CN107012163A - A kind of rite-directed mutagenesis formulates the method and its application of glutinous corn germplasm - Google Patents
A kind of rite-directed mutagenesis formulates the method and its application of glutinous corn germplasm Download PDFInfo
- Publication number
- CN107012163A CN107012163A CN201610060095.5A CN201610060095A CN107012163A CN 107012163 A CN107012163 A CN 107012163A CN 201610060095 A CN201610060095 A CN 201610060095A CN 107012163 A CN107012163 A CN 107012163A
- Authority
- CN
- China
- Prior art keywords
- dna
- promoter
- corn
- seq
- sgrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01242—NDP-glucose--starch glucosyltransferase (2.4.1.242)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Nutrition Science (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the method and its application that a kind of rite-directed mutagenesis formulates glutinous corn germplasm.The method for the cultivation glutinous corn that the present invention is provided, including the carrier of Maize genome editor is imported into purpose corn, obtain in glutinous corn, the glutinous corn seed amylopectin content and be higher than amylopectin content in the purpose corn kernel；The carrier of Maize genome editor contains the promoter that Cas9 GFPs, sgRNA encoding genes and RNA polymerase III are recognized.The method provided using the present invention can realize the gene editing to corn, glutinous corn be obtained, with very high breeding and cultivating value.
Description
Technical field
The present invention relates to genetic engineering field, and in particular to a kind of method of rite-directed mutagenesis initiative glutinous corn germplasm and its
Using.
Background technology
Corn is important cereal crops and forage crop, and cornstarch is in human lives and industrial production using wide
General, contained amylose and amylopectin have very high economic value.Because the physicochemical property of amylopectin makes side chain form sediment
Powder has larger application space in fields such as food processing, livestock-raising, paper-making industry, textile industry and sticker industry, because
It is significant to producing and processing that this cultivates glutinous corn.
Glutinous corn is also known as waxy corn, refers to that amylopectin content is almost 100% in endosperm after corn kernel maturation,
And endosperm is in cutin is opaque and lacklustre wax shape, in stickiness therefore also known as glutinous corn after boiling.Waxy is one universal
Mutant character, native waxy mutant is very common in cereal crop in the diploids such as corn, paddy rice, barley, sorghum.It is glutinous
Property the unique character of corn be by by the stealthy Catastrophe control of waxy1 single-genes, Sprague etc. (1943) is identified positioned at corn
The waxy1 gene locis of No. 9 the short arm of a chromosome, wild type Waxy1 full length gene 3718bp, are included by 14 extrons and 13
Son is constituted, encoded particles mating type amylosynthease (Granule-Bound Starch Synthase, GBSSI), and the enzyme is main
Control the amylose synthesis of corn embryosperm and pollen.If waxy1 gene delections, expression are obstructed or the reduction of GBSSI enzymatic activitys,
Amylose content in endosperm amylose biosynthesis block, endosperm will be caused to reduce, so as to change gelatinization and expansion of starch etc.
Glutinous corn of the characteristic formation with waxy character.More than 50 waxy1 allele are had now been found that, mutated site spreads all over
Whole waxy1 genes, wherein quite a few is that different transposons insert same position or the insertion of identical transposons not
Unstable waxy mutation such as wx-7, wx-8, wx-9 (klosgen 1986) that same position is caused, also have some stabilizations
Waxy1 mutant is that occur missing or insertion mutation in waxy1 genes key position, and such as wx-D7, wx-D10 are waxy1 respectively
7th extron and exon10 occur base deletion and lead mutagenic generation (fan, 2008；Tian Mengliang 2008).
CRISPR/Cas9 is that the short palindrome in interval based on bacterium or archeobacteria rule cluster repeats CRISPR (clustered
Regularly interspaced short palindromic repeats) mediation acquired immune system be derived
Gene editing technology.One section of sgRNA gene that the technology is designed first, the RNA of the genetic transcription can pass through base complementrity
Pairing identification target dna sequence, the double-stranded DNA for instructing Cas9 nucleic acid cleavage to recognize, induction homologous recombination (HDR,
Homologous directed repair) or nonhomologous end link (NHEJ, non-homologous end-joining),
And then realize target DNA editor.Lost based on the gene editing technology that the type immunologic mechanism of bacterium II is developed in plant particularly crop
Passing has great application prospect in improvement.One of basic demand of the technology is exactly recipient cell intracellular expression single molecular recognition
RNA (sgRNA, single guiding RNA), the molecule is responsible for recognizing specific gene editing site, and then mediation is combined
Cas9 albumen exercises DNA enzymatic and cuts activity, introduces DNA double strand breaks in the site of design, is repaiied by the NHEJ or HDR of intracellular
Multiple approach introduces mutation.Therefore, sgRNA expression is the important component of the technology.
The content of the invention
The technical problems to be solved by the invention are how to cultivate glutinous corn.
To solve the above problems, present invention firstly provides the side for cultivating glutinous corn (the high corn of amylopectin content)
Method.
The present invention provide cultivation glutinous corn method, including into purpose corn import Maize genome editor load
Body, obtains glutinous corn.
Amylopectin content is higher than amylopectin content in the purpose corn kernel in the glutinous corn seed.
The carrier of the Maize genome editor contains sgRNA encoding genes.
The target DNA that the sgRNA is recognized in corn is the DNA fragmentation of coding Waxy1 albumen, the Waxy1 albumen
Can be a1) or a2)：
A1) amino acid sequence is the protein shown in SEQ ID No.5；
A2) substitution and/or missing and/or addition one or several will be passed through in the amino acid sequence shown in SEQ ID No.5
Individual amino acid residue obtain as a1) derived from protein.
