CN114533706A

CN114533706A - Aerosol inhalation preparation for preventing and treating respiratory diseases and application thereof

Info

Publication number: CN114533706A
Application number: CN202210135755.7A
Authority: CN
Inventors: 宋瑜丽; 唐旭东; 杨淑琼; 侯云德
Original assignee: Shenzhen Liyunde Bio Tech Co ltd
Current assignee: Shenzhen Liyunde Bio Tech Co ltd
Priority date: 2022-02-15
Filing date: 2022-02-15
Publication date: 2022-05-27
Anticipated expiration: 2042-02-15
Also published as: CN114533706B; WO2023155342A1

Abstract

The invention provides an aerosol inhalation preparation for preventing and treating respiratory diseases and application thereof, belonging to the technical field of aerosol inhalation preparations. The aerosol inhalation preparation for preventing and treating respiratory diseases provided by the invention comprises an antiviral active factor, mannitol, a solubilizer and a buffer solution. The aerosol inhalation preparation provided by the invention has the characteristics of convenience, high efficiency, good activity retention and uniform particle size, has good prevention and treatment effects on respiratory diseases caused by virus infection of respiratory syncytial virus, influenza virus, new coronavirus and the like, is particularly suitable for infants, children and the old, and is also suitable for people of any age group.

Description

Aerosol inhalation preparation for preventing and treating respiratory diseases and application thereof

Technical Field

The invention belongs to the technical field of aerosol inhalation preparations, and particularly relates to an aerosol inhalation preparation for preventing and treating respiratory diseases and application thereof.

Background

At present, common administration modes for treating respiratory diseases comprise inhalation, oral administration, vein, transdermal administration and the like, wherein the action part of the inhalation administration is in the lung, and the inhalation administration can be skillfully combined with the physiological and histological characteristics of a respiratory system due to the physiological structure of the lung, so that the inhalation administration has obvious advantages. Inhalation formulations are liquid or solid formulations in which the drug substance is dissolved or dispersed in a suitable medium and delivered to the lungs in aerosol or vapor form for local or systemic action.

The inhalation preparation has various dosage forms, and the descriptions of the classification of the inhalation preparation are different from each other in pharmacopoeias of various countries. The chinese pharmacopoeia (2020 edition, fourth department) classifies inhalation formulations as: inhalation aerosols, inhalation powders, inhalation sprays, inhalation liquid formulations, formulations convertible to vapors. The inhalation preparation is basically prepared from a main drug and auxiliary materials (if a propellant is required to be added into an aerosol and a carrier is required to be added into a powder aerosol), the proportion requirement of the main drug and the corresponding auxiliary materials is very high, and slight difference can obviously influence the stability of the inhalation preparation and the uniformity of delivered drugs. The grain diameter of the medicine is strictly controlled: the size of the drug particles can significantly affect the lung deposition rate. The chinese pharmacopoeia indicates that the particle size of the raw drug in the inhalation formulation should be generally controlled below 10 μm, most of which should be below 5 μm. It is believed that the desired drug particle size is between 1-5 μm.

