CN109355304A - A method of the initiative glutinous seed germplasm of Endosperm of Sweet Corn - Google Patents

Abstract

The invention discloses a kind of methods for formulating the glutinous seed germplasm of Endosperm of Sweet Corn.The method of the initiative glutinous seed germplasm of Endosperm of Sweet Corn disclosed by the invention includes: Sh2 gene and Wx gene in rite-directed mutagenesis recipient corn, and screening obtains double homozygous mutation corns that Sh2 gene and Wx gene mutate；Wx gene in rite-directed mutagenesis recipient corn, screening obtain the Wx gene single mutation corn of Wx gene mutation；By double homozygous mutation corns and Wx gene single mutation corn hybridization, first-filial generation is obtained；First-filial generation is selfed to get to the sugariness compared with recipient corn and the waxy corn kernel enhanced；First-filial generation is sweet-waxy maizes germplasm, which has extensive market prospects.

Description

A method of the initiative glutinous seed germplasm of Endosperm of Sweet Corn

Technical field

The present invention relates in field of biotechnology, a method of the initiative glutinous seed germplasm of Endosperm of Sweet Corn.

Background technique

Corn is important grain, forage crops and the raw material of industry.Corn, waxy corn, pop corn etc., which are met, to disappear The special eating requirements of the person of expense have biggish kind of industry application value.In recent years, Specialty corns type is needed with market The diversification asked, the Specialty corns for cultivating different mouthfeels have become breeding new direction.

CRISPR(clustered regularly interspaced short palindromic repeats)/Cas (CRISPR-associated) 9 gene editing technologies can efficiently fixed-point implementation target gene it is manually modified, include by design The sgRNA in the selectively targeted genome target site of 20bp gRNA, can realize target site together with Cas9 albumen in vivo Shearing, introduced and be mutated in target site based on homologous recombination repair (HDR) or non-homologous end joining repair mode, be efficient Gene editing technology, at present in various plants and animal realize target gene knockout, deletion, replacement etc..Utilize this Technology can be in double allelic variant bodies of transgenosis present age acquisition gene, and advantage is bright for the breeding of recessive gene control character It is aobvious.By rejecting transgenic element in offspring, non-transgenic recessive Mutants homozygous can be quickly obtained.It can based on this The problems such as avoiding the breeding of recessive gene control character from relying on huge workload caused by complicated backcrossing and Linkage drag.

Summary of the invention

The technical problem to be solved by the present invention is to how construct sweet-waxy maizes germplasm.

In order to solve the above technical problems, present invention firstly provides a kind of method for constructing sweet-waxy maizes germplasm, the side Method includes:

1) the Sh2 gene and Wx gene in rite-directed mutagenesis recipient corn, screening obtain the Sh2 gene and the Wx gene The double homozygous mutation corns to mutate；

2) the Wx gene in recipient corn described in rite-directed mutagenesis, screening obtain the Wx gene list of Wx gene mutation Mutant maize；

3) by double homozygous mutation corns and the Wx gene single mutation corn hybridization, first-filial generation is obtained；It will be described First-filial generation selfing is to get to the sugariness compared with the recipient corn and the waxy corn kernel enhanced；The first-filial generation As sweet-waxy maizes germplasm.

The recipient corn contains the Sh2 gene and the Wx gene.

The sequence of the Sh2 gene can be sequence 1 in sequence table.The sequence of the Wx gene can be sequence 2 in sequence table.

The ratio of sugariness and the waxy seed enhanced compared with the recipient corn in the self progeny of the first-filial generation For 1:3.

The content or activity of Sh2 gene described in double homozygous mutation corns and the Wx coded by said gene protein are Decline.

The content or activity decline of Wx coded by said gene protein described in the Wx gene single mutation corn.The Wx base Because Sh2 gene described in single mutation corn does not mutate.

In the above method, the screening can obtain target corn by measuring the sequence screening of target gene.

In the above method, Sh2 gene described in rite-directed mutagenesis and the Wx gene using CRISPR/Cas9 method into Row.

In the above method, Sh2 gene described in rite-directed mutagenesis can be by that will target the sgRNA and Cas9 of entitled target sequence 1 It imports in the recipient corn and realizes；The target sequence 1 is the segment of the Sh2 gene.

The recipient corn can be imported by that will target the sgRNA and Cas9 of entitled target sequence 2 by pinpointing the Wx gene Middle realization；The target sequence 2 is the segment of the Wx gene.

In the above method, Sh2 gene described in rite-directed mutagenesis can target the sgRNA of entitled target sequence 1 by that will contain The recombinant vector of expression cassette and Cas9 expression casette is imported in the recipient corn and is realized；The target sequence 1 is the Sh2 base The segment of cause.

Wx gene described in point mutation can target the expression cassette and Cas9 base of the sgRNA of entitled target sequence 2 by that will contain It is realized because the recombinant vector of expression cassette imports in the recipient corn；The target sequence 2 is the segment of the Wx gene.

In the above method, double homozygous mutation corns can be by importing institute for the recombinant vector of entitled recombinant vector 1 It states and screens the corn that the Sh2 gene and the Wx gene mutate in recipient corn and obtain；The recombinant vector 1 contains Target the expression cassette and Cas9 gene table of the expression cassette of the sgRNA of entitled target sequence 1, the sgRNA of the entitled target sequence 2 of targeting Up to box；The target sequence 1 is the segment of the Sh2 gene；The target sequence 2 is the segment of the Wx gene.

The Wx gene single mutation corn can pass through following m1) or m2) obtain:

M1) will entitled recombinant vector 2 recombinant vector import in the recipient corn screen the Wx gene occur it is prominent The corn of change；Expression cassette and Cas9 expression casette of the recombinant vector 2 containing the sgRNA for targeting the target sequence 2；

M2) recombinant vector 1 is imported in the recipient corn and screens the corn that the Wx gene mutates.

In the above method, the target sequence 1 can be 5785-5804 of sequence 1 in sequence table.

The target sequence 2 can be 1909-1928 of sequence 2 in sequence table.

In the above method, the expression cassette of the sgRNA of the entitled target sequence 1 of the targeting may include promoter and entitled The coded sequence of the sgRNA of Sh2-sgRNA；The promoter is U6-2 promoter, and the coded sequence of the Sh2-sgRNA is sequence 9132-9234 of sequence 3 in list.

The expression cassette of the sgRNA of the entitled target sequence 2 of targeting includes the sgRNA of promoter and entitled Wx-sgRNA Coded sequence；The promoter is U6-2 promoter, and the coded sequence of the Wx-sgRNA is the of sequence 3 in sequence table 8418-8520.

The Cas9 expression casette is by promoter, Cas9 coded sequence and terminator；The promoter is UBI starting Son, the Cas9 coded sequence are 2150-6415 of sequence 3 in sequence table, and the terminator is NOS terminator.

The expression cassette of the sgRNA of the entitled target sequence 1 of the targeting concretely in sequence table sequence 3 9132- 9629.9235-9629 of sequence 3 are U6-2 promoter, and 9215-9234 are the target sequence 1,9132- 9214 are sgRNA frame sequence.

The expression cassette of the sgRNA of the entitled target sequence 2 of the targeting concretely in sequence table sequence 3 8418- 8915.8521-8915 of sequence 3 are U6-2 promoter, and 8501-8520 are the target sequence 2,8418- 8500 are sgRNA frame sequence.

1878-8388 of the Cas9 expression cassette concretely sequence 3.6421-8388 of sequence 3 are UBI Promoter, 2150-6415 are Cas9 protein sequence, and 1878-2130 are NOS terminator.

In the above method, the recombinant vector 1 can be the recombinant vector containing DNA fragmentation shown in sequence 3 in ordered list.

Wherein, 880-1556 of sequence 3 are CaMV35S promoter, and 284-835 are Bar gene, 103- 277 are CaMV35S poly (A) signal, this three parts constitutes the expression cassette of Bar screening-gene.

In the above method, the recombinant vector 1 can be CPB-Sh2-Wx carrier.The CPB-Sh2-Wx carrier contains sequence DNA fragmentation shown in sequence 3 in table.

In the above method, double homozygous mutation corns are concretely by the institute in the recipient corn in two chromosomes It states target sequence 1 described in Sh2 gene and sports GTGAGGGTGATGGGAGAC, it will be in the recipient corn in two chromosomes The Wx gene described in target sequence 2 sport ACCGGAGCTGAACCTC and obtain.

The Wx gene single mutation corn is concretely by the Wx gene in the recipient corn in two chromosomes Described in target sequence 2 sport ACTTACCCGGAGCTGAACCTC and obtain.

The present invention also provides following X1) or product X2):

X1) reagent set, by the expression cassette of the sgRNA of the entitled target sequence 1 of targeting, the entitled target sequence of targeting The expression cassette of the sgRNA of column 2 and Cas9 expression cassette composition；

X2) biomaterial is following B1) any one of to B6):

B1) following b11) or b12) or b13):

B11) DNA fragmentation shown in sequence 3 in sequence table；

B12 the nucleotide sequence) and b11) limited has 75% or 75% or more identity, and with the same function DNA molecular；

B13) the nucleotide sequence hybridization limited under strict conditions with b11) or b12), and DNA with the same function Molecule；

B2) contain B1) recombinant vectors of the nucleic acid molecules；

B3) contain B1) recombinant microorganisms of the nucleic acid molecules or contain B2) recombinant microorganism of the recombinant vector；

B4) contain B1) plant cells of the nucleic acid molecules or contain B2) plant cell of the recombinant vector；

B5) contain B1) plant tissues of the nucleic acid molecules or contain B2) plant tissue of the recombinant vector；

B6) contain B1) plant organs of the nucleic acid molecules or contain B2) plant organ of the recombinant vector.

X1) reagent set can be used for constructing sweet-waxy maizes germplasm, it can also be used to which preparation is for constructing sweet-waxy maizes kind The product of matter.

Those of ordinary skill in the art can easily adopt by known method, such as the side of directed evolution and point mutation Method is mutated DNA fragmentation shown in sequence 3 of the invention.Those have and sequence of the invention by manually modified DNA fragmentation 75% or the nucleotide of higher identity shown in 3, and there is identical function, it is derived from core of the invention Nucleotide sequence and it is equal to sequence of the invention.

Term " identity " used herein refers to the sequence similarity with native sequence nucleic acid." identity " includes and this hair DNA fragmentation shown in bright sequence 3 is same with 75% or higher or 85% or higher or 90% or higher or 95% or higher The nucleotide sequence of one property.Identity can with the naked eye or computer software is evaluated.Using computer software, two or more Identity between a sequence can be indicated with percentage (%), can be used to evaluate the identity between correlated series.