In the above method, the carrier of the Maize genome editor can also the encoding gene containing Cas9 albumen and RNA it is poly-
The promoter that synthase III is recognized；The promoter that the RNA polymerase III is recognized starts the transcription of the sgRNA encoding genes.
In the above method, the purpose corn can be non-glutinous corn kind.
The non-glutinous corn kind concretely corn inbred line CA335.
In the above method, the Waxy1 albumen is the amino acid sequence shown in SEQ ID No.5, contains 564 amino
Acid.
In the above method, the nucleotide sequence of the cDNA genes of the Waxy1 albumen is as shown in SEQ ID No.1, SEQ
466-2160 of ID No.1 are the coded sequence of the Waxy1 albumen.
In the above method, the target site of the sgRNA identifications can be the DNA molecular shown in SEQ ID No.2.
In the above method, the sgRNA encoding genes are DNA points shown in 10087-10191 of SEQ ID No.3
Son.
In the above method, the promoter that the RNA polymerase III is recognized can be the ca99 of promoter ZmPol III, and the RNA gathers
Synthase III recognize promoter be the ca99 of promoter ZmPol III, the ca99 of promoter ZmPol III are following b1) or b2) or
B3 the DNA molecular shown in)：
B1) the DNA molecular shown in SEQ ID No.4；
B2 the DNA sequence dna) and b1) limited has 75% or more than 75% homogeneity, and the DNA with promoter function points
Son；
B3) under strict conditions with b1) or b2) limit DNA sequence dna hybridize, and with promoter function DNA molecular.
In the above method, the encoding gene of the Cas9 albumen is following c1) or c2) or c3) shown in DNA molecular：
C1) DNA moleculars of the SEQ ID No.3 from 5 ' ends shown in 12309-16409；
C2 the DNA sequence dna) and c1) limited has the DNA molecular of 75% or more than 75% homogeneity；
C3) under strict conditions with c1) or c2) limit DNA sequence dna hybridization DNA molecular.
" amylopectin content is higher than amylopectin content in the purpose corn kernel in the glutinous corn seed " can
It is that yellowish-brown or coloring are shallower through iodine staining to be presented as glutinous corn seed, and purpose corn kernel is navy blue through iodine staining
Or inclined black.
" amylopectin content is higher than amylopectin content in the purpose corn kernel in the glutinous corn seed " can
It is presented as that the amylum body of glutinous corn seed is yellowish-brown through iodine staining or colours shallower, the amylum body warp of purpose corn kernel
Iodine staining is navy blue or inclined black.
To solve the above problems, present invention also offers the carrier of Maize genome editor.
The carrier of Maize genome editor provided by the present invention, the encoding gene containing Cas9 albumen, sgRNA coding bases
The promoter that cause and RNA polymerase III are recognized；The promoter that the RNA polymerase III is recognized starts the sgRNA encoding genes
Transcription；
The target DNA that the sgRNA is recognized in corn is the DNA fragmentation of coding Waxy1 albumen, the Waxy1 albumen
For a1) or a2)：
A1) amino acid sequence is the protein shown in SEQ ID No.5；
A2) substitution and/or missing and/or addition one or several will be passed through in the amino acid sequence shown in SEQ ID No.5
Individual amino acid residue obtain as a1) derived from protein.
Above-mentioned carrier also includes the promoter (such as corn UBI promoters) for the encoding gene transcription for starting Cas9 albumen, eventually
The terminator (such as NOS terminator) that only Cas9 GFPs are transcribed, replicon and resistant gene (such as kalamycin resistance gene).
In the carrier of above-mentioned Maize genome editor, the target site of the sgRNA identifications is shown in SEQ ID No.2
DNA molecular.
In the carrier of above-mentioned Maize genome editor, the sgRNA encoding genes are SEQ ID No.3 10087-
DNA molecular shown in 10191.
In the carrier of above-mentioned Maize genome editor, the promoter that the RNA polymerase III is recognized can be promoter ZmPol
III ca99, the ca99 of promoter ZmPol III are following b1) or b2) or b3) shown in DNA molecular：
B1) the DNA molecular shown in SEQ ID No.4；
B2 the DNA sequence dna) and b1) limited has 75% or more than 75% homogeneity, and the DNA with promoter function points
Son；
B3) under strict conditions with b1) or b2) limit DNA sequence dna hybridize, and with promoter function DNA molecular.
In the carrier of above-mentioned Maize genome editor, the encoding gene of the Cas9 albumen is following c1) or c2) or c3)
Shown DNA molecular：
C1) DNA moleculars of the SEQ ID No.3 from 5 ' ends shown in 12309-16409；
C2 the DNA sequence dna) and c1) limited has the DNA molecular of 75% or more than 75% homogeneity；
C3) under strict conditions with c1) or c2) limit DNA sequence dna hybridization DNA molecular.
The carrier of above-mentioned Maize genome the editor concretely ca99-sgRNA-Cas9 of recombinant vector ZmPol III, its nucleosides
Acid sequence is shown in SEQ ID No.3.Wherein, nucleotide sequences of the SEQ ID No.3 from 5 ' ends shown in 208-884
For the enhanced promoters of CaMV 35s, the nucleotides sequence shown in 2188-2982 is classified as kalamycin resistance gene, the
Nucleotides sequence shown in 4407-4995 is classified as replicon ori, and the nucleotides sequence shown in 9691-10086 is classified as promoter
The ca99 of ZmPol III, the nucleotides sequence shown in 10087-10191 is classified as sgRNA encoding gene, 10192-12193
Shown nucleotides sequence is classified as corn UBI promoters, and the nucleotides sequence shown in 12309-16409 is classified as the volume of Cas9 albumen
Code gene, the nucleotides sequence shown in 16477-16729 is classified as NOS terminator.