The aerosol inhalation for treating respiratory diseases caused by viruses is very extensive in China. IFN mainly comprises IFN-alpha 2b, IFN-alpha 2a and IFN-alpha 1b approved to be on the market in China, and the dosage forms comprise injection, spray, cream, suppository, vaginal effervescent tablets and eye drops, but the dosage forms are not atomized. Nebulization requires the use of specialized formulations, and the use of non-nebulizing formulations sometimes, but not exclusively, does not achieve effective treatment and may increase adverse reactions. For example, aerosols with a large particle size are often entrapped in the oropharynx or swallowed into the digestive tract and are therefore unsuitable for pulmonary inhalation therapy. Cream, suppository, etc. are also not suitable for atomization. It is common to administer IFN by nebulization with the super instructions for injection clinically. However, some of the marketed IFN injection contains benzyl alcohol and other preservatives, and the preservatives can cause airway spasm, mucosal damage, asthma and other adverse reactions after atomization and inhalation. More clinical experiences of IFN injection atomization using super specifications exist in China, and particularly in the field of pediatrics. Since the outbreak of new coronavirus outbreaks, experts recommend IFN atomization on probation. However, no special atomizing preparation is available in China, the super-instruction application follows the principle of 'super-instruction medication', adverse reactions generated by the medicine are also more concerned, and proper medicine and atomizing devices are selected to ensure the effectiveness and safety of the medicine and carry out pharmaceutical monitoring. Certainly, the drug enterprises are expected to develop IFN atomized formulations to meet clinical requirements, and the drug administration safety and effectiveness of patients are one of the urgent clinical requirements. The attempt of aerosol inhalation of IFN for viral pneumonia mainly comes from children cases in China, but the report of aerosol inhalation of IFNs for treating respiratory viral infection is not found after the examination of foreign documents, and only a few studies show that aerosol inhalation of IFN-gamma may be helpful for the control of drug-resistant tuberculosis and the treatment of IPF (idiopathic pulmonary fibrosis), which indicates that aerosol inhalation of IFNs may have certain application prospects in the treatment of respiratory diseases. However, the clinical results of the IFN aerosol inhalation therapy COVID-19 are lacking, and the effectiveness and safety of the drug need to be further studied. Adverse reactions of IFN inhalation by atomization for treating coronavirus pneumonia generally speaking, the IFN inhalation by atomization has the advantages of rapid action, small dosage, light adverse reactions of the whole body and the like, but the adverse reactions can not be ignored. At present, domestic IFN is all injection preparations, although documents support that the aerodynamics of the IFN meets the requirements of an atomized preparation, the administration instruction does not mention that the IFN can be used for atomized inhalation, and the IFN belongs to the category of 'medication beyond the instruction book'.

Biological macromolecules have a complex structure and in the case of inhalation there are some factors that cause their degradation. How to ensure structural integrity and biological activity is a key factor in the successful development of inhalation formulations. Moreover, despite the advantages of prolonged pulmonary exposure, the safety of inhaled formulations, and in particular the excipients used, are important aspects of drug development and clinical use. Currently, the number of excipients approved for inhalation formulations is limited, mainly some sugars, amino acids, lipids, salts, phospholipids and small molecule PEGs. The use of non-approved excipients in some new inhalation formulations would be time consuming, laborious and risk being rejected by regulatory agencies. This also explains in part the small number of inhalation formulations on the market. The limited excipients approved by the FDA are highly challenging to innovate in inhaled formulations. In addition, the design of the prescription, the choice of adjuvants, processing techniques, and the choice of atomizing equipment should all be considered systematically. Secondly, the tissue penetration and systemic adsorption of biomacromolecule drugs are limited by their hydrophilic nature. Therefore, the research and development of the interferon biomacromolecule atomizing and inhaling preparation with obvious effect and good stability to meet the clinical requirement and ensure the medication safety and effectiveness of patients are one of the technical problems to be solved urgently in the field.

Disclosure of Invention

In view of the above, the present invention aims to provide an interferon biomacromolecule aerosol inhalation preparation with significant effect and good stability for preventing and treating respiratory diseases, and the preparation has the advantages of good activity retention and uniform particle size.

In order to achieve the above object, the present invention provides the following technical solutions:

the invention provides an aerosol inhalation preparation for preventing and treating respiratory diseases, which comprises an antiviral active factor, mannitol, a solubilizer and a buffer solution.

Preferably, the antiviral active factor comprises interferon, and the interferon comprises interferon with an amino acid sequence shown as SEQ ID No. 1.

Preferably, the solubilizer includes sodium chloride, and the buffer includes disodium hydrogen phosphate hydrate and sodium dihydrogen phosphate hydrate.

Preferably, the concentration of the mannitol is 1-80mg/mL, the concentration of the antiviral active factor is 0.001-200 mug/mL,

preferably, the concentrations of the solubilizer and the buffer are as follows: 15.5-31mg/mL of disodium hydrogen phosphate hydrate, 4.95-9.9mg/mL of sodium dihydrogen phosphate hydrate and 8.7-17.4mg/mL of sodium chloride.

Preferably, the pH of the aerosolized inhalation formulation is from 5.5 to 7.6.