The stringent condition can be as follows: 50 DEG C, in 7% lauryl sodium sulfate (SDS), 0.5M NaPO₄And 1mM Hybridize in the mixed solution of EDTA, is rinsed in 50 DEG C, 2 × SSC, 0.1%SDS；May be used also are as follows: 50 DEG C, in 7%SDS, 0.5M NaPO₄Hybridize in the mixed solution of 1mM EDTA, is rinsed in 50 DEG C, 1 × SSC, 0.1%SDS；May be used also are as follows: 50 DEG C, 7%SDS, 0.5M NaPO₄Hybridize in the mixed solution of 1mM EDTA, is rinsed in 50 DEG C, 0.5 × SSC, 0.1%SDS；Also It can are as follows: 50 DEG C, in 7%SDS, 0.5M NaPO₄Hybridize in the mixed solution of 1mM EDTA, at 50 DEG C, 0.1 × SSC, 0.1% It is rinsed in SDS；May be used also are as follows: 50 DEG C, in 7%SDS, 0.5M NaPO₄Hybridize in the mixed solution of 1mM EDTA, at 65 DEG C, It is rinsed in 0.1 × SSC, 0.1%SDS；It can also are as follows: in 6 × SSC, the solution of 0.5%SDS, hybridize at 65 DEG C, then with 2 × SSC, 0.1%SDS and 1 × SSC, it is primary that 0.1%SDS respectively washes film；It can also are as follows: in the solution of 2 × SSC, 0.1%SDS, 68 Hybridize at DEG C and wash film 2 times, each 5min, and in 0.5 × SSC, the solution of 0.1%SDS, hybridizes at 68 DEG C and wash film 2 It is secondary, each 15min；Can also are as follows: 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution in, hybridize and wash under the conditions of 65 DEG C Film.

Above-mentioned 75% or 75% or more identity can be 80%, 85%, 90% or 95% or more identity.

The recombinant vector of DNA fragmentation shown in sequence 3 can be contained with existing vector construction.

The carrier can be plasmid, sticking grain, bacteriophage or viral vectors.The plasmid concretely CPB carrier.

The microorganism can be yeast, bacterium, algae or fungi.Wherein, bacterium can be Agrobacterium, such as BMEHA105 agriculture bar Bacterium.

The transgenic plant cells system, Transgenic plant tissue and genetically modified plants organ do not include propagation material.

Above, the recombinant vector can be CPB-Sh2-Wx carrier.The CPB-Sh2-Wx carrier is containing in ordered list DNA fragmentation shown in sequence 3.

The present invention also provides application of the product in building sweet-waxy maizes germplasm.

In the present invention, the sugariness enhancing be may be embodied in soluble sugar content increase.The waxy enhancing may be embodied in In amylopectin content increase.

The recipient corn concretely corn inbred line ZC01.

The present invention by mutation Sh2 and Wx gene obtain have double recessive homozygous genotype parent A (sh2sh2wxwx, I.e. double homozygous mutation corns), and individually mutation Wx gene obtains mono- recessiveness homozygous mutation parent B (Sh2Sh2wxwx, i.e. Wx base of Wx Because of single mutation corn).Two parents are hybridized again, can be obtained with the mutation of Sh2 genetic heterozygosis and Wx gene mutation homozygosis Hybrid F1 (Sh2sh2wxwx).1/4 super sweet tea type seed will be generated in the hybridization kind of groups after free pollination, on fruit ear (sh2sh2wxwx), 3/4 waxy seed (Sh2_wxwx, i.e. Sh2Sh2wxwx and Shsh2wxwx), the i.e. glutinous mixed type mouthfeel of sweet tea Special corn kind (Fig. 7), the corn have extensive market prospects.

Detailed description of the invention

Fig. 1 is Sh2 gene structure and representative mutation type.

Fig. 2 is Wx gene structure representativeness mutation type.

Fig. 3 is the identification of mutant soluble sugar content.

Fig. 4 is the identification of mutant amylopectin content.

Fig. 5 is the iodine staining of mutant seed starch and pollen.

Fig. 6 is that sweet tea, glutinous mutant and the glutinous 1:3 segregation ratio fruit ear of sweet tea are shown.

Fig. 7 is the breeding principle of the glutinous 1:3 segregation ratio corn variety of sweet tea on fringe.

Specific embodiment

The present invention is further described in detail With reference to embodiment, and the embodiment provided is only for explaining The bright present invention, the range being not intended to be limiting of the invention.Experimental method in following embodiments is unless otherwise specified Conventional method.Material as used in the following examples, reagent, instrument etc., are commercially available unless otherwise specified. Quantitative test in following embodiment, is respectively provided with three repeated experiments, and results are averaged.In following embodiments, such as without special Illustrate, the 1st of each nucleotide sequence is the 5 ' terminal nucleotides of corresponding DNA in sequence table, and last bit is the 3 ' of corresponding DNA Terminal nucleotide.

In following embodiments corn inbred line ZC01 (Li, C., Liu, C., Qi, X., Wu, Y., Fei, X., Mao, L.,...&Xie,C.(2017).RNA‐guided Cas9 as an in vivo desired‐target mutator in Maize.Plant biotechnology journal, 15 (12), 1566-1576) public can obtain the biology from applicant Material, the biomaterial are only attached most importance to used in the related experiment of duplicate invention, not can be used as other purposes and are used.

In following embodiments CPB carrier (bibliography: Li, C., Liu, C., Qi, X., Wu, Y., Fei, X., Mao, L.,...&Xie,C.(2017).RNA‐guided Cas9 as an in vivo desired‐target mutator in Maize.Plant biotechnology journal, 15 (12), 1566-1576.), the public can obtain the life from applicant Object material, the biomaterial are only attached most importance to used in the related experiment of duplicate invention, not can be used as other purposes and are used.

The present invention is using corn inbred line ZC01 as acceptor material, to have upstream-downstream relationship in cornstarch synthesis access Two key gene Sh2 genes and Wx gene are target, carry out gene editing using CRISPR/Cas9 method, it is glutinous to have formulated sweet tea Mixed type mouthfeel Chemical mutagenesis.Sh2 gene is located at No. 3 chromosomes of corn, and overall length 11562bp, totally 18 exons (scheme by sequence 1 1), 5706-5930 of sequence 1 are 4 exons.Wx gene is located at No. 9 chromosomes, and overall length 3866bp, totally 13 show outside Sub (sequence 2, Fig. 2), 1857-1966 of sequence 2 are 7 exon of Wx gene.

The building of embodiment 1, rite-directed mutagenesis gene editing carrier

1, target sequence is designed

Sh2 site-directed point mutation target sequence are as follows: 5 '-GTGAGGGTGATGGGATTGAC-3 ', the sequence are located at Sh2 gene 4 Exon (Fig. 1), i.e. 5785-5804 of sequence 1；

Wx site-directed point mutation target sequence are as follows: 5 '-GAGGTTCAGCTCCGGGTAGT-3 ', the sequence are located at Wx gene 7 Exon (Fig. 2), i.e. 1909-1928 of sequence 2.

2, the building of recombinant vector

Building is used for the gene editing carrier of rite-directed mutagenesis Sh2 gene and Wx gene, the expression of sgRNA in the two carriers Driving is driven using RNA polymerase three classes promoter U6-2.

U6-2 promoter sequence are as follows: AATTGGCCCTTACAAAATAGCTAGACGTGCAGGTGGCTGGATGTGCGCTCC CTGAATATCAACTTGTGTCTCCTCCGATTCAGTCCGCAGATGAAACTTGGTAATAACTGCAGCTGATCCGTCGTCA TTCATGCTATGCAGGGGATTCGATCTTCAGCATGTGCAGTGCAGGCAACAACAATCTACGTTGTCTGGGCTTGCGA TAGGTACACGACCACGAGGGAAGGCAACGCGTGATGTATGGGCCGCGCCTAAGCATCCAGCCCACGCGGGCGTGCG CGTCGTCGCTACGGCTTGCGGGGGAAGGGATCAAGGGACGAACCGAGAACTAGTACCAGACCGGCCAGCGAGCATT GCAGACACCGGCTTATAAGTTCAGCTGCGACCACCGCTCC。

Used gRNA frame sequence are as follows: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTA TCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT。

CPB-Sh2-Wx gene editing carrier construction method is to design 4 primer CU-F:cggccagtgccaagcttCT AATTGGCCCTTACAAAATAGCTAGA, GW-R:actacccggagctgaacctcGGAGCGGTGGTCGCAGC, GS-F:ga GgttcagctccgggtagtGTTTTAGAGCTAGAAATAGCAAGTTAAA, CS-R:gctgcactgcacaagcttAAAAAA AGCACCGACTCGG.U6-2 promoter first is expanded with CU-F and GW-R, then expands sgRNA skeleton with GS-F and CS-R.Finally use CU-F and CS-R overlapping U6-2 starting subdivision and sgRNA skeleton part.U6-2 promoter is Chong Die with gRNA and sgRNA skeleton Afterwards, then by overlapping fragments U6-2:gRNA_Wx: sgRNA passes through homologous recombination mode and the gene editing base through HindIII linearisation Plinth support C PB carrier (having included Cas9 protein expression box) forms circular plasmid vector CPB-Wx, further uses PmeI digestion line Property.The sgRNA expression cassette structure for targeting Sh2 is entered wherein.Specific construction method is to design 4 primer C-F:tcaaacactg AtagtttAATTGGCCCTTACAAAATAGCTAGA, GSH-R:gtcaatcccatcaccctcacGGAGCGGTGGTCGCAGC, GSH-F:gtgagggtgatgggattgacGTTTTAGAGCTAGAAATAGCAAGTTAAA, C-R:tttcccgccttcagttt AAAAAAAGCACCGACTCGG.U6-2 promoter is expanded with C-F and GSH-R first, then expands sgRNA bone with GSH-F and C-R Frame obtains U6-2:gRNA finally with the part overlapping U6-2 C-F and C-R and the part sgRNA_Sh2: sgRNA, and pass through homologous recombination Mode is connected into the carrier of PmeI linearization for enzyme restriction, and the support C PB-Sh2-Wx eventually for gene editing is built into.

(there is fixed point editor's gene in plant after converting for the area T-DNA of conversion in CPB-Sh2-Wx carrier The region of DNA domain of function) sequence is shown in sequence 3 in sequence table.Wherein 6421-8388 of sequence 3 are UBI promoter, 2150- 6415 are Cas9 protein sequence, and 1878-2130 are NOS terminator, this three parts constitutes Cas9 expression cassette.Sequence 3 9235-9629 be U6-2 promoter, 9215-9234 be Sh2 site-directed point mutation target sequence (be denoted as target sequence 1), 9132-9214 are sgRNA frame sequence, this three parts constitutes the sgRNA expression cassette of targeting Sh2 gene, express target To the sgRNA of Sh2 gene, which is denoted as Sh2-sgRNA.8521-8915 of sequence 3 are U6-2 promoter, the 8501-8520 are Wx site-directed point mutation target sequence (being denoted as target sequence 2), and 8418-8500 are sgRNA frame sequence, This three parts constitutes the sgRNA expression cassette of targeting Wx gene, which is denoted as Wx- by the sgRNA of expression targeting Wx gene sgRNA.880-1556 of sequence 3 are CaMV35S promoter, and 284-835 are Bar gene, and 103-277 are CaMV35S poly (A) signal, this three parts constitute the expression cassette of Bar screening-gene.