The carrier of above-mentioned Maize genome editor amylopectin content in cultivating glutinous corn and/or improving corn kernel
In application fall within the scope of protection of the invention.
In above-mentioned application, the corn concretely corn inbred line CA335.
The above-mentioned ca99-sgRNA-Cas9 of recombinant vector ZmPol III can by using agriculture bacillus mediated, Ti-plasmids, Ri plasmids,
The conventional biology methods such as plant viral vector, directly delivered DNA, microinjection, conductance, particle gun convert plant cell or group
Knit, and by the plant cell or tissue cultivating of conversion into plant.
It is demonstrated experimentally that being planted using the recombinational agrobacterium maize transformation containing the ca99-sgRNA-Cas9 of recombinant vector ZmPol III
Strain, edlin can be entered to Waxy1 genes, after Waxy1 genes are by CRESPR/Cas9 endonuclease editors, can be caused
Waxy1 gene mutations, when the Waxy1 genes of two homologues are undergone mutation, can cause GBSSI enzymatic activitys to be lost
Lose, endosperm amylose biosynthesis block, amylose content is reduced in endosperm, so as to change the characteristics such as the gelatinization and expansion of starch
Form the glutinous corn with waxy character.Waxy1 gene editings to corn can be realized using the method for the present invention, obtained
Glutinous corn, with very high breeding and cultivating value.
Brief description of the drawings
Fig. 1 is the ca99-sgRNA-Cas9 of recombinant vector ZmPol III structural representation.
Fig. 2 is positive T0In generation, turns the mutation type of sgRNA gene plants.
Fig. 3 is positive T0In generation, turns the statistical chart of sgRNA gene plant mutation types.
Fig. 4 is T1For the phenotype after corn kernel iodine staining.
Fig. 5 is from T1Result after the amylum body iodine staining separated for corn kernel.
Embodiment
The present invention is further described in detail with reference to embodiment, the embodiment provided is only for explaining
The bright present invention, the scope being not intended to be limiting of the invention.
Experimental method in following embodiments, is conventional method unless otherwise specified.
Material, reagent used etc., unless otherwise specified, are commercially obtained in following embodiments.
PEASY-Blunt Cloning Kit, Trans5 α Competents cell, PEASY-blunt simple
Vector and Trans T1 competent cells are the product of Beijing Quanshijin Biotechnology Co., Ltd.
Corn inbred line CA335 (Chuanxiao Xie, Shihuang Zhang_, Minshun Li, Xinhai Li,
Zhuanfang Hao,Li Bai,Degui Zhang,Yehong Liang.Inferring Genome Ancestry and
Estimating Molecular Relatedness Among 187Chinese Maize Inbred Lines.Journal
of Genetics and Genomics(Formerly Acta Genetica Sinica).2007,34(8):It is 738_748) public
Crowd can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science (i.e. applicant), the biomaterial only attach most importance to duplicate invention phase
Close experiment used, can not be used as other purposes.Corn inbred line CA335 is non-glutinous corn kind.
In glutinous No. 2 and Kennian No.1 be it is commercially available, the white glutinous seed in following embodiments be in the seed of glutinous No. 2.It is following
Yellow glutinous seed in embodiment is the seed of Kennian No.1.
YEB fluid nutrient mediums：By beef extract 5g, yeast extract 1g, peptone 5g, sucrose 5g, MgSO4·7H2O 0.04g
1L deionized waters are dissolved in, pH to 7.2, autoclave sterilization 20min are adjusted with the 10M NaOH aqueous solution.
The structure of embodiment 1, the ca99 of promoter ZmPol III clone and the ca99-sgRNA-Cas9 of recombinant vector ZmPol III
First, the ca99 of promoter ZmPol III clone
3~4, corn inbred line CA335 seeds are taken, after sterilization seed soaking, puts it into the quartzy sand table of humidity and cultivates,
Blade to be grown, extracts blade genome standby.Using blade genome as template, using the ca99-F of ZmPol III (5 '-
AATTGGCCCTTACAAAATAG-3 ') and the ca99-R of ZmPol III (5 '-GGAGCGGTGGTC GCAGCTG-3 ') composition primer
To entering performing PCR amplification, pcr amplified fragment is obtained.The pcr amplified fragment is carried out using pEASY-Blunt Cloning Kit
Subclone, obtains recombinant vector.Recombinant vector is transferred in Trans5 α Competent cells, overnight incubation, picking Dan Ke
It is grand, expand and cultivate and be sequenced, sequencing result shows in recombinant vector containing the promoter ZmPol III shown in SEQ ID No.4
Ca99 sequences.
2nd, the ca99-sgRNA-Cas9 of recombinant vector ZmPol III acquisition
Recombinant vector ZmPol III ca99-sgRNA-Cas9 (circular plasmids, carrier shown in artificial synthesized SEQ ID No.3
Structural representation is shown in Fig. 1).Wherein, nucleotides sequences of the SEQ ID No.3 from 5 ' ends shown in 208-884 is classified as CaMV
The enhanced promoters of 35s, the nucleotides sequence shown in 2188-2982 is classified as kalamycin resistance gene, 4407-4995
Shown nucleotides sequence is classified as replicon ori, and the nucleotides sequence shown in 9691-10086 is classified as promoter described in step one
The ca99 of ZmPol III, the nucleotides sequence shown in 10087-10191 is classified as sgRNA encoding gene, 10192-12193
Shown nucleotides sequence is classified as corn UBI promoters, and the nucleotides sequence shown in 12309-16409 is classified as the volume of Cas9 albumen
Code gene, the nucleotides sequence shown in 16477-16729 is classified as NOS terminator.