Preferably, the storage temperature of the aerosol inhalation formulation is from-30 ℃ to 27 ℃.

Preferably, the aerosolized inhalation formulation is preferably a portable mesh nebulizer.

The invention also provides an application of the aerosol inhalation preparation in preparing products for preventing and treating respiratory diseases.

Preferably, the respiratory disease comprises a respiratory disease caused by a viral infection.

Preferably, the virus includes respiratory syncytial virus, influenza virus and new corona virus.

The invention has the beneficial effects that:

the atomization inhalation preparation provided by the invention has no obvious difference in activity before and after atomization, the particle size generated during atomization use is uniform and small and is 0.5-10 mu m, the atomization inhalation preparation can be used for preventing and treating respiratory diseases, especially has obvious effect on preventing and treating respiratory diseases caused by virus infection, has no side effect, is especially suitable for infants, children and old people, and is also suitable for people of other ages.

In addition, the aerosol inhalation preparation has broad-spectrum antiviral activity and has obvious prevention and treatment effects on various respiratory diseases caused by virus infection.

Drawings

Figure 1 is a graph of biological activity for samples of different formulations, showing significant changes (p <0.05) compared to formulation 4;

FIG. 2 is a graph of particle size volume distributions of samples of different formulations, wherein a-e show significant changes (p <0.05) compared to formulation 1, formulation 2, formulation 3, formulation 4, and formulation 5, respectively, when the particle size is <3 μm; when the particle size is less than 5 μm and 3 μm, A-E respectively show that the particle size has significant changes (p is less than 0.05) compared with formula 1, formula 2, formula 3, formula 4 and formula 5; when the particle size is larger than 5 mu m, the values of x, #, &, @ respectively show that the particle size is obviously changed (p is smaller than 0.05) compared with the particle sizes of formula 1, formula 2, formula 3, formula 4 and formula 5;

FIG. 3 is a particle size volume number distribution for samples of different formulations, with the various letters in FIG. 3 being annotated as in FIG. 2;

FIG. 4 shows the particle size results of different formulations of antiviral activity;

FIG. 5 is a graph of the biological activity of the formulation of example 3 at various test temperatures and various pH values, wherein a, c, e represent significant changes (p <0.05) at pH6.5, 7.0, 7.5, respectively, as compared to the 37 ℃ storage conditions, and b, d, f represent significant changes (p <0.05) at pH6.5, 7.0, 7.5, respectively, as compared to the room temperature storage conditions; G. h, I, J shows that when the food is stored at 37 ℃, normal temperature, 2-8 ℃ and-20 ℃, the change is obvious compared with the pH value of 7.0 (p is less than 0.05);

FIG. 6 is a graph of the biological activity of the formulation of example 2 at various test temperatures and various pH values, with the various letters in FIG. 6 being annotated as in FIG. 5;

FIG. 7 shows the body weight changes of experimental mice;

figure 8 shows the change in viral titers of lung tissue in mice, and NS showed no statistical difference between p >0.05 and a very significant difference between p <0.001, compared to group 1.

Detailed Description

The specific sources of mannitol, solubilizer and buffer are not particularly limited in the invention, and any commercially available product which meets the medical raw materials in the field can be adopted. In the present invention, the solubilizer is preferably sodium chloride, and the buffer is preferably PB buffer composed of disodium hydrogen phosphate hydrate and sodium dihydrogen phosphate hydrate. In the invention, the mannitol has the functions of a stabilizing agent and a solubilizing agent, and can also increase the hydration of secretion in respiratory tract, thereby being more beneficial to the diffusion of the medicine.

In the present invention, the antiviral active factor preferably comprises interferon, and the interferon preferably comprises interferon having an amino acid sequence shown in SEQ ID No. 1. In the aerosol inhalation formulation of the present invention, the concentration of interferon having an amino acid sequence shown in SEQ ID No.1 is preferably 0.001 to 200. mu.g/mL, more preferably 0.005 to 100. mu.g/mL. The molecular weight of the interferon with the amino acid sequence shown as SEQ ID No.1 is 18.3KD, and the isoelectric point is 5.5-6.5. The preparation method of the interferon with the amino acid sequence shown as SEQ ID No.1 is not particularly limited, and in the specific embodiment of the invention, the preparation method of the interferon with the amino acid sequence shown as SEQ ID No.1 is preferably obtained by genetic engineering preparation, and specifically comprises the steps of nucleotide sequence synthesis, carrier selection, engineering bacterium construction, large-scale fermentation, separation and purification and the like.