The stabilization genetic transformation of 2 corn directed gene editor's carrier of embodiment

One, the acquisition of transgenic plant

1, the support C PB-Sh2-Wx of targeting Sh2 gene and Wx gene that embodiment 1 is built is imported into BMEHA105 agriculture In bacillus competent cell (Beijing Bo Maide gene technology Co., Ltd: BC303-01), recombinational agrobacterium is obtained.

2, the recombinational agrobacterium obtained using N6 fluid nutrient medium incubation step 1, obtains bacterium solution OD_600nmFor 0.8 recombination Agrobacterium bacterium solution, 5000r/min are centrifuged 10min, collect thallus, (it is by 4g that 1L, which infects buffer, with the buffer that infects prepared The N6 salt of the vitamin containing N6,2mg 2,4-D, 100mg inositol, 0.7gL- proline, 68.4g sucrose, 36g glucose, 1mL nitre What sour silver (10mg/mL), 1mL acetosyringone (100mol/L) and water were uniformly mixed so as to obtain, pH5.2) suspension thalline, make OD_600nmValue It is 0.5 or so, then 28 DEG C, 150r/min concussion 0.5h obtain infected liquid.

3, the callus to grow fine that corn inbred line ZC01 rataria induces is immersed in and is infected in buffer immersion 1h is then transferred in the infected liquid of step 2 preparation and impregnates 15min, dries, the callus after being infected.

4, the callus after infecting step 3 put to co-culture base (1L co-culture base be by 4g vitamin containing N6 N6 salt, 2mg 2,4-D, 30g sucrose, 8g agar, 1mL silver nitrate (10mg/mL), 1mL acetosyringone (100mol/L), 3mL What L-cysteine (100mg/mL) and water were uniformly mixed so as to obtain, pH5.8), 20 DEG C are cultivated 3 days, and going to recovery media, (1L restores training Feeding base is by N6salts 4g；N6 vitamin(1000×)1ml；2,4-D 1.5mg；L-PROLINE 0.7g；Sucrose 30g；Nitre Sour 5 μM of silver；Ethanesulfonic acid 0.5g；Cefotaxime 100mg；Vancomycin 100mg；What agar 8g and water were uniformly mixed so as to obtain, pH5.8), 28 DEG C culture 10 days, then go to be added glufosinate-ammonium recovery media (1L recovery media contains, N6salts 4g；N6 vitamin(1000×)1ml；2,4-D 1.5mg；L-PROLINE 0.7g；Sucrose 30g；5 μM of silver nitrate；Ethanesulfonic acid 0.5g；Cephalo Thiophene oxime 100mg；Vancomycin 100mg；Bialaphos 1.5mg；Agar 8g；PH is adjusted to 5.8) 28 DEG C dark culture 7 days.Screening is positive Callus.

Wherein, N6 vitamin (1000 ×) is West Beijing Mei Jie Science and Technology Ltd. product, article No. C149.

5, the positive callus for obtaining step 4 goes to inducing embryoid body culture medium (1L inducing embryoid body culture medium is By the MS salt of 4.43g vitamin containing MS (contain inositol), 0.25mg 2,4-D, 30g sucrose, 5mg 6-BA, 4g plant gel, What 1ml cefotaxime (250mg/mL) and water were uniformly mixed so as to obtain, pH5.8), dark culture 2 weeks, then go to (1L points of differential medium Changing culture medium is by the MS salt of 4.43g vitamin containing MS (containing inositol), 30g sucrose, 4g plant gel, 1mL cefotaxime What (250mg/mL) and water were uniformly mixed so as to obtain, pH5.8) be transferred to after growing green seedling root media (1L root media be by What 2.215g 1/2MS, 30g sucrose, 51.55mg MS vitamin, 4g plant gel and water were uniformly mixed so as to obtain, pH5.8) it takes root, Certain altitude is grown to, exposure is cultivated 3 days in air, transplanted seedlings.

6,3 centimetres of plant leaf or so are taken, is put into pipe and grinds sufficiently, the ddH of 500 μ l is added₂O, insertion bar gene inspection It tests paper slip (Beijing Ao Chuanjinbiao Bioisystech Co., Ltd: A07-13-413), the plant for positive band occur is T₀Generation Positive transformant.

Embodiment 3 surpasses the identification of sweet tea Yu glutinous mutant

One, mutant gene type is identified

T₀In generation, obtains 22 positive transformants altogether, and positive transformant is selfed or is hybridized with wild-type corn self-mating system ZC01. Due to super-sweet corn seed with shrinkage phenotype and waxy corn seed has the fine and close opaque phenotype of endosperm, therefore by phenotype to T₀ Seed is selected on selfing fruit ear, chooses shrinkage or glutinous matter seed plants T₁Generation, T₁Generation by 52 mutant strains in tri-leaf period Carry out genome extraction and genotype identification.Using primer pair SH-F (5 '-AGGTATATGCCTAGTTCCATCAAAAG-3 ') and SH-R (5 '-GCAGTGAAACCACAGTTCCCAG-3 ') and WX-F ' (5 '-GAGATGAGCTCCTCGGCGTAG-3 ') and WX-R ' (5 '-AGCCTCAACAACAACCCATACTT-3 ') carry out Sh2 and Wx gene target site areas PCR amplification, use primer CSS (5 '-GCATTTTAGTGGCACGCATT-3 ') and CWS (5 '-GCTGACGGTGAGGACCCT-3 ') carry out target site sequencing, obtain Obtain mutant mutated-genotype.By analysis, in 52 mutant, 4 plants of the mono- recessive mutation of Wx (Sh2Sh2wxwx), Sh2 and Wx gene is 2 plants of heterozygous mutant (Sh2sh2Wxwx), and Sh2 genetic heterozygosis is mutated and Wx Gene Double allelic variant (Sh2sh2wxwx) 1 plant, remaining individual is Sh2-Wx double recessive homozygous mutation (sh2sh2wxwx), including 7 plants of Sh2 and Wx Double homozygous mutation strains.Two gene mutation types of mutant be mainly a base insertion and Individual base missing (Fig. 1, Fig. 2).

Two, the separation of super sweet tea and waxy mutant

T₁In generation, will number three double recessive homozygous mutation strains for 10-24-6,14-34-6,17-33-3 (sh2sh2wxwx) it is selfed, obtains T₂Generation double homozygous mutation strain sw891, sw144, sw893, and produced again by PCR Object sequencing confirm its mutation type be double recessive homozygous mutation, in sw144 two genes have occurred nucleotide missing and Missing is the missing of 2 nucleotide and 4 nucleotide, causes the frameshit of protein coding frame, Sh2 gene claims frameshift mutation that will make ADP glucose pyrophosphorylase large subunit loses activity, and the frameshift mutation of Wx gene leads to do not have pearl starch conjunction into the cell It loses activity (bibliography: Greene, T.&Hannah, L.Maize endosperm ADP-glucose at enzyme pyrophosphorylase SHRUNKEN2 and BRITTLE2 subunit interactions.Plant Cell 10, 1295–1306(1998).).The mono- cryptic mutant of three Wx and Sh2 heterozygosis of numbering as 3-06-5,8-36-1,8-36-2 are dashed forward Become and the bis- allelic variant strain 3-06-4 of Wx are selfed and in T₂Generation identification obtains Wx mono- recessive mutation strain w155, w170, w172, w179.The mutation of Wx gene cause not have into the cell pearl starch synzyme lose activity (bibliography: Shure, M., Wessler,S.&Fedoroff,N.Molecular identification and isolation of the Waxy 35,225-233 (1983) of locus in maize.Cell), so that starch is amylopectin.By by sw144 (sh2sh2wxwx) and w155 (Sh2Sh2wxwx) hybridization obtains the strain SCW1 with Sh2sh2wxwx genotype, with the strain (Sh2Sh2wxwx with Sh2sh2wxwx) there is 1:3 to separate for super sweet tea seed (sh2sh2wxwx) and waxy seed on system's simulation fruit ear The cenospecies of ratio, each strain genotype and targeting regions are as shown in table 1.

Table 1

Three, mutant sugar content measures

The mono- recessive homozygous mutation strain of Sh2-Wx double recessive mutant homozygous strain sw891, sw144, sw893 and Wx obtained Be w170, SWC1 and wild-type corn self-mating system ZC01, using plant soluble sugar content detection kit (BC0030, Solarbio, Beijing) carry out fresh seed soluble sugar content measurement.Randomly select 22 days fruit ear middle part seeds after each strain is pollinated It 10 (SWC1 strain 20), is separated with sharp cutter and obtains grain endosperm part and shred, mixed, then weigh 0.2g or so Sample carries out grinding homogenate, then centrifuging and taking supernatant after boiling water bath heating is dissolved in 10ml distilled water, then dilute 20 times, after Continuous operation carries out to specifications, the soluble sugar content being finally computed multiplied by originally extension rate 20, as sample can Dissolubility sugared content.Such as Fig. 3, it is respectively by measuring the fresh grain endosperm soluble sugar content of sw144, sw891, sw893 10.28%, 7.59%, 7.38% (fresh weight %), it is extremely significant to be higher than the glutinous mixed type strain SWC1 (sugar content 2.04%) of sweet tea, it is glutinous Property mutating strain series w170 (sugar content 1.57%) and wild type ZC01 (WT, sugar content 0.23%).SWC1 and waxy mutant strain It is w170 same extremely significant higher than wild type, shows seed of the SWC type cenospecies than waxy mutating strain series of this research institute initiative More sweet tea.

Four, mutant amylopectin content measures

Further, 22 days seed 10, fruit ear middle parts are using amylopectin content measurement examination after randomly selecting each strain pollination Agent box (K-AMYL, Megazyme, IR) carries out amylopectin content measurement to mutant obtained, and determination step is according to reagent Box operating instruction carries out.Endosperm starch dissolves by heating in DMSO first, and removes lipid molecular with ethyl alcohol, and precipitating re-dissolves In salting liquid, two samples are classified as, it is a later that removal amylopectin precipitating is combined and be centrifuged with ConA, it obtains Amylose solution.The amylose solution for removing amylopectin and total starch solution are used into glucose oxidase/peroxide respectively Change enzyme hydrolysis is D-Glucose.Finally measure amylose solution and the oxidase reagent GOPOD in total starch solution Light absorption value under 510nm excitation wavelength, and according to formula: amylose content=amylose solution light absorption value ÷ always forms sediment Light absorption value × 66.8 × 100% of powder solution acquires the amylose content of each sample, then calculates amylopectin content, Amylopectin content=1- amylose content.

It such as Fig. 4, is computed, branch in the seed starch of the mono- recessive mutation strain of tetra- Wx of w155, w170, w172, w179 Content of starch is respectively 95.97%, 96.85%, 96.68% and 97.43%.The extremely significant wild type ZC01 seed that is higher than forms sediment 82.49% amylopectin content in powder.Show that the Wx gene mutation homozygous lines of this research institute initiative have very high branch Content of starch.