Embodiment 2, cultivation glutinous corn mutant strain and its checking
First, Agrobacterium infects the preparation of liquid
1st, the ca99-sgRNA-Cas9 of recombinant vector ZmPol III for synthesizing embodiment 1 convert Agrobacterium EHA105 competence
Cell, obtains recombinational agrobacterium, is named as the ca99-sgRNA-Cas9 of EHA105-ZmPol III.
2nd, the ca99-sgRNA-Cas9 monoclonals of EHA105-ZmPol III are inoculated in 20mL 50mg/L containing kanamycins and profit
The flat 50mg/L of good fortune YEB fluid nutrient mediums, 28 DEG C, 220rpm 12~16h of concussion and cultivate, then by 2%-4%, (volume basis contains
Amount) ratio be inoculated in the YEB fluid nutrient mediums containing 100 μM of acetosyringone, 28 DEG C, 220rpm shaken cultivations to OD600Value reaches
To 0.5 or so, obtain Agrobacterium and infect liquid.
2nd, glutinous corn mutant strain is cultivated
By the ca99-sgRNA-Cas9 Induction Transformation corn inbred line CA335 ratarias of EHA105-ZmPol III, by screening,
Differentiation, obtains and complete breaks up plant again.Comprise the following steps that：
1st, it is inoculated with
After pollination in 9~15d, when corn inbred line CA335 ratarias grow to 1.8~2.2mm, fruit ear is taken, with 70% (body
Product percentage) alcohol disinfecting, often goes 1 layer of skin to be sterilized 1 time with 70% alcohol swab, after after complete peeling, is sterilized with 0.1% mercuric chloride
About 10min.Kind of skin and endosperm are pruned line by line from top to bottom with scalpel again, rataria is chosen from seed middle and upper part with tweezers, add
Agrobacterium prepared by step one is infected in liquid, soaks 15~20min, shake that around here will be frequently.After having soaked, bacterium solution is abandoned, is used
Aseptic filter paper blots unnecessary bacterium solution.Scultellum is placed in upwards and fills inducing culture (by KN0 through autoclaving32830mg、
NH4SO4463mg、CaCl2·2H2O 166mg、MgSO4·7H20185mg、KH2PO4400mg、FeSO4·7H2027.8mg、
ZnSO4·7H201.6mg、MnS04·4H204.4mg、H2BO30.8mg, KI 1.6mg, glycine 2mg, nicotinic acid 0.5mg, hydrochloric acid
Thiamine 1.0mg, pyridoxine hydrochloride 0.5mg, sucrose 30g, agar 6g, proline 1.38g, caseinhydrolysate 500mg and 2,4-D
2mg is dissolved in 1L distilled water, adjusts pH to 5.8,121 DEG C of sterilizing 15min) culture dish in, be placed in 26 DEG C of incubators and secretly trained
Support (young shoot and root grown carefully is removed during about 3~5d), every 3 weeks subcultures 1 time, be total to subculture 3 times.
2nd, subculture
The 11st week after step 1 inoculation, embryo callus is selected, embryo callus is caught broken into 2.5-3mm sizes
Fritter, is transferred to differential medium (by KN0 in the way of every bottle of 3 pieces of callus32830mg、NH4SO4463mg、CaCl2·2H2O
166mg、MgSO4·7H20185mg、KH2PO4400mg、FeSO4·7H2027.8mg、ZnSO4·7H201.6mg、MnS04·
4H204.4mg、H2BO30.8mg, KI 1.6mg, glycine 2mg, nicotinic acid 0.5mg, thiamine hydrochloride 1.0mg, pyridoxine hydrochloride
0.5mg, sucrose 30g, agar 6g, proline 690mg, caseinhydrolysate 100mg and mannitol 20mg are dissolved in 1L distilled water, regulation
PH to 5.8,121 DEG C of sterilizing 15min) carry out differentiation culture.Condition of culture：28 DEG C, (illumination/8 are small within 16 hours for alternation of light and darkness culture
When it is dark；Intensity of illumination is about 2000lx).
3rd, break up
Complete after step 2, embryo callus is transferred to redifferential medium (by KN032830mg、NH4SO4463mg、
CaCl2·2H2O 166mg、MgSO4·7H20185mg、KH2PO4400mg、FeSO4·7H2027.8mg、ZnSO4·
7H201.6mg、MnS04·4H204.4mg、H2BO30.8mg, KI 1.6mg, glycine 2mg, nicotinic acid 0.5mg, thiamine hydrochloride
1.0mg, pyridoxine hydrochloride 0.5mg, sucrose 30g, agar 6g, proline 690mg, caseinhydrolysate 100mg and KT 1mg are dissolved in
1L distilled water, adjusts pH to 5.8,121 DEG C of sterilizing 15min) carry out dedifferentiation culture.Condition of culture：28 DEG C, alternation of light and darkness culture
(16 hours illumination/8 hour dark；Intensity of illumination is about 2000lx).
4th, complete after step 3, resistance screening (using concentration to carry out resistance screening for 3mg/L bialaphos) is carried out successively
And culture of rootage, obtain regeneration plant, as T0In generation, intends turning the ca99-sgRNA-Cas9 gene plants of ZmPol III.