In the present invention, when the stabilizer, the solubilizer, and the buffer are mannitol, sodium chloride, disodium hydrogen phosphate hydrate, and sodium dihydrogen phosphate hydrate, respectively, the concentration of mannitol is preferably 1 to 80mg/mL, more preferably 5 to 60mg/mL, the concentration of sodium chloride is preferably 8.7 to 17.4mg/mL, more preferably 9.5 to 16.5mg/mL, the concentration of disodium hydrogen phosphate hydrate is preferably 15.5 to 31mg/mL, more preferably 17.5 to 28mg/mL, and the concentration of sodium dihydrogen phosphate hydrate is preferably 4.95 to 9.9mg/mL, more preferably 5.5 to 8.5 mg/mL.

The pH of the aerosolized inhalation formulation of the present invention is preferably in the range of 5.5 to 7.6, more preferably 6.0 to 7.5. When the aerosol inhalation preparation provided by the invention is applied to preventing and treating respiratory diseases, the invention has no special limitation on the types of atomizers, and can be applied to ultrasonic atomization, jet atomization and vibrating mesh atomization administration devices. The aerosol inhalation preparation is used together with an atomizer to generate uniform micro particles of 0.5-10 mu m, and the medicament enters the respiratory tract and the lung for deposition in a respiratory inhalation mode, thereby achieving the aim of painless, rapid and effective treatment. The invention ensures that the aerosol inhalation preparation has obvious biological stability through the selection of the types and the dosage of the medicinal auxiliary materials, has no obvious change of medicinal activity before and after atomization, has obvious effect of preventing and treating respiratory diseases caused by virus infection, has no side effect, is particularly suitable for infants, children and the old, and is also suitable for people of other ages. The storage temperature of the aerosol inhalation formulation of the present invention is preferably-30 ℃ to 27 ℃, more preferably 2 to 8 ℃.

The preparation method of the aerosol inhalation preparation is not particularly limited, and the aerosol inhalation preparation can be prepared by ensuring the raw and auxiliary materials and the dosage which are described in the invention, packaging after sterilization and using according to the instruction.

In the present invention, the respiratory disease preferably includes a respiratory disease caused by viral infection. The present invention is not particularly limited in kind of virus, and in the specific embodiment of the present invention, the virus preferably includes respiratory syncytial virus, influenza virus and new coronavirus, and the new coronavirus preferably includes COVID-19 and SARS-COV-2. The present invention is not particularly limited with respect to the kind of product, including pharmaceutical products.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Preparation of interferon with amino acid sequence shown as SEQ ID No.1

Synthesizing a corresponding nucleic acid template according to the amino acid sequence shown as SEQ ID No.1, and amplifying a sufficient amount of nucleic acid by a PCR method.

The primers of the amplification reaction system are as follows:

F：CATATGTGCGACCTGCCACA

R：CTCGAGTTAGTTGGTGCTCAGGC

the amplification reaction system comprises: dNTP 1. mu.L, 10 Xpfu buffer 5. mu.L, upstream and downstream primers 2. mu.L each, template 1. mu. L, Pfu enzyme 0.4. mu.L (5 u/. mu.L), ddH₂O 38.6μL。

The amplification reaction conditions are as follows: 95 ℃ 3 min, 95 ℃ 22 sec, 68 ℃ 20 sec, 72 ℃ 60 sec, 72 ℃ 5 min. For a total of 24 cycles. After the reaction, the reaction mixture was separated by agarose gel electrophoresis, digested simultaneously with Nde I/Xho I, and subjected to electrophoresis to recover a target DNA fragment of about 500 bp.