Five, mutant pollen and the identification of endosperm starch iodine staining

Since Wx gene mutation can theoretically cause the change of seed and pollen Starch synthesis access simultaneously, therefore further lead to The iodine staining of seed starch and pollen is crossed to carry out phenotype verifying.It is detected, the Sh2-Wx double recessive mutant sw144 formulated With the mono- cryptic mutant w155 of Wx, after potassium iodide dyeing, seed starch and pollen are dyed to yellowish-brown, show its starch group At mainly being occupied by amylopectin, and wild type either pollen or seed starch, all presentation bluish violet, show to have higher Amylose content (Fig. 5).In addition, the lower dye levels of presentation of sw144 its seed starch and pollen compared with w155, Show that its amylopectin content ratio w155 mutant is lower, confirmed the epistasis of Sh2 gene, after mutant homozygous, in seed Total content of starch decline.

To sum up, this research is using corn inbred line ZC01 as acceptor material, simultaneously using gene editing technology CRISPR/Cas9 Corn Sh2 and Wx gene is targeted, and screens non-transgenic super-sweet corn strain and waxy corn strain in generation behind, is demonstrated The desired phenotype for the strain formulated, 22 days its seed fresh weight soluble sugars after the pollination of Sh2 and Wx double recessive homozygous mutation strain Content reaches 10% (F.W.%) or more, extremely significant to be higher than wild-type corn (soluble sugar content 0.23%).Wx is mono- recessive prominent Amylopectin content is up to 97% or more in mutant system seed starch, and the extremely significant amylopectin higher than control material 82% contains Amount.Meanwhile the Sh2-Wx double recessive mutant homozygous strain sw144 (sh2sh2wxwx) and Wx for obtaining gene editing are mono- recessive prominent Mutant system w155 (Sh2Sh2wxwx) hybridization obtains the strain SCW1 with Sh2sh2wxwx genotype, simulates fruit with the strain Super sweet tea seed (sh2sh2wxwx) and waxy seed (Sh2Sh2wxwx) have the cenospecies (Fig. 6) of 1:3 segregation ratio on fringe, and pass through Chi-square Test demonstrates super sweet tea seed and waxy seed on its fringe and meets 1:3 (212/653) segregation ratio (p < 0.05).Fresh seed can Dissolubility sugared content significantly improves (P < 0.05) than waxy corn.It, can be to related in a variety of corn varieties using the strategy of this research Gene is modified, and the glutinous mixed type flavor Chemical mutagenesis breeding of a variety of segregation ratio sweet teas is carried out, still using the strategy to other Upstream and downstream gene in metabolic pathway carries out related mutation, and being cultivated using upstream-downstream relationship between gene similar has compound phenotype Corn and other crops cenospecies.

<110>Institute of Crop Science, Chinese Academy of Agricultural Science

<120>a kind of method for formulating the glutinous seed germplasm of Endosperm of Sweet Corn

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 11562

<212> DNA

<213>corn (Zea mays L.)

<400> 1

atcctggctt cgcccctcga tctggaggct ggtggccgct ggcgcagcgt acgcaaggca 60

gcatccgacg gcgagctcgt cgcgaggttc tacttcacct acggcgggcg cagcgtggtg 120

atcgggccac cgcgtgcgtg ctgtgtgcgc cggagtttct ggacatggcg gcggcggcac 180

accatcgtgg acgccgtgaa gtgcaagcgc ctgcttccgc tcgcgggctc caccgacgag 240

gtcgacagct ggggcatcgc cgtcgaggac agcgcgagcg tggagtcgtt gagcacgagg 300

tggacggggc atgccgagct gctccgcggc accgtgcgct ccaatagccg accacgcttt 360

cgagctcttc aaggattgat catccgcaac ctgcctcagc aatcggagtg ttgaggtgct 420

cgcgaccgcc gcgcgcgtgc atgccatcca cgaggcgtag tagcccctga cgctgcaggt 480

ttgtctgtga ctcacacacg cacgccatat gtttgttcta atgctctagt gcagcagtgt 540

tgcgaatgcc taactgcaaa agcaccaagt caatcagcgt gggatcacct gaatttaatg 600

ttctttttag ccatcatatg caccatgatg ttgtgcttgc cattaagatc ggggaacgta 660

tccggtgttc aaaggggtac ggtggtcacg tgtacatttt aaatttggaa cgtcgatcca 720

acatctaaca gaagcaccaa ttttacaaag aacccctttc accttcctca cttggtggga 780

cggttcttaa tcaaattaac tgcagccgct ggtatacatg tacatgtggg cccgcctagc 840

ccggcacggc acaggcccac aaaaacacgg tccacaaaag cacgacccac aaaagcacat 900

atctaattat gggccgtgcc gtgccagcac gtgtgcccag tcatcggccc acaattagtt 960

atgtgtgcca ggccgaccca aatagcccaa aataccttaa tatgccagac cggctcatat 1020

acatacaaca gtaatacatc aacaaaacgt ataaaatata tatatgacca aaataaaact 1080

aagatgtttt gtggatgcac attataaacc tttggtcaga aagaaaaaaa tattacaact 1140

agctcacaaa aaatatccag ttctctgttt agtgtttaat tgagtactat acatccatac 1200

agaataaata tacaatgatc atcatcacta ttcactatcc atatctaggt attggttctc 1260

gatggcttat taaagctcta gattctccaa gttatgctag tcatgtgggc tttgacagac 1320

cttagttaaa tactgagtct atattttgtg ggccttagtt aaatgggtcg tggcaggccg 1380

gcccgtgggc ttgacttgag gcccaggcac ggcccacaat gtgggccgtg ccggcccatg 1440

cccacaatta ggttgggcag tgccagatat gggccgtgcc agaaattgtg tgctttgggc 1500

cggcctatta ggcacaacat aaatgtacac ctatagccgc atagccgctg gatgtgagat 1560

gaatgtctca gatttaaaat gtgcacttga gcaccgtacc tctttgaaca acagatatgt 1620

tcctttaaga ttgatggtgg aaaaaaatta gtcagtacct cactgtatgg cggcattgtt 1680

tgattatttc agttcgcacc cgttggacct tgctcattaa aaaagtttat accatggagt 1740

ctttgcatgt agttgtgtag taggggaaga gtggcatagg aggaatcaca acttcagcta 1800

gcttctctag ccttagggta tttttgtctt tttgcagttc ggtcttttcg cagccctgcg 1860

ctgccccccc tgtccgcctg tccctagacc tgttttgcgt cggcggggaa gacagttgac 1920

aggaaggaca cgatcttcgt gtccgatgcc gatcttcatg cgagcagcga gccactacgt 1980

tgcgctgcca gtgtcggcta tggtatccag gcattcgttg tgcacgttga cgatgagctc 2040

gaagccggtc cgggtgaacg cgagcagcac ggtgaggtca acgtcgtaca tccgcacgtc 2100

gatgctgagg ccagccagca gcggcatgac agattgcggc gtcaggagat tgtgccagta 2160

ggtggcgggg ctgggggcag accggcaggc gaggcctatg ggcgggcagt gctgtgagtt 2220

agagcagtgt ggcaatgttg gtggtagtgg tgacaccctt cgggagcgga aggaggctgg 2280

aacttcaggt cagttctatt gccataaata aataaaataa aataaatgag gctcaaaatt 2340

ccaaaatgtc atttcagcgt gtgcaccgct tcataaggcc agtctcgtga atcctacaag 2400

tttgatggta ttctgggcct cgggcatagc ccatttatca taaataagga caattttgta 2460

attctctcct tttctttttg tttgcttgta tttgtatttc acatgggact cacttatgtt 2520

gatgtatttt agcttgtaaa aaagagtaaa aacattattc agtgaagtga cgcattgagt 2580

tcatgattaa gtttcaatta tcctttttaa taggtccatg ccacgcttgt ataaggattg 2640

agtaaaaaaa ctaactttat tacaccacag tagataacaa taagtcatat cagttgcatc 2700

acacaagcac actatttact tcttgttttt ggatcaattc tttggtgtct gtaaacccat 2760

acaacataac ttgaatatga acagcactgc agggataatt gaaacctagg agtaaataaa 2820

atggatgtga acgtttcaga ttatttggca ttctgtaaaa gacccaacac ccaaatgctt 2880

gaaaaaatat atcatgttgt aaaaattcga tctgcatttc cttctgtaag caataaaaca 2940

tggctctttt aagaattacc ttgacaaaaa ggtaaaatat aatatcaata ataactccgg 3000

ataggaaaaa cttattcttc tgcttataat tatatcttaa atttaagtct atgacaatgt 3060

gaaatattta ttgctagtgc tacattttaa tgtgtaatga aagcactttc ttttggacat 3120

tcgaattctc ctttgaaaat gatatactcc tgtgattctg gtttttagga gaattgcatg 3180

catggcctag tggtagcgtt gagataatga gttaagcttt ttgaagtttc taatgtgaat 3240

tgtttttctt ttaacttaaa tactcattca gcgaaagatc ctctagcgta atgggtaagg 3300

attccgagta tcaccttcag gttctgggtt cgaccctcat cgggggcgaa tttcgggctt 3360

ggttaaaaaa aatactctca ctatgccccg cccgctcccg ggttacgttc tgtgcgccac 3420

cctctggctg agctgttgta aagtgggcga tgacggcccg ctagtgatgg ggggcagggg 3480

tggacccaag tacggctgag tgagggcaca tgcccccgcc catttctttg ttctaagtac 3540

tagggtctaa attttcaccg tgagcccccc tgcttagtct aatttagatg cccttgctct 3600

ggtattttga tgctcgtcct tacaagtatg cccttagtca tattttgtcc tgggtccgcc 3660

cttgatgaga ggggccaggg tttagagatt ttctcggccg ggaccaatgt tccggtctct 3720

tcttaatata gtaccgggac agtctttccc tctccggccg agttttttat actcactcta 3780

ggtgcaaacg taagttgttc aggcttgtgc ttaaggatta agaaagtaaa taaaatgacc 3840

atgttacact ttttttattt ataccgtatc gggaaagata aaccatttat ctgtgagtgg 3900

tagcatggtc aaggagaaaa aaatagatgc atagaggttc tgggacgact cacatttaga 3960

gcatagttga aaaggctaaa acaaccagga gggggtgggg tcgggataca taaattttca 4020

tgagtgatgg ttgaactatt gagggtgcaa aataattttt tcaacaaata atgtggtgaa 4080

atacctaaga ggggtgcacc tagcatagat tttttggggc tccccttggc ctctcctttc 4140

ttccgccctg aaaacaacct acatggatac atctgcaacc agagggagta tctgatgctt 4200

tttcctgggc agggagagct atgaggcgta tgtcctcaaa gccactttgc attgtgtgaa 4260

accaatatcg atctttgtta cttcatcatg cgtgaacatt tgtggaaact actagcttac 4320

aagcattagt gacagctcag aaaaaagtta tctctgaaag gtttcatgtg taccgtggga 4380

aatgagaaat gttgccaact caaacacctt caatatgttg tttgcaggca aactcttctg 4440

gaagaaaggt gtctaaaact atgaacgggt tacagaaagg tataaaccac ggctgtgcat 4500

tttggaagta tcatctatag atgtctgttg aggggaaagc cgtacgccaa cgttatttac 4560

tcagaaacag cttcaacaca cagttgtctg ctttatgatg gcatctccac ccaggcaccc 4620

accatcacct atctctcgtg cctgtttatt ttcttgccct ttctgatcat aaaaaatcat 4680

taagagtttg caaacatgca taggcatatc aatatgctca tttattaatt tgctagcaga 4740

tcatcttcct actctttact ttatttattg tttgaaaaat atgtcctgca cctagggagc 4800

tcgtatacag taccaatgca tcttcattaa atgtgaattt cagaaaggaa gtaggaacct 4860

atgagagtat ttttcaaaat taattagcgg cttctattat gtttatagca aaggccaagg 4920

gcaaaattgg aacactaatg atggttggtt gcatgagtct gtcgattact tgcaagaaat 4980

gtgaaccttt gtttctgtgc gtgggcataa aacaaacagc ttctagcctc ttttacggta 5040

cttgcacttg caagaaatgt gaactccttt tcatttctgt atgtggacat aatgccaaag 5100

catccaggct ttttcatggt tgttgatgtc tttacacagt tcatctccac cagtatgccc 5160

tctcatactc tatataaaca catcaacagc atcgcaatta gccacaagat cacttcggga 5220

ggcaagtgcg atttcgatct cgcagccacc ttttttttgt tctgttgtaa gtatactttc 5280

ccttaccatc tttatctgtt agtttaattt gtaattggga agtattagtg gaaagaggat 5340

gagatgctat catctatgta ctctgcaaat gcatctgacg ttatatgggc tgcttcatat 5400

aatttgaatt gctccattct tgccgacaat atattgcaag gtatatgcct agttccatca 5460

aaagttctgt tttttcattc taaaagcatt ttagtggcac gcattttttg tccatgaggg 5520

aaaggaaatc tgttttggtt actttgcttg aggtgcattc ttcatatgtc cagttttatg 5580

gaagtaataa acttcagttt ggtcataaga tgtcatatta aagggcaaac atatattcaa 5640

tgttcaattc atcgtaaatg ttcccttttt gtaaaagatt gcatactcat ttatttgagt 5700

tgcaggtgta tctagtagtt ggaggagata tgcagtttgc acttgcattg gacacgaact 5760

caggtcctca ccagataaga tcttgtgagg gtgatgggat tgacaggttg gaaaaattaa 5820

gtattggggg cagaaagcag gagaaagctt tgagaaatag gtgctttggt ggtagagttg 5880

ctgcaactac acaatgtatt cttacctcag atgcttgtcc tgaaactctt gtaagtatcc 5940

acctcaatta ttactcttac atgttggttt actttacgtt tgtcttttca agggaaattt 6000

actgtatttt ttgggttttg tgggagttct atacttctgt tggactggtt attgtaaaga 6060

tttgttcaaa tagggtcatc taataattgt ttgaaatctg ggaactgtgg tttcactgcg 6120

ttcaggaaaa agtgaattct tggttactgc atgaataact tatggaaata gaccttagag 6180

ttgctgcatg attatcacaa atcattgcta cgatatctta taatagttct ttcgacctcg 6240

cattacatat ataactgcaa ctcgtagttg cgttcaaaaa aaaatgcaac tcttagaacg 6300

ctcaccagtg taatctttcc tgaattgtta tttaatggca tgtatgcact acttgtatac 6360

ttatctagga ttaagtaatc taactctagg ccccatattt gcagcattct caaacacagt 6420

cctctaggaa aaattatgct gatgcaaacc gtgtatctgc tatcattttg ggcggaggca 6480

ctggatctca gctctttcct ctgacaagca caagagctac gcctgctgta agggataaca 6540

ctgaacatcc aacgttgatt actctattat agtattatac agactgtact tttcgaattt 6600

atcttagttt tctacaatat ttagtggatt cttctcattt tcaagataca caattgatcc 6660

ataatcgaag tggtatgtaa gacagtgagt taaaagatta tattttttgg gagacttcca 6720

gtcaaatttt cttagaagtt tttttggtcc agatgttcat aaagtcgccg ctttcatact 6780

ttttttaatt ttttaattgg tgcactatta ggtacctgtt ggaggatgtt acaggcttat 6840

tgatatccct atgagtaact gcttcaacag tggtataaat aagatatttg tgatgagtca 6900

gttcaattct acttcgctta accgccatat tcatcgtaca taccttgaag gcgggatcaa 6960

ctttgctgat ggatctgtac aggtgattta cctcatcttg ttgatgtgta atactgtaat 7020

taggagtaga tttgtgtgga gagaataata aacagatgcc gagattcttc tctaaaagtc 7080

tagatccaaa ggcattgtgg ttcaaaacac tatggacttc taccatttat gtcattactt 7140

tgccttaatg ttccattgaa tggggcaaat tattgattct acaagtgttt aattaaaaac 7200

taattgttca tcctgcaggt attagcggct acacaaatgc ctgaagagcc agctggatgg 7260

ttccagggta cagcagactc tatcagaaaa tttatctggg tactcgaggt agttgatatt 7320

ttctcgttta tgaatgtcca ttcactcatt cctgtagcat tgtttctttg taattttgag 7380

ttctcctgta tttctttagg attattacag tcacaaatcc attgacaaca ttgtaatctt 7440

gagtggcgat cagctttatc ggatgaatta catggaactt gtgcaggtat ggtgttctct 7500

tgttcctcat gtttcacgta atgtcctgat tttggattaa ccaactactt ttggcatgca 7560

ttatttccag aaacatgtcg aggacgatgc tgatatcact atatcatgtg ctcctgttga 7620

tgagaggtaa tcagttgttt atatcatcct aatatgaata tgtcatcttg ttatccaaca 7680

caggatgcat atggtctaat ctgctttcct ttttttccct tcggaagccg agcttctaaa 7740

aatgggctag tgaagattga tcatactgga cgtgtacttc aattctttga aaaaccaaag 7800

ggtgctgatt tgaattctat ggttagaaat tccttgtgta atccaattct tttgttttcc 7860

tttctttctt gagatgaacc cctcttttag ttatttccat ggataacctg tacttgactt 7920

attcagaaat gattttctat tttgctgtag aatctgacac taaagctaat agctactgat 7980

gttgcagaga gttgagacca acttcctgag ctatgctata gatgatgcac agaaatatcc 8040

ataccttgca tcaatgggca tttatgtctt caagaaagat gcacttttag accttctcaa 8100

gtaatcactt tcctgtgact tttttctatc caactcctag tttaccttct aacagtgtca 8160

attcttaggt caaaatatat tcaattacat gactttggat ctgaaatcct cccaagagct 8220

gtactagatc atagtgtgca ggtaagtctg atctgtctgg agtatgtgtt ctgtaaactg 8280

taaattcttc atgtcaaaaa gttgtttttg tttccagttt ccactagttt ttatttacca 8340

atgcacgatt tatgtatttt cgcttccatg catcatacat actaacaata cattttacgt 8400

attgtgttag gcatgcattt ttacgggcta ttgggaggat gttggaacaa tcaaatcatt 8460

ctttgatgca aacttggccc tcactgagca ggtactctgt catgtattct gtactgcata 8520

tatattacct ggaattcaat gcatagaatg tgttagacca tcttagttcc atcctgtttt 8580

cttcaattag cttatcattt aatagttgtt gactagaatc taaacacaaa tttacctaat 8640

atgtttctct cttcagcctt ccaagtttga tttttatgat ccaaaaacac ctttcttcac 8700

tgcaccccga tgcttgcctc cgacgcaatt ggacaagtgc aaggtatatg tcttaccgag 8760

cacaattgtt acctgagcaa gattttgtgt acttgacttg ttctcctcca cagatgaaag 8820

atgcatttat ctcagatggt tgcttactga gagaatgcaa catcgagcat tctgtgattg 8880

gagtctgctc acgtgtcagc tctggatgtg aactcaaggt acatactctg ccaatgtata 8940

tgctgatgtt ttatacattc tcttgcataa tttgattcga gtcaccacaa ttagtgtaac 9000

tgcaatctac tcttgagtat accatttcaa caccaggcat caccaaatca cacagaacaa 9060

tagcaacgaa gccttttagt tccaagaaat ttagggtagc ctagagttga aatctaacaa 9120

aacaaaagtc aaagctctat cacgtggata gttgttttcc atgcactctt atttaagcta 9180

aatttttggg tatactacat ccatttaatt attgttttat tgcttcttcc ctttgccttt 9240

cccccattac tatcgcgtct taagatcata ctacgcacta gtgtctttag aggtctctgg 9300

tggacatgtt caaaccatct caatcgaatc ggtgttggac aagtttttct tgaatttgtg 9360

ctacacctaa cctatcacgt atatcatcgt ttcaaacttg atccttcttg tatcatcata 9420

aatccaatgc aacatacgca tttctgcaac atttatctgt tgaacatgtc atctttttgt 9480

aggttaacat tatgcaccat acaatgtagc atgtctaatc atcatcctat aaaatttaca 9540

ttttagctta tgtggtatcc tcttgccact tagaacatca tatgtttgat gccatttcat 9600

ccaccctgct ttgattctat ggctaacatc ttcattaata tcctcgcctc tctgtatcat 9660

tggtcctaaa tatggaaata cattctttct gggcactact tgaccttcca aactaacgtc 9720

tcctttgatc ctttcttgtg tgtagtagta ccgaagtcac atctcatata ttcggtttta 9780

gttctactaa gtcccgggtt cgatccccct caggggtaaa tttcgggctt ggtaaaaaaa 9840

atcccctcgc tgtgtcccgc ccgctctcgg ggatcgatat cctgcgcgcc accctccggc 9900

tgggcattgc agagtgggca gttgatcggc tcgttagtga tggggagcgg ggttcaaggg 9960

ttttctcggc cgggaccatg tttcggtctc ttaatataat accgggaggg cagtctttcc 10020

ctccccggtc gagttttagt tctaccgagt ctaaaacctt tggactctag agtcccctgt 10080

cacaactcac aactctagtt ttctatttac ttctacctag cgtttattaa tgatcactat 10140

atcgtctgta aaaagcatac accaaggtaa tccccttgta tgtcccttgt aatattatcc 10200

atcacaagaa aaaaaaggta aggctcaaag ttgacttttg atataatcct attctaatcg 10260

agaagtcatc tgtatcttcg tctcttgttc gaacactagt cacaattttt tttgtacatg 10320

ttcttaatga gtccaacgta atattccttg atattttgta agccctcatc aagtcaatga 10380

aaatcacgtg taggtccttc atttgttcct tatactgctc catcacttgt ctcattaaga 10440

aaatatctct catagttaac cttttggcat gaaacaaaat cacacagaag ttgtttcctt 10500

tttttaagat cccacacaaa agaggtttga tctaaggaat ctggatccct gacaggttta 10560

tcaaaatcct ttgtgttttt cttaaaactg aatattcctc cagcttctag tattgatgta 10620

atattcaatc tgtttagcaa gtgaacacct tggttcttgt tgttactgta catcccaccc 10680

acccccccga ggcccagatt accacgacat gaatacaaga atattgaacc cagatctaga 10740

gtttgtttgt actgttgaaa atcggtgaca attcattttg ttattgcgct ttctgataac 10800

gacaggactc cgtgatgatg ggagcggaca cctatgaaac tgaagaagaa gcttcaaagc 10860

tactgttagc tgggaaggtc ccagttggaa taggaaggaa cacaaagata aggtgagtat 10920

ggatgtggaa ccaccggtta gttcccaaaa atatcactca ctgatacctg atggtatcct 10980

ctgattattt tcaggaactg tatcattgac atgaatgcta ggattgggaa gaacgtggtg 11040

atcacaaaca gtaaggtgag cgagcgcacc tacatgggtg cagaatcttg tgtgctcatc 11100

tatcctaatt cggtaattcc tatccagcgc tagtcttgtg accatggggc atgggttcga 11160

ctctgtgaca gggcatccaa gaggctgatc acccggaaga agggtactac ataaggtctg 11220

gaatcgtggt gatcttgaag aatgcaacca tcaacgatgg gtctgtcata tagatcggct 11280

gcgtttgcgt ctacaaaaca agaacctaca atggtattgc atcgatggat cgtgtaacct 11340

tggtatggta agagccgctt gacaggaagt cgagcgttcg ggcgcaagat gcgttgtctg 11400

gcatgctgtt ccttgaccat ttgtgctgct agtatgtact gttataagct gccctagaag 11460

ttgcagcaaa cctttttatg aacctttgta tttccattac ctgctttgga tcaactatat 11520

ctgtcatcct atatattact aaatttttac gtgtttttct aa 11562

<210> 2

<211> 3866

<212> DNA

<213>corn (Zea mays L.)