3rd, the identification of the waxy mutant strain of corn
1st, PCR augmentation detections
1) T that step 2 is cultivated is treated0The seedling that generation intends turning the ca99-sgRNA-Cas9 gene plants of ZmPol III grows to 3~4
Ye Shi, takes fresh blade to be put into clean mortar, and mortar need to add Liquid nitrogen precooler, and the blade fetched is put into liquid nitrogen, Ran Houyong
Pestle smashes blade.
2) step 1 is taken) obtained powder, adding the 800 μ L CTAB buffer solutions of 65 DEG C of preheatings, (500mL CTAB is extracted
The preparation method of buffer solution：It is 1M to add 50mL concentration, and pH7.5 Tris solution, 70mL concentration is 5M NaCl solution, 50mL
Concentration is 0.5M, pH8.0 EDTA solution, and 5.0g CTAB, 5.0mL concentration are 14M beta -mercaptoethanol solution, 325mL
ddH2O, matching while using), rapid acutely vibration.65 DEG C of heating water bath 15min, will overturn mixing several times during water-bath.Water-bath
Afterwards, centrifuge tube is taken out, room temperature is cooled to.
3) step 2 is completed) after, the centrifuge tube is taken, 800 μ L chloroform is added：Isoamyl alcohol (v：V=24：1) mixed liquor,
Gently reverse and shake 12000rpm centrifugation 10min after 10min, take supernatant.
4) step 3 is taken) obtained supernatant, 3 μ L RNase solution are added, 0.5~1h of warm bath at room temperature or at 37 DEG C.
5) step 4 is completed) after, body fluid phase system is rounded, 800 μ L chloroform is added：Isoamyl alcohol (v：V=24：1) mix
Liquid, gently reverses and shakes 12000rpm centrifugation 10min after 10min, supernatant is taken, in the centrifuge tube for being placed in new 1.5mL.
6) step 5 is completed) after, the centrifuge tube is taken, the isopropanol of 0.7 times of volume precooling (- 80 DEG C) is added, gently mixes
Aggegation is separated out to DNA, 10min is centrifuged under the conditions of 12000rpm, supernatant is abandoned (careful DNA is poured out).
7) step 6 is completed) after, the centrifuge tube is taken, 700 μ L 70% ethanol is added, washed 1~2 time.
8) step 7 is completed) after, take the centrifuge tube, room temperature to add 50 μ L ddH after drying2O dissolving DNAs, as gene
Group DNA.
9) with step 8) obtain T0The genomic DNA that generation intends turning the ca99-sgRNA-Cas9 gene plants of ZmPol III is mould
Plate, performing PCR amplification is entered by primer of the artificial synthesized ca99-Ubi-F1 of ZmPol III and the ca99-Ubi-R1 of ZmPol III, and PCR expands
Increase production thing to be detected with 2% agarose gel electrophoresis, and be imaged with ultraviolet gel imager.
PCR response procedures：94℃3min；94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 30s, 35 circulations；72℃10min.
Primer sequence and PCR reaction systems refer to Tables 1 and 2.
According to above-mentioned steps 1) -9), the T that step 2 is cultivated0In generation, intends turning the plant of the ca99-sgRNA-Cas9 genes of ZmPol III
The seedling of strain replaces with corn inbred line CA335 seedling, and other steps are constant, are used as negative control.
By above-mentioned steps 9) in T0The genomic DNA that generation intends turning the ca99-sgRNA-Cas9 gene plants of ZmPol III is replaced with
The ca99-sgRNA-Cas9 of recombinant vector ZmPol III, other steps are constant, are used as positive control.
The primer sequence of table 1. and amplified production
Table 2.PCR reaction systems are configured
| Constituent | Consumption (μ L) |
| 10×PCR BufferI | 2.0 |
| dNTP(2.5mM) | 1.6 |
| F1(10μM) | 0.4 |
| R1(10μM) | 0.4 |
| Template | 2.0 |
| rTaq(2.5U/uL) | 0.2 |
| ddH2O | 13.4 |
| TOTAL | 20.0 |
Test result indicates that, the T obtained with the ca99-sgRNA-Cas9 of recombinant vector ZmPol III and step 20In generation, intends turning
The genomic DNA of the ca99-sgRNA-Cas9 gene plants of ZmPol III is template, contains SEQ in the pcr amplification product of acquisition
416bps of the ID No.3 from 5 ' ends shown in 10047-10462 DNA fragmentation, and corn inbred line CA335 seedling
416bps of the SEQ ID No.3 from 5 ' ends shown in 10047-10462 DNA fragmentation is not contained in genomic DNA.Can
See, the T that step 2 is obtained0It is positive T that generation, which intends turning the ca99-sgRNA-Cas9 gene plants of ZmPol III,0In generation, intends turning ZmPol III
Ca99-sgRNA-Cas9 gene plants.
2nd, the Molecular Detection of mutation type
To analyze the mutation type of target sequence, SEQ ID No.5 (shown in SEQ ID No.1, are encoded with Waxy1 genes
Shown albumen) Cas9 target sequences be core, with positive T0In generation, turns the ca99-sgRNA-Cas9 gene plant seedling of ZmPol III
Genomic DNA be template, using artificial synthesized DE (WX1)-F and DE (WX1)-R be primer, enter performing PCR amplification, obtain
Pcr amplification product.Pcr amplification product is connected with PEASY-blunt simple vector and converted to Trans T1 impressions
In state cell, overnight incubation, picking monoclonal expands and cultivates and be sequenced, and counts mutation type and calculates mutation rate.