The pET30a plasmid vector was double-digested with Nde I/Xho I, recovered by agarose electrophoresis, and ligated with the target DNA fragment recovered as described above. The ligation reaction conditions were: and 4. mu.L of the seamless cloning mixed solution, 8.5. mu.L of the enzyme digestion vector pET30a, 4. mu.L of the purified PCR product and 7.5. mu.L of the ligation mixed solution are placed in a PCR instrument for 1h at 37 ℃.

Coli BLD21 competent cells were prepared, the ligation product was transformed, kanamycin-plated, and cultured overnight at 37 ℃.

Selecting a single colony as a template, amplifying by using the designed primer F, R, detecting the product by agarose electrophoresis, and generating a specific band on the positive clone at about 500 bp; the positive clones are taken for small-scale culture, and the extracted plasmid is subjected to double digestion by Nde I/Xho I. Specific bands appear around 3kb and around 500bp respectively, which is consistent with the predicted situation, and the success of the construction of the recombinant plasmid is preliminarily shown. To further confirm their sequence, the ABI377 sequencer was fully automated with the T7 universal primer.

Fermentation, purification and detection of interferon with amino acid sequence shown as SEQ ID No.1

The constructed expression engineering bacteria of the novel interferon are subjected to plate coating activation, then single colonies are selected and inoculated in LB culture medium (10 g of peptone, 5g of yeast powder and 10g of sodium chloride per liter, the pH is adjusted to 7.0) containing kanamycin with the final concentration of 30 mug/mL, and shaking culture is carried out on a shaking table at 37 ℃ and 235 rpm until OD600nm is 0.6-0.8. Then inoculated into 50L of LB medium at a volume inoculation amount of 5% to perform fermentation culture (containing 30. mu.g/mL of kanamycin) in an 80L fermenter at a culture temperature of 37 ℃ with the pH being adjusted to 6.5-7.5 with ammonia water during the culture, and the dissolved oxygen value being controlled to 3-5% with the rotation speed. After OD600nm reached 1.0, IPTG 10g was added in a mass-to-volume ratio of 1:5000 to continue the induction culture at 37 ℃ for 4.5 hours, and the fermenter was appropriately supplemented with LB medium in the process. After the induction culture time is up, the culture medium is placed in a tank at the room temperature of 5000 r/min and centrifuged for 20 min to collect the thalli, and the obtained thalli are washed and centrifuged twice by using TE buffer solution (50mmol/L Tris-HCl,5mmol/L EDTA, pH8.0) to remove main impurities in the fermentation liquid.

And adding 40g of the thalli obtained by the treatment into 600mL of TE buffer solution according to the mass-to-volume ratio of 1:15, placing the thalli on an ultrasonic disruptor for ultrasonic disruption under the conditions of beating for 5 seconds and pausing for 5 seconds for 60 minutes, removing supernatant after the temperature of the disrupted solution is 12000 rpm/separation center for 20 minutes, adding TE buffer solution into the sediment according to the mass-to-volume ratio of 1:10, washing and centrifuging twice to obtain the separated inclusion body.

Adding 10g of the obtained inclusion body into an inclusion body dissolving solution (8mol/L urea, 50mmol/LTris-HCl, 300mmol/L sodium chloride, pH8.0) according to the mass-to-volume ratio of 1:10, dissolving, performing denaturation treatment for 2 hours under the condition of moderate stirring, discarding the precipitate after the inclusion body is completely dissolved at the room temperature of 12000 r/separation heart for 20 minutes, and performing renaturation treatment on the supernatant by a dilution renaturation method, wherein the renaturation solution comprises the following components: 0.15mol/L sodium borate buffer solution, 3mmol/L oxidized glutathione and 1mmol/L reduced glutathione, and the pH value is adjusted to 9.5. The renaturation process is carried out in a low-temperature refrigeration house at the temperature of 2-8 ℃, firstly, supernatant is diluted by 6 times by using renaturation liquid, after the supernatant is placed for 8 hours, the supernatant is diluted by 5 times by using the renaturation liquid, and the renaturation is continued for 6 hours.

