosphate buffer (vehicle, pH7.0); ribavirin, dissolved in normal saline, and configured as a mother solution with a concentration of 1.5 and 5.0 mg/mL; commercially available Interferon, diluted in a solvent, is configured as a mother solution; Example 3 preparation (LYD-01). The above-mentioned test samples were tested for antiviral effect by intramuscular injection and atomization respectively, and the specific experimental design is shown in Table 2. The viral load in lung tissue and the change of animal body weight were investigated respectively. The results are shown in Figure 7 and Figure 8.

Table 2 Anti-RSVA2 strain infection mouse in vivo effect test design

As can be seen from Figure 7 and Figure 8, the intramuscular injection of commercially available interferon and the nebulized inhalation preparation of the present invention has no obvious virus inhibitory effect, but the commercially available interferon and the nebulized inhalation preparation of the present invention can inhibit the virus by nebulization. , showing good efficacy in vivo. Among them, nebulized administration of commercially available interferon can cause weight loss in animals at a set dose, which is considered an adverse side effect. However, the nebulized inhalation preparation of the present invention does not see weight loss in mice, indicating that the aerosol inhalation preparation of the present invention can not only achieve a significant effect of inhibiting RSV virus, but also has no adverse side effects.

The above is only a preferred embodiment of the present invention, it should be pointed out that, for those of ordinary skill in the art, without departing from the principle of the present invention, some improvements and modifications can also be made, and these improvements and modifications can also be made. It should be regarded as the protection scope of the present invention.

Claims

An atomized inhalation preparation for preventing and treating respiratory diseases is characterized in that the atomized inhalation preparation includes antiviral active factor, mannitol, solubilizer and buffer.
The nebulized inhalation preparation according to claim 1, wherein the antiviral activity factor includes interferon, and the interferon includes an interferon whose amino acid sequence is as shown in SEQ ID No.1.
The atomized inhalation preparation according to claim 1, wherein the solubilizer includes sodium chloride, and the buffer includes disodium hydrogen phosphate hydrate and sodium dihydrogen phosphate hydrate.
The atomized inhalation preparation according to claim 1, characterized in that the concentration of the mannitol is 1-80 mg/mL, and the concentration of the antiviral active factor is 0.001-200 μg/mL.
The nebulized inhalation preparation according to claim 3, characterized in that the concentrations of the solubilizer and the buffer are as follows: disodium hydrogen phosphate hydrate 15.5-31 mg/mL, sodium dihydrogen phosphate hydrate 4.95-9.9 mg/mL mL, sodium chloride 8.7-17.4mg/mL.
The atomized inhalation preparation according to any one of claims 1-5, characterized in that, the pH value of the atomized inhalation preparation is 5.5-7.6.
The atomized inhalation preparation according to any one of claims 1-5, characterized in that the storage temperature of the atomized inhalation preparation is -30°C to 27°C.
The application of the atomized inhalation preparation described in any one of claims 1-7 in the preparation of products for preventing and treating respiratory diseases.
The use according to claim 8, characterized in that the respiratory diseases include respiratory diseases caused by virus infection.
The application according to claim 9, wherein the viruses include respiratory syncytial virus, influenza virus and novel coronavirus.