Molecular Detection the primer is as follows：
DE(WX1)-F：CATACTTCTCCGGACCATACGG；
DE(WX1)-R:TAGGGGCTGACGGTGAGG
Mutation rate=be totally converted event mutator sum/is totally converted event number=(homozygous mutation strain number × 2+ is double
Allelic mutation strain number × 2+ heterozygous mutants strain number)/it is totally converted event number × 100%.
It is same intracellular when Cas9, which plays a role, starts to shear specific gene because corn is liploid plant
Two homologues on two allele be likely to be edited, produce same-type or different types of mutation,
So regarding two allele in a plant as two gene editing events.Homozygous mutation strain refers to the two of the plant
The Waxy1 genes of bar homologue there occurs that identical is mutated, and diallele mutant strain refers to that two of the plant are same
The Waxy1 genes of source chromosome are mutated but mutant form is different, and heterozygous mutant strain number refers to two of the plant
The Waxy1 genes of a homologue in homologue there occurs mutation, the Waxy1 genes of another homologue
Do not undergo mutation, wild type refers to that the Waxy1 genes in two homologues of the plant are not undergone mutation.
Positive T is detected altogether0In generation, turns 34 plants of III ca99-sgRNA-Cas9 gene plants of ZmPol, wherein homozygous mutation strain number 15
Strain, generation editor's number are 30 times, and 17 plants of diallele mutant strain, generation editor's number of times are 34 times, and heterozygous mutant strain number is 0
Strain, 2 plants of wild type, generation editor's number of times are 0 time, and mutation rate is 94%.Homozygous mutation and diallele mutation are designated as dashing forward
Variant.Count editing sites insertion or deletion condition number statistical such as Fig. 2.It is each according to editing sites insertion or deletion condition statistics
The shared ration statisticses such as Fig. 3 of type mutation.
Corn is diplont, the Granule-Bound Starch Synthases of Waxy1 gene codes be control corn embryosperm and
The amylose synthesis of pollen.After Waxy1 genes are by CRESPR/Cas9 endonuclease editors, Waxy1 genes can be caused
Mutation, when the Waxy1 genes of two homologues are undergone mutation, can cause GBSSI enzymatic activitys to be lost, endosperm straight chain
Starch synthesis is obstructed, and amylose content is reduced in endosperm, so as to change the formation of the characteristics such as the gelatinization and expansion of starch with glutinous
The glutinous corn of property character.
3rd, seed is waxy investigates with non-waxy character
Non- waxy starch runs into iodine water and becomes blue principle：Starch both (accounts for 10%- containing amylose in non-waxy seed
30%) also there is amylopectin (accounting for 70%-90%), amylose is in curve form in structure, and rolled up by the effect of hydrogen bond
Bent curl, is added after iodine water, and iodine molecule just enters to link together in helical structure by Van der Waals force with amylose,
So as to form complex compound, this complex compound can absorb other light in addition to blue light, so it is deep that non-waxy starch is presented
Blueness.
Waxy starch runs into iodine water and becomes yellowish-brown principle：Amylopectin content almost accounts for 100% in waxy starch, and straight chain forms sediment
Powder can also adsorb iodine, but the iodine negligible amounts of the glucose residue absorption in each branch, so waxy starch is presented yellow
Brown.
Positive T is authorized by corn inbred line CA335 pollen0In generation, turns the ca99-sgRNA-Cas9 gene plants of ZmPol III
Female inflorescence, makees orthogonal, after corn seed is ripe, obtains orthogonal T1For seed.
By positive T0The pollen that generation turns the ca99-sgRNA-Cas9 gene plants of ZmPol III authorizes corn inbred line CA335's
Female inflorescence, makees reciprocal cross, after corn seed is ripe, obtains reciprocal cross T1For seed.
Seed to be measured：Orthogonal T1For seed, reciprocal cross T1For seed, white glutinous seed, yellow glutinous seed or corn inbred line CA335
Seed.
(1) seed is dyed
By seed to be measured peel off kind of a skin be then immersed in iodine solution (contain 10% (mass ratio) KI, 5% (mass ratio) I2's is water-soluble
Liquid) 10min, takes out, observes seed coat color.Seed to be measured is not shelled into kind of skin and is used as control.If seed coat color be navy blue or
Inclined black, be then non-waxy seed, as seed be yellowish-brown or colour it is shallower, if be waxy.
Seed coloration result is shown in that (R1 is not peel off the seed of kind of skin to Fig. 4, and R2 is peels off kind of skin and be immersed in iodine solution 10min
Poststaining result, L1 is white glutinous seed, and L2 is yellow glutinous seed, and L3 is corn inbred line CA335 seeds, and L4, L6 and L8 are orthogonal
T1For seed, L5 and L7 are reciprocal cross T1For seed.Bar is 2 centimetres).As a result show, orthogonal T1For seed and reciprocal cross T1For seed
In existing waxy seed have non-waxy seed again.
(2) amylum body is dyed
By orthogonal T1For seed, reciprocal cross T1For seed, white glutinous seed or corn inbred line CA335 seed soaked overnights, embryo is treated
The endosperm of one layer of 3mm width of dorsad embryo side is cut after breast is soft, is ground, iodine solution is added, is then seen with ordinary optical microscope
Examine amylum body staining conditions and count T1For waxy seed, non-waxy seed and heterozygous seed (i.e. existing waxy shallow lake in seed
Powder has the seed of non-waxy starch grain again) grain number.