The renaturation solution after dialysis was centrifuged at 12000 rpm at 4 ℃ for 30 minutes and then equilibrated with 25mmol/L Tris-HCl pH8.0 solution on a DEAE Sepharose FF column. After the sample loading is finished, the chromatographic column is continuously washed for 2-3 column volumes by using the balance buffer solution, and then the elution is carried out by using 25mmol/L Tris-HCl pH8.0 solution containing 0.35mol/L sodium chloride to collect an elution peak.

The linear flow rate in the loading, washing and eluting processes is controlled between 50 cm/h and 200 cm/h.

DEAE Sepharose FF eluted peak was diluted with 50mmol/L acetate-sodium acetate pH4.5 buffer at a volume ratio of 1:10 and applied to CM Sepharose FF column equilibrated with the same buffer. After the sample loading is finished, continuously washing the chromatographic column for 2-3 column volumes by using an equilibrium buffer solution, then eluting by using a 25mmol/L acetic acid-sodium acetate pH4.5 buffer solution containing 0.1-0.15mol/L sodium chloride to remove a main impurity peak, and eluting by using a 25mmol/L acetic acid-sodium acetate pH4.5 buffer solution containing 0.5mol/L sodium chloride to collect a target peak. The linear flow rate in the loading, washing and eluting processes is controlled between 50 cm/h and 200 cm/h.

The purity of the novel interferon alpha separated by the CM Sepharose FF chromatographic column is respectively detected by SDS-PAGE electrophoresis plus Coomassie brilliant blue staining method and molecular exclusion HPLC method, and the result is more than 97%. The specific activity was determined to be not less than 3.0X 10 by "interferon activity assay" and "protein assay" as specified in the pharmacopoeia of the people's republic of China, 2020 edition (three)⁸IU/mg。

Example 2

The interferon with the amino acid sequence shown in SEQ ID No.1 prepared in the example 1 is prepared into an aerosol inhalation preparation for preventing and treating respiratory diseases, wherein the mannitol is 45mg/mL, the interferon with the amino acid sequence shown in SEQ ID No.1 is 30 mu g/mL, the disodium hydrogen phosphate hydrate is 15.5mg/mL, the sodium dihydrogen phosphate hydrate is 4.95mg/mL, and the sodium chloride is 8.7 mg/mL. (formulation 1) (preparation A)

Example 3

The interferon with the amino acid sequence shown in SEQ ID No.1 prepared in the example 1 is prepared into an aerosol inhalation preparation for preventing and treating respiratory diseases, wherein the mannitol is 45mg/mL, the interferon with the amino acid sequence shown in SEQ ID No.1 is 50 mu g/mL, the disodium hydrogen phosphate hydrate is 15.5mg/mL, the sodium dihydrogen phosphate hydrate is 4.95mg/mL, and the sodium chloride is 8.7 mg/mL. (preparation B)

Example 4

The interferon with the amino acid sequence shown in SEQ ID No.1 prepared in the example 1 is prepared into an aerosol inhalation preparation for preventing and treating respiratory diseases, wherein mannitol is 1mg/mL, the interferon with the amino acid sequence shown in SEQ ID No.1 is 0.001 mu g/mL, disodium hydrogen phosphate hydrate is 31mg/mL, sodium dihydrogen phosphate hydrate is 9.9mg/mL, and sodium chloride is 17.4 mg/mL.

Example 5

The interferon with the amino acid sequence shown in SEQ ID No.1 prepared in the example 1 is prepared into an aerosol inhalation preparation for preventing and treating respiratory diseases, wherein the mannitol is 80mg/mL, the interferon with the amino acid sequence shown in SEQ ID No.1 is 200 mu g/mL, the disodium hydrogen phosphate hydrate is 20mg/mL, the sodium dihydrogen phosphate hydrate is 6.5mg/mL, and the sodium chloride is 9.2 mg/mL.

Example 6

The difference from example 2 is that the concentration of interferon whose amino acid sequence is shown in SEQ ID No.1 is 80. mu.g/mL, and the rest is the same as example 2.

Example 7

The difference from example 2 is that the concentration of interferon whose amino acid sequence is shown in SEQ ID No.1 is 100. mu.g/mL, and the rest is the same as example 2.