<400> 2

gcgagggccg agagcagcgc gcggccgggt cacgcaacgc gccccacgta ctgccctccc 60

cctccgcgcg cgctagaaat accgaggcct ggaccggggg gggccccgtc acatccatcc 120

atcgaccgat cgatcgccac agccaacacc acccgccgag gcgacgcgac agccgccagg 180

aggaaggaat aaactcactg ccagccagtg aagggggaga agtgtactgc tccgtccacc 240

agtgcgcgca ccgcccggca gggctgctca tctcgtcgac gaccaggttc cgttccgatc 300

ctgtccttga gtttcgtcca gatcctggcg tgtatctacg tgtttgatga tccaggttca 360

tcgaatctaa atctgtccgt gcacatgtct tctctctctc tgtctgtctg ctatgcagtg 420

gattaatcgg catggcggct ctagccacgt cgcagctcgt cgcaacgcgc gccggcctgg 480

gcgtcccgga cgcgtccacg ttccgccgcg gcgccgcgca gggcctgagg gggggccgga 540

cggcgtcggc ggcggacacg ctcagcatgc ggaccagcgc gcgcgcggcg cccaggctcc 600

agcaccagca gcagcagcag gcgcgccgcg gggccaggtt cccgtcgctc gtcgtgtgcg 660

ccagcgccgg catgaacgtc gtcttcgtcg gcgccgagat ggcgccgtgg agcaagaccg 720

gcggcctcgg cgacgtcctc ggcggcctgc cgccggccat ggccgtaagc gcgcgcaccg 780

agacatgcat ccgttggatc gcgtcttctt cgtgctcttg ccgcgtgcat gatgcatgtg 840

tttcctcctg gctcgtgtat gtgactgacg tgtgtgttcg ggcatgcaat gcatgcaggc 900

gaatgggcac cgtgtcatgg tcgtctctcc ccgctacgac cagtacaagg acgcctggga 960

caccagcgtc gtgtccgagg tacggccacc gagatcagat tcagatcaca catcacagtc 1020

acacacaccg tcatatgaac ctttctctgc tctgatgcct gcagatcaag atgggagaca 1080

ggtacgagac ggtcaggttc ttccactgct acaagcgcgg agtggaccgc gtgttcgttg 1140

accacccact gttcctggag agggtgagat gagatctgat cactcgatac gcaattacca 1200

ccccattgta agcagttaca gtgagccttt ttttttgccc ccgcctggtc gctggtttca 1260

ggtttgggga aagaccgagg agaagatcta cgggcctgac gctggaacgg actacaggga 1320

caaccagctg cggttcagcc tgctatgcca ggtcaggatg gcttggtact acaacttcat 1380

atcatctgta tgcagcagta tacactgatg agaaatgcat gctgttctgc aggcagcact 1440

tgaagctcca aggatcctga gcctcaacaa caacccatac ttctccggac catacggtaa 1500

gagttgcagt cttcgtatat atatctgttg agctcgagaa tcttcacagg aaacggccca 1560

tcagacggac tgtcatttta tactgactac tgctgctgct cttcgtccat ccatccatac 1620

aaggggagga cgtcgtgttc gtctgcaacg actggcacac cggccctctc tcgtgctacc 1680

tcaagagcaa ctaccagtcc cacggcatct acagggacgc aaaggttgcc ttctctgaac 1740

tgaacaacgc cgtcttcgtt ctccatgctc gtatacctcg tctggtggtg gtgcttctct 1800

gagaaactga aactgactgc atgtctgtct gaccatcttc acgtactacc taccagaccg 1860

ctttctgcat ccacaacatc tcctaccagg gccggttcgc cttctccgac tacccggagc 1920

tgaacctccc ggagagattc aagtcgtcct tcgatttcat cgacgggtct gttttcctgc 1980

gtgcatgtga acattcatga acggtaaccc acaactgttc gcgtcctgct ggttcattat 2040

ctgacctgga ttgcattgca gctacgagaa gcccgtggaa ggccggaaga tcaactggat 2100

gaaggccggg atcctcgagg ccgacagggt cctcaccgtc agcccctact acgccgagga 2160

gctcatctcc ggcatcgcca ggggctgcga gctcgacaac atcatgcgcc tcaccggcat 2220

caccggcatc gtcaacggca tggacgtcag cgagtgggac cccagcaggg acaagtacat 2280

cgccgtgaag tacgacgtgt cgacggtgag ctggctagct agctgattct gctgcctggt 2340

cctcctgctc atgctggttc ggttctgacg cggcaagtgt acgtacgtgc gtgcgacggt 2400

ggtgtggtgt ccggttcagg ccgtggaggc caaggcgctg aacaaggagg cgctgcaggc 2460

ggaggtcggg ctcccggtgg accggaacat cccgctggtg gcgttcatcg gcaggctgga 2520

agagcagaag ggacccgacg tcatggcggc cgccatcccg cagctcatgg agatggtgga 2580

ggacgtgcag atcgttctgc tggtacgtgt gcgccgcccg ccacccggct actacatgcg 2640

tgtatcgttc tactggaaca tacgtgtgag caacgcgatg gataatgctg cagggcacgg 2700

gcaagaagaa gttcgagcgc atgctcatga gcgccgagga gaagttccca ggcaaggtgc 2760

gcgccgtggt caagttcaac gcggcgctgg cgcaccacat catggccggc gccgacgtgc 2820

tcgccgtcac cagccgcttc gagccctgcg gcctcatcca gctgcagggg atgcgatacg 2880

gaacggtacg agagagaaaa aaaaacatcc tgaatcctga cgagagggac agagacagat 2940

tgattatgaa tgcttcatcg atttgaattg attgatcgat gtctcccgct gcgactcttg 3000

cagccctgcg cctgcgcgtc caccggtgga ctcgtcgaca ccatcatcga aggcaagacc 3060

gggttccaca tgggccgcct cagcgtcgac gtaagcctag ctctgccatg atctttcttc 3120

tttctgtatg tatgtatgta tgaatcagca ccgccgttct tgtttcgtcg tcctctcttc 3180

ccagtgcaac gtcgtggagc cggcggacgt caagaaggtg gccaccacct tgcagcgcgc 3240

catcaaggtg gtcggcacgc cggcgtacga ggagatggtg aggaactgca tgatccagga 3300

tctctcctgg aaggtacgta cgcccgcccc gccagagcag agcgccaaga tcgatcgacc 3360

gaccgaccac acgtacgcgc ctcgctcctg tcgctgaccg tggtttaatt tgcgaaatgc 3420

gcagggccct gccaagaact gggagaacgt gctgctcagc ctcggggtcg ccggcggcga 3480

gccaggggtc gaaggcgagg agatcgcgcc gctcgccaag gagaacgtgg ccgcgccctg 3540

aagagttcgg cctgcaggcc ccctgatctc gcgcgtggtg caaacatgtt gggacatctt 3600

cttatatatg ctgtttcgtt tatgtgatat ggacaagtat gtgtagctgc ttgcttgtgc 3660

tagtgtaata tagtgtagtg gtggccagtg gcacaaccta ataagcgcat gaactaattg 3720

cttgcgtgtg tagttaagta ccgatcggta attttatatt gcgagtaaat aaatggacct 3780

gtagtggtgg agtaaataat ccctgctgtt cggtgttctt atcgcttctc gtatagatgt 3840

tatatagagt acattttctt tctgaa 3866

<210> 3

<211> 9668

<212> DNA

<213>artificial sequence

<400> 3

tggcaggata tattgtggtg taaacaaatt gacgcttaga caacttaata acacattgcg 60

gacgttttta atgtactgaa ttaacgccga attaattcgg gggatctgga ttttagtact 120

ggattttggt tttaggaatt agaaatttta ttgatagaag tattttacaa atacaaatac 180

atactaaggg tttcttatat gctcaacaca tgagcgaaac cctataggaa ccctaattcc 240

cttatctggg aactactcac acattattat ggagaaactc gagtcaaatc tcggtgacgg 300

gcaggaccgg acggggcggt accggcaggc tgaagtccag ctgccagaaa cccacgtcat 360

gccagttccc gtgcttgaag ccggccgccc gcagcatgcc gcggggggca tatccgagcg 420

cctcgtgcat gcgcacgctc gggtcgttgg gcagcccgat gacagcgacc acgctcttga 480

agccctgtgc ctccagggac ttcagcaggt gggtgtagag cgtggagccc agtcccgtcc 540

gctggtggcg gggggagacg tacacggtcg actcggccgt ccagtcgtag gcgttgcgtg 600

ccttccaggg gcccgcgtag gcgatgccgg cgacctcgcc gtccacctcg gcgacgagcc 660

agggatagcg ctcccgcaga cggacgaggt cgtccgtcca ctcctgcggt tcctgcggct 720

cggtacggaa gttgaccgtg cttgtctcga tgtagtggtt gacgatggtg cagaccgccg 780

gcatgtccgc ctcggtggca cggcggatgt cggccgggcg tcgttctggg ctcatggtag 840

actcgagaga gatagatttg tagagagaga ctggtgattt cagcgtgtcc tctccaaatg 900

aaatgaactt ccttatatag aggaagggtc ttgcgaagga tagtgggatt gtgcgtcatc 960

ccttacgtca gtggagatat cacatcaatc cacttgcttt gaagacgtgg ttggaacgtc 1020

ttctttttcc acgatgctcc tcgtgggtgg gggtccatct ttgggaccac tgtcggcaga 1080

ggcatcttga acgatagcct ttcctttatc gcaatgatgg catttgtagg tgccaccttc 1140

cttttctact gtccttttga tgaagtgaca gatagctggg caatggaatc cgaggaggtt 1200

tcccgatatt accctttgtt gaaaagtctc aatagccctt tggtcttctg agactgtatc 1260

tttgatattc ttggagtaga cgagagtgtc gtgctccacc atgttcacat caatccactt 1320

gctttgaaga cgtggttgga acgtcttctt tttccacgat gctcctcgtg ggtgggggtc 1380

catctttggg accactgtcg gcagaggcat cttgaacgat agcctttcct ttatcgcaat 1440

gatggcattt gtaggtgcca ccttcctttt ctactgtcct tttgatgaag tgacagatag 1500

ctgggcaatg gaatccgagg aggtttcccg atattaccct ttgttgaaaa gtctcaatag 1560

ccctttggtc ttctgagact gtatctttga tattcttgga gtagacgaga gtgtcgtgct 1620

ccaccatgtt ggcaagctgc tctagccaat acgcaaaccg cctctccccg cgcgttggcc 1680

gattcattaa tgcagctggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa 1740

cgcaattaat gtgagttagc tcactcatta ggcaccccag gctttacact ttatgcttcc 1800

ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga 1860

catgattacg aattcccgat ctagtaacat agatgacacc gcgcgcgata atttatccta 1920

gtttgcgcgc tatattttgt tttctatcgc gtattaaatg tataattgcg ggactctaat 1980

cataaaaacc catctcataa ataacgtcat gcattacatg ttaattatta catgcttaac 2040

gtaattcaac agaaattata tgataatcat cgcaagaccg gcaacaggat tcaatcttaa 2100

gaaactttat tgccaaatgt ttgaacgatc ggggaaattc gagctcttac tttttctttt 2160

ttgcctggcc ggcctttttc gtggccgccg gccttttgtc gcctcccagc tgagacaggt 2220

cgatccgtgt ctcgtacagg ccggtgatgc tctggtggat cagggtggcg tccagcacct 2280

ctttggtgct ggtgtacctc ttccggtcga tggtggtgtc aaagtacttg aaggcggcag 2340

gggctcccag attggtcagg gtaaacaggt ggatgatatt ctcggcctgc tctctgatgg 2400

gcttatcccg gtgcttgttg taggcggaca gcactttgtc cagattagcg tcggccagga 2460

tcactctctt ggagaactcg ctgatctgct cgatgatctc gtccaggtag tgcttgtgct 2520

gttccacaaa cagctgtttc tgctcattat cctcggggga gcccttcagc ttctcatagt 2580

ggctggccag gtacaggaag ttcacatatt tggagggcag ggccagttcg tttcccttct 2640

gcagttcgcc ggcagaggcc agcattctct tccggccgtt ttccagctcg aacagggagt 2700

acttaggcag cttgatgatc aggtcctttt tcacttcttt gtagcccttg gcttccagaa 2760

agtcgatggg attcttctcg aagctgcttc tttccatgat ggtgatcccc agcagctctt 2820

tcacactctt cagtttcttg gacttgccct tttccacttt ggccaccacc agcacagaat 2880

aggccacggt ggggctgtcg aagccgccgt acttcttagg gtcccagtcc ttctttctgg 2940

cgatcagctt atcgctgttc ctcttgggca ggatagactc tttgctgaag ccgcctgtct 3000

gcacctcggt ctttttcacg atattcactt ggggcatgct cagcactttc cgcacggtgg 3060

caaaatcccg gcccttatcc cacacgatct ccccggtttc gccgtttgtc tcgatcagag 3120

gccgcttccg gatctcgccg ttggccaggg taatctcggt cttgaaaaag ttcatgatgt 3180

tgctgtagaa gaagtacttg gcggtagcct tgccgatttc ctgctcgctc ttggcgatca 3240

tcttccgcac gtcgtacacc ttgtagtcgc cgtacacgaa ctcgctttcc agcttagggt 3300

actttttgat cagggcggtt cccacgacgg cgttcaggta ggcgtcgtgg gcgtggtggt 3360

agttgttgat ctcgcgcact ttgtaaaact ggaaatcctt ccggaaatcg gacaccagct 3420

tggacttcag ggtgatcact ttcacttccc ggatcagctt gtcattctcg tcgtacttag 3480

tgttcatccg ggagtccagg atctgtgcca cgtgctttgt gatctgccgg gtttccacca 3540

gctgtctctt gatgaagccg gccttatcca gttcgctcag gccgcctctc tcggccttgg 3600

tcagattgtc gaactttctc tgggtaatca gcttggcgtt cagcagctgc cgccagtagt 3660

tcttcatctt cttcacgacc tcttcggagg gcacgttgtc gctcttgccc cggttcttgt 3720

cgcttctggt cagcaccttg ttgtcgatgg agtcgtcctt cagaaagctc tgaggcacga 3780

tatggtccac atcgtagtcg gacagccggt tgatgtccag ttcctggtcc acgtacatat 3840

cccgcccatt ctgcaggtag tacaggtaca gcttctcgtt ctgcagctgg gtgttttcca 3900

cggggtgttc tttcaggatc tggctgccca gctctttgat gccctcttcg atccgcttca 3960

ttctctcgcg gctgttcttc tgtcccttct gggtggtctg gttctctctg gccatttcga 4020

tcacgatgtt ctcgggcttg tgccggccca tcactttcac gagctcgtcc accaccttca 4080

ctgtctgcag gatgcccttc ttaatggcgg ggctgccggc cagattggca atgtgctcgt 4140

gcaggctatc gccctggccg gacacctggg ctttctggat gtcctcttta aaggtcaggc 4200

tgtcgtcgtg gatcagctgc atgaagtttc tgttggcgaa gccgtcggac ttcaggaaat 4260

ccaggattgt cttgccggac tgcttgtccc ggatgccgtt gatcagcttc cggctcagcc 4320

tgccccagcc ggtgtatctc cgccgcttca gctgcttcat cactttgtcg tcgaacaggt 4380

gggcataggt tttcagccgt tcctcgatca tctctctgtc ctcaaacagt gtcagggtca 4440

gcacgatatc ttccagaatg tcctcgtttt cctcattgtc caggaagtcc ttgtccttga 4500

taattttcag cagatcgtgg tatgtgccca gggaggcgtt gaaccgatct tccacgccgg 4560

agatttccac ggagtcgaag cactcgattt tcttgaagta gtcctctttc agctgcttca 4620

cggtcacttt ccggttggtc ttgaacagca ggtccacgat ggcctttttc tgctcgccgc 4680

tcaggaaggc gggctttctc attccctcgg tcacgtattt cactttggtc agctcgttat 4740

acacggtgaa gtactcgtac agcaggctgt gcttgggcag caccttctcg ttgggcaggt 4800

tcttatcgaa gttggtcatc cgctcgatga agctctgggc ggaagcgccc ttgtccacca 4860

cttcctcgaa gttccagggg gtgatggttt cctcgctctt tctggtcatc caggcgaatc 4920

tgctgtttcc cctggccaga gggcccacgt agtaggggat gcggaaggtc aggatcttct 4980

cgatcttttc ccggttgtcc ttcaggaatg ggtaaaaatc ttcctgccgc cgcagaatgg 5040

cgtgcagctc tcccaggtgg atctggtggg ggatgctgcc gttgtcgaag gtccgctgct 5100

tccgcagcag gtcctctctg ttcagcttca cgagcagttc ctcggtgccg tccatctttt 5160

ccaggatggg cttgatgaac ttgtagaact cttcctggct ggctccgccg tcaatgtagc 5220

cggcgtagcc gttcttgctc tggtcgaaga aaatctcttt gtacttctca ggcagctgct 5280

gccgcacgag agctttcagc agggtcaggt cctggtggtg ctcgtcgtat ctcttgatca 5340

tagaggcgct caggggggcc ttggtgatct cggtgttcac tctcaggatg tcgctcagca 5400

ggatggcgtc ggacaggttc ttggcggcca gaaacaggtc ggcgtactgg tcgccgatct 5460

gggccagcag gttgtccagg tcgtcgtcgt aggtgtcctt gctcagctgc agtttggcat 5520

cctcggccag gtcgaagttg ctcttgaagt tgggggtcag gcccaggctc agggcaatca 5580

ggtttccgaa caggccattc ttcttctcgc cgggcagctg ggcgatcaga ttttccagcc 5640

gtctgctctt gctcagtctg gcagacagga tggccttggc gtccacgccg ctggcgttga 5700

tggggttttc ctcgaacagc tggttgtagg tctgcaccag ctggatgaac agcttgtcca 5760

cgtcgctgtt gtcggggttc aggtcgccct cgatcaggaa gtggccccgg aacttgatca 5820

tgtgggccag ggccagatag atcagccgca ggtcggcctt gtcggtgctg tccaccagtt 5880

tctttctcag gtggtagatg gtggggtact tctcgtggta ggccacctcg tccacgatgt 5940

tgccgaagat ggggtgccgc tcgtgcttct tatcctcttc caccaggaag gactcttcca 6000

gtctgtggaa gaagctgtcg tccaccttgg ccatctcgtt gctgaagatc tcttgcagat 6060

agcagatccg gttcttccgt ctggtgtatc ttcttctggc ggttctcttc agccgggtgg 6120

cctcggctgt ttcgccgctg tcgaacagca gggctccgat caggttcttc ttgatgctgt 6180

gccggtcggt gttgcccagc accttgaatt tcttgctggg caccttgtac tcgtcggtga 6240

tcacggccca gcccacagag ttggtgccga tgtccaggcc gatgctgtac ttcttgtcgg 6300

ctgctgggac tccgtggata ccgaccttcc gcttcttctt tggggccatc ttatcgtcat 6360

cgtctttgta atcaatatca tgatccttgt agtctccgtc gtggtcctta tagtccatct 6420

gcagaagtaa caccaaacaa cagggtgagc atcgacaaaa gaaacagtac caagcaaata 6480

aatagcgtat gaaggcaggg ctaaaaaaat ccacatatag ctgctgcata tgccatcatc 6540

caagtatatc aagatcaaaa taattataaa acatacttgt ttattataat agataggtac 6600

tcaaggttag agcatatgaa tagatgctgc atatgccatc atgtatatgc atcagtaaaa 6660

cccacatcaa catgtatacc tatcctagat cgatatttcc atccatctta aactcgtaac 6720

tatgaagatg tatgacacac acatacagtt ccaaaattaa taaatacacc aggtagtttg 6780

aaacagtatt ctactccgat ctagaacgaa tgaacgaccg cccaaccaca ccacatcatc 6840

acaaccaagc gaacaaaaag catctctgta tatgcatcag taaaacccgc atcaacatgt 6900

atacctatcc tagatcgata tttccatcca tcatcttcaa ttcgtaacta tgaatatgta 6960

tggcacacac atacagatcc aaaattaata aatccaccag gtagtttgaa acagaattct 7020

actccgatct agaacgaccg cccaaccaga ccacatcatc acaaccaaga caaaaaaaag 7080

catgaaaaga tgacccgaca aacaagtgca cggcatatat tgaaataaag gaaaagggca 7140

aaccaaaccc tatgcaacga aacaaaaaaa atcatgaaat cgatcccgtc tgcggaacgg 7200

ctagagccat cccaggattc cccaaagaga aacactggca agttagcaat cagaacgtgt 7260

ctgacgtaca ggtcgcatcc gtgtacgaac gctagcagca cggatctaac acaaacacgg 7320

atctaacaca aacatgaaca gaagtagaac taccgggccc taaccatgga ccggaacgcc 7380

gatctagaga aggtagagag gggggggggg ggaggacgag cggcgtacct tgaagcggag 7440

gtgccgacgg gtggatttgg gggagatctg gttgtgtgtg tgtgcgctcc gaacaacacg 7500

aggttgggga aagagggtgt ggagggggtg tctatttatt acggcgggcg aggaagggaa 7560

agcgaaggag cggtgggaaa ggaatccccc gtagctgccg gtgccgtgag aggaggagga 7620

ggccgcctgc cgtgccggct cacgtctgcc gctccgccac gcaatttctg gatgccgaca 7680

gcggagcaag tccaacggtg gagcggaact ctcgagaggg gtccagaggc agcgacagag 7740

atgccgtgcc gtctgcttcg cttggcccga cgcgacgctg ctggttcgct ggttggtgtc 7800

cgttagactc gtcgacggcg tttaacaggc tggcattatc tactcgaaac aagaaaaatg 7860

tttccttagt ttttttaatt tcttaaaggg tatttgttta atttttagtc actttatttt 7920

attctatttt atatctaaat tattaaataa aaaaactaaa atagagtttt agttttctta 7980

atttagaggc taaaatagaa taaaatagat gtactaaaaa aattagtcta taaaaaccat 8040

taaccctaaa ccctaaatgg atgtactaat aaaatggatg aagtattata taggtgaagc 8100

tatttgcaaa aaaaaaggag aacacatgca cactaaaaag ataaaactgt agagtcctgt 8160

tgtcaaaata ctcaattgtc ctttagacca tgtctaactg ttcatttata tgattctcta 8220

aaacactgat attattgtag tactatagat tatattattc gtagagtaaa gtttaaatat 8280

atgtataaag atagataaac tgcacttcaa acaagtgtga caaaaaaaat atgtggtaat 8340

tttttataac ttagacatgc aatgctcatt atctctagag aggggcacga ccgggtcacg 8400

ctgcactgca caagcttaaa aaaagcaccg actcggtgcc actttttcaa gttgataacg 8460

gactagcctt attttaactt gctatttcta gctctaaaac actacccgga gctgaacctc 8520

ggagcggtgg tcgcagctga acttataagc cggtgtctgc aatgctcgct ggccggtctg 8580

gtactagttc tcggttcgtc ccttgatccc ttcccccgca agccgtagcg acgacgcgca 8640

cgcccgcgtg ggctggatgc ttaggcgcgg cccatacatc acgcgttgcc ttccctcgtg 8700

gtcgtgtacc tatcgcaagc ccagacaacg tagattgttg ttgcctgcac tgcacatgct 8760

gaagatcgaa tcccctgcat agcatgaatg acgacggatc agctgcagtt attaccaagt 8820

ttcatctgcg gactgaatcg gaggagacac aagttgatat tcagggagcg cacatccagc 8880

cacctgcacg tctagctatt ttgtaagggc caattagaag cttggcactg gccgtcgttt 8940

tacaacgtcg tgactgggaa aaccctggcg ttacccaact taatcgcctt gcagcacatc 9000

cccctttcgc cagctggcgt aatagcgaag aggcccgcac cgatcgccct tcccaacagt 9060

tgcgcagcct gaatggcgaa tgctagagca gcttgagctt ggatcagatt gtcgtttccc 9120

gccttcagtt taaaaaaagc accgactcgg tgccactttt tcaagttgat aacggactag 9180

ccttatttta acttgctatt tctagctcta aaacgtcaat cccatcaccc tcacggagcg 9240

gtggtcgcag ctgaacttat aagccggtgt ctgcaatgct cgctggccgg tctggtacta 9300

gttctcggtt cgtcccttga tcccttcccc cgcaagccgt agcgacgacg cgcacgcccg 9360

cgtgggctgg atgcttaggc gcggcccata catcacgcgt tgccttccct cgtggtcgtg 9420

tacctatcgc aagcccagac aacgtagatt gttgttgcct gcactgcaca tgctgaagat 9480

cgaatcccct gcatagcatg aatgacgacg gatcagctgc agttattacc aagtttcatc 9540

tgcggactga atcggaggag acacaagttg atattcaggg agcgcacatc cagccacctg 9600

cacgtctagc tattttgtaa gggccaatta aactatcagt gtttgacagg atatattggc 9660

gggtaaac 9668

Claims (10)

1. a kind of method for constructing sweet-waxy maizes germplasm, comprising:

1) the Sh2 gene and Wx gene in rite-directed mutagenesis recipient corn, screening obtains the Sh2 gene and the Wx gene is sent out Double homozygous mutation corns of raw mutation；

2) the Wx gene in recipient corn described in rite-directed mutagenesis, screening obtain the Wx gene single mutation of Wx gene mutation Corn；

3) by double homozygous mutation corns and the Wx gene single mutation corn hybridization, first-filial generation is obtained；By the hybridization Generation selfing is to get to the sugariness compared with the recipient corn and the waxy corn kernel enhanced；The first-filial generation is Sweet-waxy maizes germplasm.

2. according to the method described in claim 1, it is characterized by: Sh2 gene described in rite-directed mutagenesis and the Wx gene are sharp It is carried out with CRISPR/Cas9 method.

3. according to the method described in claim 2, it is characterized by: Sh2 gene described in rite-directed mutagenesis is entitled by that will target The sgRNA and Cas9 of target sequence 1 are imported in the recipient corn and are realized；The target sequence 1 is the segment of the Sh2 gene；

And/or it pinpoints the Wx gene and passes through sgRNA and Cas9 the importing recipient corn that will target entitled target sequence 2 Middle realization；The target sequence 2 is the segment of the Wx gene.

4. according to the method described in claim 2, it is characterized by: Sh2 gene described in rite-directed mutagenesis will be by that will contain targeting name Referred to as the recombinant vector of the expression cassette of the sgRNA of target sequence 1 and Cas9 expression casette is imported in the recipient corn and is realized；Institute State the segment that target sequence 1 is the Sh2 gene；

And/or Wx gene described in rite-directed mutagenesis will be by that will contain the expression cassette and Cas9 for the sgRNA for targeting entitled target sequence 2 The recombinant vector of expression casette is imported in the recipient corn and is realized；The target sequence 2 is the segment of the Wx gene.

5. according to the method described in claim 2, it is characterized by: double homozygous mutation corns are by carrying entitled recombination The recombinant vector of body 1, which imports, to be screened the corn that the Sh2 gene and the Wx gene mutate and obtains in the recipient corn It arrives；The sgRNA of expression cassette of the recombinant vector 1 containing the sgRNA for targeting entitled target sequence 1, the entitled target sequence 2 of targeting Expression cassette and Cas9 expression casette；The target sequence 1 is the segment of the Sh2 gene；The target sequence 2 is the Wx base The segment of cause；

And/or the Wx gene single mutation corn is obtained by following m1) or m2):

M1) recombinant vector of entitled recombinant vector 2 is imported in the recipient corn and screens what the Wx gene mutated Corn；Expression cassette and Cas9 expression casette of the recombinant vector 2 containing the sgRNA for targeting the target sequence 2；

M2) recombinant vector 1 is imported in the recipient corn and screens the corn that the Wx gene mutates.

6. according to the method any in claim 3-5, it is characterised in that: the target sequence 1 is sequence 1 in sequence table 5785-5804；

And/or the target sequence 2 is 1909-1928 of sequence 2 in sequence table.

7. according to the method any in claim 4-6, it is characterised in that:

The expression cassette of the sgRNA of the entitled target sequence 1 of targeting includes the sgRNA of promoter and entitled Sh2-sgRNA Coded sequence；The promoter is U6-2 promoter, and the coded sequence of the Sh2-sgRNA is the of sequence 3 in sequence table 9132-9234；

And/or the expression cassette of the sgRNA of the entitled target sequence 2 of targeting includes promoter and entitled Wx-sgRNA The coded sequence of sgRNA；The promoter is U6-2 promoter, and the coded sequence of the Wx-sgRNA is sequence 3 in sequence table 8418-8520；

And/or the Cas9 expression casette is by promoter, Cas9 coded sequence and terminator；The promoter is UBI starting Son, the Cas9 coded sequence are 2150-6415 of sequence 3 in sequence table, and the terminator is NOS terminator.

8. according to the method any in claim 5-7, it is characterised in that: the recombinant vector 1 is containing in ordered list The recombinant vector of DNA fragmentation shown in sequence 3.

9. following X1) or product X2):

X1) reagent set, by the expression cassette of the sgRNA of the entitled target sequence 1 of any targeting in claim 5-7, described Target the expression cassette and Cas9 expression cassette composition of the sgRNA of entitled target sequence 2；

X2) biomaterial is following B1) any one of to B6):

B1) following b11) or b12) or b13):

B11) DNA fragmentation shown in sequence 3 in sequence table；

B12 the nucleotide sequence) and b11) limited has 75% or 75% or more identity, and DNA with the same function points Son；

B13) the nucleotide sequence hybridization limited under strict conditions with b11) or b12), and DNA molecular with the same function；

B2) contain B1) recombinant vectors of the nucleic acid molecules；

B3) contain B1) recombinant microorganisms of the nucleic acid molecules or contain B2) recombinant microorganism of the recombinant vector；

B4) contain B1) plant cells of the nucleic acid molecules or contain B2) plant cell of the recombinant vector；

B5) contain B1) plant tissues of the nucleic acid molecules or contain B2) plant tissue of the recombinant vector；

B6) contain B1) plant organs of the nucleic acid molecules or contain B2) plant organ of the recombinant vector.

10. application of the product described in claim 9 in building sweet-waxy maizes germplasm.