Amylum body coloration result is shown in that (A is corn inbred line CA335 seeds to Fig. 5, and B is white glutinous seed, and C is corn inbred line
The amylum body mixing iodine staining result of CA335 seeds and white glutinous seed, D is orthogonal T1For the non-waxy seed in seed, E is anti-
Hand over T1For the waxy seed in seed, F is orthogonal T1For the non-waxy seed and reciprocal cross T in seed1For the waxy seed in seed
Amylum body mixing iodine staining result).Statistical result shows, orthogonal T1Amount to 345 for seed, including waxy seed 53,
Non- waxy seed 214, heterozygous seed 78；Reciprocal cross T1Amount to 286, including waxy seed 103 for seed, it is non-waxy
Seed 129 and heterozygous seed 54.
Claims (10)
1. cultivating the method for glutinous corn, including the carrier of Maize genome editor is imported into purpose corn, obtain waxy jade
Rice；The carrier of the Maize genome editor contains sgRNA encoding genes；
The target DNA that the sgRNA is recognized in corn is the DNA fragmentation of coding Waxy1 albumen, and the Waxy1 albumen is a1)
Or a2)：
A1) amino acid sequence is the protein shown in SEQ ID No.5；
A2 substitution and/or missing) will be passed through in the amino acid sequence shown in SEQ ID No.5 and/or one or several ammonia are added
Base acid residue obtain as a1) derived from protein.
2. the method as described in claim 1, it is characterised in that：The carrier of the Maize genome editor also contains Cas9 albumen
Encoding gene and RNA polymerase III recognize promoter；The promoter that the RNA polymerase III is recognized starts the sgRNA
The transcription of encoding gene.
3. method according to claim 1 or 2, it is characterised in that：The target site of the sgRNA identifications is SEQ ID
DNA molecular shown in No.2.
4. according to any described method of claims 1 to 3, it is characterised in that：The sgRNA encoding genes are SEQ ID
DNA molecular shown in 10087-10191 of No.3.
5. according to any described method in Claims 1-4, it is characterised in that：
The promoter that the RNA polymerase III is recognized is the ca99 of promoter ZmPol III, under the ca99 of promoter ZmPol III are
State b1) or b2) or b3) shown in DNA molecular：
B1) the DNA molecular shown in SEQ ID No.4；
B2 the DNA sequence dna) and b1) limited has 75% or more than 75% homogeneity, and the DNA molecular with promoter function；
B3) under strict conditions with b1) or b2) limit DNA sequence dna hybridize, and with promoter function DNA molecular；
The encoding gene of the Cas9 albumen is following c1) or c2) or c3) shown in DNA molecular：
C1) DNA moleculars of the SEQ ID No.3 from 5 ' ends shown in 12309-16409；
C2 the DNA sequence dna) and c1) limited has the DNA molecular of 75% or more than 75% homogeneity；
C3) under strict conditions with c1) or c2) limit DNA sequence dna hybridization DNA molecular.
6. a kind of carrier of Maize genome editor, the encoding gene containing Cas9 albumen, sgRNA encoding genes and RNA polymerizations
The promoter that enzyme III is recognized；The promoter that the RNA polymerase III is recognized starts the transcription of the sgRNA encoding genes；
The target DNA that the sgRNA is recognized in corn is the DNA fragmentation of coding Waxy1 albumen, and the Waxy1 albumen is a1)
Or a2)：
A1) amino acid sequence is the protein shown in SEQ ID No.5；
A2 substitution and/or missing) will be passed through in the amino acid sequence shown in SEQ ID No.5 and/or one or several ammonia are added
Base acid residue obtain as a1) derived from protein.
7. carrier according to claim 6, it is characterised in that：The target site of the sgRNA identifications is SEQ ID No.2 institutes
The DNA molecular shown.
8. the carrier according to claim 6 or 7, it is characterised in that：The sgRNA encoding genes are SEQ ID No.3
DNA molecular shown in 10087-10191.
9. according to any described carrier in claim 6 to 8, it is characterised in that：
The promoter that the RNA polymerase III is recognized is the ca99 of promoter ZmPol III, under the ca99 of promoter ZmPol III are
State b1) or b2) or b3) shown in DNA molecular：
B1) the DNA molecular shown in SEQ ID No.4；
B2 the DNA sequence dna) and b1) limited has 75% or more than 75% homogeneity, and the DNA molecular with promoter function；
B3) under strict conditions with b1) or b2) limit DNA sequence dna hybridize, and with promoter function DNA molecular；
The encoding gene of the Cas9 albumen is following c1) or c2) or c3) shown in DNA molecular：
C1) DNA moleculars of the SEQ ID No.3 from 5 ' ends shown in 12309-16409；
C2 the DNA sequence dna) and c1) limited has the DNA molecular of 75% or more than 75% homogeneity；
C3) under strict conditions with c1) or c2) limit DNA sequence dna hybridization DNA molecular.