Comparative example 1

The difference from example 2 is that PEG600 is used instead of mannitol, and the rest is the same as example 2. (formulation 2)

Comparative example 2

The difference from example 2 is that albumin is used instead of mannitol, and the rest is the same as example 2. (formulation 3)

Comparative example 3

The difference from example 2 is that chitosan is used instead of mannitol, and the rest is the same as example 2. (formulation 4)

Comparative example 4

The difference from example 2 is that mannitol was replaced by medium molecular weight hyaluronic acid, and the rest is the same as example 2. (formulation 5)

Example 8

The biological activity and the sample particle size of example 2 and comparative examples 1 to 4 were measured, respectively, wherein the biological activity was measured by: the determination is carried out by an interferon activity determination method specified in the pharmacopoeia of the people's republic of China 2020 edition (three and four), and the detection method of the particle size of the sample comprises the following steps: using a laser particle size tester (model Winner311XP, measuring mileage 0.1-100 μm), at ambient temperature and humidity: the particle size of the above formulation after atomization (atomizer was a vibrating mesh atomizer) was tested at 25 ℃ and 69% RH. The results are shown in FIGS. 1 to 3.

As can be seen from fig. 1-3, the aerosolized inhalation formulation of the present invention has higher biological activity and a more uniform, more suitable, more favorable particle size for aerosolized inhalation, and a particle size volume distribution and number distribution ratio of <3 μm are large, compared to other aerosolized inhalation formulations that do not contain mannitol.

Example 9

The particle sizes of the samples of example 2 and example 3 were measured, respectively, and the particle sizes of the samples were measured by the same method as in example 8. Each group was repeated three times and finally the mean was plotted. The median particle size of the preparation buffer solution test is as follows by taking the preparation buffer solution as a control (namely, the control group is not added with interferon with an amino acid sequence shown as SEQ ID No. 1): 3.201 μm. Example 2 median particle size Xv50 ═ 3.188 μm after aerosol inhalation formulation testing, number distribution data: 96.548% of <3 μm and 99.417% of <5 μm, meeting the requirements of medical atomization. The results are shown in fig. 4, and it can be seen from fig. 4 that the aerosol inhalation formulation of the present invention has a more uniform particle size that is more compatible with respiratory aerosol inhalation when in use.

Example 10

The stability of the activity of the aerosol inhalation formulations of examples 2 and 3 was examined at 2-8 deg.C, -20 deg.C, 37 deg.C and at pH6.5, pH7.0, pH7.5, respectively, and the results are shown in FIGS. 5 and 6.

As can be seen from the results of FIGS. 5 and 6, the aerosolized inhalation formulation of the present invention has the best activity at pH7.0, long shelf life at 2-8 deg.C and-20 deg.C, and the best stability of biological activity.

Example 11

The biological activities of the aerosol inhalation formulation of example 3 before and after atomization were measured by cytopathology using a vibrating mesh nebulizer in combination with the aerosol inhalation formulation of example 3, and the results are shown in table 1, which indicates that the biological activities of the aerosol inhalation formulation of the present invention before and after atomization were not changed much, and there was no statistical difference.

TABLE 1 Change in biological Activity before and after nebulization

Categories	Biological Activity (× 10)⁶IU/ml)
		Before atomization	5.49±0.16
After atomization	5.45±0.34

Example 12

During 10-18 days 1 month in 2020, 35 BALB/c mice were divided into 5 groups of 7 animals each, and males and females were randomly distributed, and the groups were infected with Respiratory Syncytial Virus (RSV) A2 strain by nasal drip for molding. The experimental samples for administration were: vehicle (blank): 20mM phosphate buffer (vehicle, pH 7.0); ribavirin, which is dissolved in common normal saline to prepare mother solution with the concentration of 1.5 and 5.0 mg/mL; diluting the commercial interferon in a solvent to prepare a mother solution; example 3 formulation (LYD-01). The test samples were subjected to the antiviral effect test by intramuscular injection and atomization, and the specific experimental design is shown in table 2. And (4) respectively inspecting indexes such as lung tissue virus capacity, animal weight change and the like. The results are shown in FIGS. 7 and 8.

TABLE 2 in vivo efficacy test design of mice infected with RSVA2 strain

As can be seen from fig. 7 and 8, although no significant virus-inhibitory effect was observed in intramuscular injection of the commercially available interferon and the aerosol inhalation preparation of the present invention, the commercially available interferon and the aerosol inhalation preparation of the present invention were able to inhibit viruses by aerosol administration, and exhibited good in vivo efficacy. Wherein the nebulized administration of commercially available interferon at a set dose can cause weight loss in animals, considered as an adverse side effect. The atomization inhalation preparation of the invention has no weight loss of mice, which shows that the atomization inhalation preparation of the invention can not only achieve the effect of obviously inhibiting RSV virus, but also has no adverse side effect when being used in atomization.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and amendments can be made without departing from the principle of the present invention, and these modifications and amendments should also be considered as the protection scope of the present invention.

Sequence listing

<110> Shenzhen Linyunde Biotechnology Limited

<120> an aerosol inhalation preparation for preventing and treating respiratory diseases and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 158

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Cys Asp Leu Pro Gln Thr His Ser Leu Gly Asn Arg Arg Ala Leu

1 5 10 15

Ile Leu Leu Ala Gln Met Arg Arg Ile Ser Pro Phe Ser Cys Leu Lys

20 25 30

Asp Arg His Asp Phe Gly Phe Pro Gln Glu Glu Phe Asp Gly Asn Gln

35 40 45

Phe Gln Lys Ala Gln Ala Ile Ser Val Leu His Glu Met Ile Gln Gln

50 55 60

Thr Phe Asn Leu Phe Ser Thr Lys Asp Ser Ser Ala Ala Trp Asp Glu

65 70 75 80

Ser Leu Leu Glu Lys Phe Tyr Thr Glu Leu Tyr Gln Gln Leu Asn Asp

85 90 95

Leu Glu Ala Cys Val Ile Gln Glu Val Gly Val Glu Glu Thr Pro Leu

100 105 110

Met Asn Val Asp Ser Ile Leu Ala Val Lys Lys Tyr Phe Gln Arg Ile

115 120 125

Thr Leu Tyr Leu Thr Glu Lys Lys Tyr Ser Pro Cys Ala Trp Glu Val

130 135 140

Val Arg Ala Glu Ile Met Arg Ser Phe Ser Leu Ser Thr Asn

145 150 155

Claims

1. An aerosol inhalation preparation for preventing and treating respiratory diseases, which is characterized by comprising an antiviral active factor, mannitol, a solubilizer and a buffer.

2. The aerosolized inhalation formulation of claim 1, wherein the antiviral activity factor comprises an interferon, and the interferon comprises an interferon having an amino acid sequence shown in SEQ ID No. 1.

3. The aerosolized inhalation formulation of claim 1, wherein the solubilizing agent comprises sodium chloride and the buffer comprises disodium hydrogen phosphate hydrate and sodium dihydrogen phosphate hydrate.

4. The aerosolized inhalation formulation according to claim 1, wherein the concentration of mannitol is 1-80mg/mL and the concentration of antiviral active factor is 0.001-200 μ g/mL.

5. The aerosolized inhalation formulation according to claim 3, wherein the concentrations of the solubilizing agent and the buffer are as follows: 15.5-31mg/mL of disodium hydrogen phosphate hydrate, 4.95-9.9mg/mL of sodium dihydrogen phosphate hydrate and 8.7-17.4mg/mL of sodium chloride.

6. The aerosolized inhalation formulation according to any of claims 1 to 5, characterized in that the pH of the aerosolized inhalation formulation is in the range of 5.5 to 7.6.

7. The aerosolized inhalation formulation according to any of claims 1 to 5, wherein the storage temperature of the aerosolized inhalation formulation is from-30 ℃ to 27 ℃.

8. Use of an inhaled aerosol formulation according to any one of claims 1 to 7 in the manufacture of a product for the prevention or treatment of a respiratory disease.

9. The use according to claim 8, wherein the respiratory disease comprises a respiratory disease caused by a viral infection.

10. The use of claim 9, wherein the virus comprises respiratory syncytial virus, influenza virus and neocoronavirus.