10. any described carrier amylopectin in cultivating glutinous corn and/or improving corn kernel in claim 6 to 9
Application in content.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610060095.5A CN107012163B (en) | 2016-01-28 | 2016-01-28 | A kind of method and its application of rite-directed mutagenesis initiative glutinous corn germplasm |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610060095.5A CN107012163B (en) | 2016-01-28 | 2016-01-28 | A kind of method and its application of rite-directed mutagenesis initiative glutinous corn germplasm |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107012163A true CN107012163A (en) | 2017-08-04 |
| CN107012163B CN107012163B (en) | 2019-09-24 |
Family
ID=59439004
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610060095.5A Active CN107012163B (en) | 2016-01-28 | 2016-01-28 | A kind of method and its application of rite-directed mutagenesis initiative glutinous corn germplasm |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012163B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355304A (en) * | 2018-11-15 | 2019-02-19 | 中国农业科学院作物科学研究所 | A method of the initiative glutinous seed germplasm of Endosperm of Sweet Corn |
| CN110132963A (en) * | 2019-04-26 | 2019-08-16 | 安徽省农业科学院烟草研究所 | A kind of method of Rapid identification waxy corn germplasm |
| CN112877331A (en) * | 2021-03-09 | 2021-06-01 | 中国农业科学院作物科学研究所 | Method for creating high amylose corn germplasm |
| CN113174379A (en) * | 2020-06-15 | 2021-07-27 | 山东舜丰生物科技有限公司 | Polypeptide and nucleic acid for improving amylose content of plants and application of polypeptide and nucleic acid |
| CN114591928A (en) * | 2022-04-02 | 2022-06-07 | 山东中农天泰种业有限公司 | dCAPS molecular marker related to amylopectin content of corn kernels |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667338A (en) * | 2013-11-28 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Fixed-point modification method for corn genome |
-
2016
- 2016-01-28 CN CN201610060095.5A patent/CN107012163B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667338A (en) * | 2013-11-28 | 2014-03-26 | 中国科学院遗传与发育生物学研究所 | Fixed-point modification method for corn genome |
Non-Patent Citations (2)
| Title |
|---|
| HUI-LI XING等: "A CRISPR/Cas9 toolkit for multiplex genome editing in plants", 《BMC PLANT BIOLOGY》 * |
| 陈亭亭: "玉米籽粒淀粉合成关键基因sbeⅠ、waxy的研究", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109355304A (en) * | 2018-11-15 | 2019-02-19 | 中国农业科学院作物科学研究所 | A method of the initiative glutinous seed germplasm of Endosperm of Sweet Corn |
| CN109355304B (en) * | 2018-11-15 | 2021-01-05 | 中国农业科学院作物科学研究所 | Method for creating corn sweet waxy seed germplasm |
| CN110132963A (en) * | 2019-04-26 | 2019-08-16 | 安徽省农业科学院烟草研究所 | A kind of method of Rapid identification waxy corn germplasm |
| CN113174379A (en) * | 2020-06-15 | 2021-07-27 | 山东舜丰生物科技有限公司 | Polypeptide and nucleic acid for improving amylose content of plants and application of polypeptide and nucleic acid |
| CN112877331A (en) * | 2021-03-09 | 2021-06-01 | 中国农业科学院作物科学研究所 | Method for creating high amylose corn germplasm |
| CN114591928A (en) * | 2022-04-02 | 2022-06-07 | 山东中农天泰种业有限公司 | dCAPS molecular marker related to amylopectin content of corn kernels |
| CN114591928B (en) * | 2022-04-02 | 2023-10-24 | 山东中农天泰种业有限公司 | dCAPS molecular marker related to amylopectin content of corn kernels |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107012163B (en) | 2019-09-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104846010B (en) | A kind of method for deleting transgenic paddy rice riddled basins | |
| CN103981211B (en) | A kind of breeding method formulating cleistogamous rice material | |
| CN105063083B (en) | Prevent method for creating and its application of the Rice Engineering maintainer of genetic drift | |
| CN107012163B (en) | A kind of method and its application of rite-directed mutagenesis initiative glutinous corn germplasm | |
| CN108728486A (en) | A kind of construction method of eggplant CRISPR/Cas9 gene knockout carriers and application | |
| CN104313034B (en) | The application of male sterility gene OsLAP5 and the method for recovering male sterility of rice | |
| EP3978613A1 (en) | Parthenogenetic haploid induction gene dmp and application thereof | |
| CN107245495A (en) | The method for creating of the common line with genic sterile of paddy rice and application | |
| CN115942867A (en) | Powdery mildew resistant cannabis plant | |
| CN106868036B (en) | A kind of method and its application of rite-directed mutagenesis initiative corn compact plant germplasm | |
| CN110540582A (en) | Application of protein OrC1 in regulating color of rice husk and awn | |
| CN107805632A (en) | OsMKK6 albumen and encoding gene are in the regulation and control developmental application of vegetable seeds | |
| CN111996192A (en) | Method for creating green-free green-shoulder tomato material and application thereof | |
| CN107805633A (en) | OsMPK4 albumen and encoding gene are in the regulation and control developmental application of vegetable seeds | |
| CN108441510A (en) | The cultivation of transgenic paddy rice GRH and black gold rice and the detection method of GRH target gene | |
| WO2022185307A1 (en) | Domestication of a legume plant | |
| CN108866080B (en) | Tomato stress response gene, recombinant expression vector thereof and application thereof in cultivation of salt-tolerant tomatoes | |
| CN115942868A (en) | Cannabis plant with increased yield | |
| CN116041466B (en) | Barley grain black character HvBlp gene and related molecular marker and application thereof | |
| US20230203513A1 (en) | Cucumber plant habit | |
| US20220186243A1 (en) | Cannabis plants with improved yield | |
| CN106244595A (en) | Lignum seu Ramulus Cunninghamiae Lanceolatae phytosulfokine-α CLPSK1 gene and application thereof | |
| CN108575729B (en) | Method for creating ornamental rice germplasm by using three rice transcription factor genes | |
| Litt | Comparative evolutionary genomics of land plants | |
| CN106866803A (en) | Plant phenotype GAP-associated protein GAP NRL2 and its encoding gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |