CN113774037B - Related protein for controlling rice flowering advancement and coding gene thereof - Google Patents

Abstract

The invention provides a related protein for controlling rice flowering, belonging to the technical field of rice genetic engineering, wherein the related protein is named as OsEMT3, and the amino acid sequence of the related protein is shown as SEQ I D No. 1. The encoding gene of OsEMT3 protein is knocked out through gene editing, so that the gene in advance of rice flowering can be obtained, the glume opening time is obviously advanced, and the hybrid rice seed production pollination rate is favorably improved. The invention also provides a coding gene of the related protein for controlling the advancing of rice flower.

Description

Related protein for controlling rice flowering advancement and coding gene thereof

Technical Field

The invention belongs to the technical field of rice genetic engineering, and relates to a related protein for controlling rice flowering advancing and a coding gene thereof.

Background

Rice (Oryza sativa L.) is an important food crop in China, and hybrid rice provides important guarantee for food safety in China. For years, the seed production cost of hybrid rice is always high, wherein the low seed production yield is an important reason. Research shows that the main factor for limiting the seed production yield of hybrid rice is the low cross-breeding seed setting rate of the sterile line, and the flowering habit of the sterile line is one of the determining factors influencing the cross-breeding seed setting rate. Generally, the glume-opening time of each day of the sterile line is generally later than that of the restorer line due to the negative effect of the sterile cytoplasm, and the male parent and the female parent are early and late in the process of seed production, so that a plurality of glumes of the sterile line miss pollination time and cannot fruit. From the perspective of genetic improvement, the discovery and utilization of early materials during the flowering are effective ways for fundamentally solving the problem of the non-occurrence of the flowering time in rice seed production. The aspects of regulation and control characteristics, character observation, genetic research, flowering time regulation and the like of rice flowering are reviewed, and a research theoretical basis is provided for research of related problems of hybrid rice breeding, seed production and flowering time.

The concept of rice flowering has been divided into two points in previous studies: 1) refers to the time from glume opening to glume closing of the first rice glume flower. 2) The method refers to the flowering time or the duration of flowering of rice in 1d in a field population glume flower, namely, the heading and flowering period, and the process is divided into initial flowers, full flowers and end flowers, and generally refers to the flowering peak or full flowers. For the research of flowering time, the research of field population glumes is mainly used. The time for opening and closing the glumes is influenced by the characteristics of varieties and environmental factors, and among a plurality of external factors influencing the glume opening of rice, the temperature is the most important influencing factor. The time when the rice glume flowers open in one day is mainly limited by the temperature of the day, and the rice glume flowers can be early or delayed due to the temperature. According to reports of Wangzhong, etc., soaking the rice ears in cold water of 0-10 deg.C and then placing them in room temperature of 20-30 deg.C or soaking them in warm water of 35-45 deg.C can promote glume-opening, which means that the glume-opening can be promoted by only increasing the temperature of the rice ears after high-temperature treatment or low-temperature treatment. The optimum humidity for rice flowering is 70% -80%, under the same temperature condition, more flowering can be achieved when the humidity is lower, and excessive humidity has influence on pollen germination. There are also studies showing that sufficient light is required for flowering of rice, flowering of mature rice is limited in the dark or in low light, but flowering can be induced by exposure to sufficient sunlight for several minutes, and in addition, the opening of rice glumes can be promoted by rubbing rice ears. The rice is a high-temperature short-day self-pollination crop, and has the characteristics of flowering habit, plant characters, flower organ structure and the like which are favorable for selfing but not favorable for cross-crossing in the long-term evolution process. The breeding of hybrid rice requires good cross-breeding of the sterile line, which is a basic prerequisite for determining whether the sterile line has production application prospect. The rice cross-breeding habit refers to the habit that the sterile line is suitable for supplying exogenous pollen in aspects of flowering habit, plant characters, flower organ structure and the like under the condition of non-artificial forced hybridization. Flowering habit refers to flowering time (group initial flowering time, full flowering time, final flowering time), glume opening amplitude and the like, and mainly influences the degree of flowering time meeting of parents and the capacity of the parents to accept pollen of male parents.

For the genetic research of flowering time, the WangJianjun and the like think that the early flowering time of rice is controlled by a pair of dominant genes; the Sunwei uses early flowering indica rice material 64 and late flowering japonica rice materials P4 and 02428 to carry out genetic research on flowering time, and the result shows that early flowering time is partially dominant; sheehy et al found that some wild rice resources have the property of early flowering; the survey of the flowering time of rice resources around the world by Nakagawa and the like shows that the flowering time of materials is normally distributed; jagadish et al found a resource CG14 in ordinary wild rice at early flowering; pham et al located two QTLs related to flowering time on chromosome 4 and 5 respectively by using a backcross population constructed by using japonica rice Nipponbare and Asia wild rice material W630; thanh and the like detect 3 early flowering genes by using a backcross population constructed by indica rice and common wild rice, and the 3 early flowering genes are respectively positioned on chromosomes 4, 5 and 10, so that the cumulative effect can promote glume flowers to bloom 30 minutes in advance at least; the F2 colony constructed by early flowering season and late flowering season japonica rice hybridization is detected by a composite interval mapping method in all countries, and 4 QTLs influencing flowering season are respectively located on the 1 st chromosome, the 10 th chromosome and the 12 th chromosome. For early genetic improvement in flowering time, early flowering materials of international oryza africana are crossed with IR36 to obtain a material that flowers one hour earlier than IR36 from progeny; the Sunyiwei et al think that the early flowering habit of indica rice can be transferred to japonica rice by adopting an indica-japonica hybridization mode; hideyuki et al used a backcross procedure to transfer the gene from the early flowering stage of wild rice to oryza sativa and mapped the gene primarily to chromosome 3, designated qEMF 3.

Many researches have been made on the process of opening and closing glumes of rice, and it is consistently thought that opening and closing glumes are respectively caused by water absorption and expansion of rice slices and water loss and wilting of the rice slices, but there are many different opinions on the mechanisms of water absorption and water loss of the rice slices: the process of opening and closing glumes of rice by predecessors has been studied, and it is considered that opening and closing glumes are caused by water absorption and expansion of rice pulp and water loss and wilting of the pulp. However, there are many different views on the mechanism of water absorption and water loss of the pulp sheet; the absorption of water by the pulp sheet is believed by seoul et al to be caused by an increase in osmotic pressure due to the conversion of mono-or polysaccharides originally present in the pulp sheet to mono-y sugars, while other researchers believe that the increase in osmotic material in the pulp sheet comes from the input of an assimilate in the small cob; wangzhi et al believe that the water absorption of the serosa during glume opening is controlled by the cell turgor pressure, and the turgor pressure is reduced depending on the relaxation of cell walls, so that as long as the wall of the serosa epidermal cells is relaxed, the cell turgor pressure is reduced to cause the cells to absorb water; evans et al believe that CO2 alters the structure of the cell wall by lowering pH, weakening or breaking the association of polymers in the cell, and can induce relaxation of plant cell walls by activating the properties of cell wall relaxing enzymes (Evans, 1971); mc Queen-Mason reported that two active proteins extracted from cucumber hypocotyls have the effect of relaxing cell walls under acidic conditions, they refer to the two proteins as swollenins, which are considered as enzymes for relaxing cell walls, Cosgrove indicates that swollenins play a major role in cell wall expansion, and that xyloglucanase, endoglucanase and other enzymes have the role of regulating swollenin in altering cell wall structure;

the pulp sheet is mainly a micro tissue composed of primary cell walls, wherein the cell walls are formed by interweaving dense cellulose microfibril, polysaccharide and a gum polysaccharide matrix embedded in the polysaccharide matrix. The cross-linking density of cellulose and hemicellulose determines the tensile strength of the cell wall. Xyloglucan is a hemicellulose-like polysaccharide present in the cell walls of all higher plants, for most dicotyledonous and non-gramineous plant monocotyledonous species. Its main chain is formed from beta-D- (1-4) -glucan skeleton, in the skeleton about 75% of glucose residues 6-position hydroxyl group is connected with alpha-D-xylosyl. The 2-hydroxyl of part of the alpha-D-xylosyl is also connected with a beta-galactosyl or alpha (1-2) fucosyl-beta (1-2) galactosyl part. This polysaccharide is considered to be an indispensable polysaccharide of a network structure composed of cellulose-hemicellulose, constituting flexible and expandable cell walls. The core structure of most xyloglucans is XXXG, with three consecutive glucose residues substituted with d-xylose at the (1 → 6) bond (X) and an unbranched fourth glycosyl residue (G). In arabidopsis, the MURUS3(MUR3) gene encodes a xyloglucan galactosyltransferase that specifically adds galactose to xylose with the third xylose residue located within the XXXG core structure. Since there is no additional galactose residue to the third xylose unit resulting in loss of function inactivation of MUR 3. Whereas AtFUT1 in arabidopsis has been cloned as early as 1999, it has 10 family members in the arabidopsis genome. AtFUT1 was constitutively expressed and was highly expressed at all tissue sites. However, other family members (AtFUT2-10) are expressed in plants in low abundance and have specific expression. In Arabidopsis thaliana rhamnogalacturonan I (RGI) RGII, arabinogalactan, N-linked glycan and xyloglucan all have fucose residues present, so that these xyloglucanotransferase genes encoding specific organs may act on fucosylation of other polysaccharides.

The plasma sheet cell wall is a complex network structure, which is mainly composed of cellulose, hemicellulose, pectin, and scalable proteins. Therefore, the change of the components can influence the structure establishment of the cell walls, change the osmotic pressure and the water absorption, and have certain relation with the glume opening of the rice.

Disclosure of Invention

In order to solve the technical problem that the glume opening time of a sterile line is slow, the invention provides a related protein for controlling the advancing of rice flower, which is named as OsEMT3, the gene of OsEMT3 protein is knocked out through gene editing, so that the advancing gene of rice flower can be obtained, the glume opening time is obviously advanced, and the improvement of the pollination rate of hybrid rice seed production is facilitated.

The invention also provides a coding gene of the related protein for controlling the advancing of rice flower.

The invention is realized by the following technical scheme:

the invention provides a related protein for controlling rice flowering, which is named as OsEMT3, and the amino acid sequence of the related protein is shown as SEQ ID No. 1.

Based on the same invention concept, the invention provides a coding gene of related protein for controlling rice blossom advancing, and the nucleotide sequence of the coding gene is shown as SEQ ID No. 2.

An application of the coding gene of related protein for controlling the early growth of rice flower in the three-line hybrid seed production or the safe production of rice yield.

Based on the same invention concept, the invention provides a premature flowering gene for controlling the advancing of rice flowering, and the nucleotide sequence of the premature flowering gene is shown as any one of SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5.

Further, the early flowering gene is obtained by carrying out gene editing on a coding gene of a related protein OsEMT3, the gene editing is carried out through a CRISPR/CAS9 system, and the nucleotide sequence of a target sequence adopted by the gene editing is shown as SEQ ID No. 6.

An application of early flowering gene for controlling early flowering in rice flowering in three-line breeding or breeding of high-temperature resistant rice varieties.

An sgRNA for knocking out a coding gene of related protein OsEMT3, wherein the nucleotide sequence of the sgRNA is shown as SEQ ID No.7 and SEQ ID No. 8.

A knockout vector for knocking out a coding gene of related protein OsEMT3 is disclosed, wherein a nucleotide sequence of a promoter of the knockout vector OsU6 is shown as SEQ ID No.9 and SEQ ID No. 10.

A target sequence for knocking out a coding gene of related protein OsEMT3 is disclosed, and the nucleotide sequence of the target sequence is shown as SEQ ID No.11 and SEQ ID No. 12.

A method of preparing a time-advanced rice variety, the method comprising:

constructing a CRISPR/CAS9 system expression vector containing the target sequence;

transforming the expression vector into a late-flowering japonica rice variety;

screening and identifying a transgenic homozygous strain with the coding gene of the related protein OsEMT3 knocked out, and obtaining a rice variety with advanced flowering.

A method of breeding a rice variety with an early flowering, the method comprising:

hybridizing a premature flowering rice variety serving as a non-recurrent parent and a restorer line or maintainer line variety with excellent agronomic characters serving as a recurrent parent to obtain a filial generation, wherein the premature flowering rice variety is prepared by the preparation method of the premature flowering rice variety;

carrying out auxiliary selection on the filial generation by adopting a molecular marker to obtain a material which has the early flowering gene and has the agronomic character tending to recurrent parent, and carrying out continuous backcross for 5-8 generations and then selfing for 1 generation to obtain BC_5-8F₂Selecting a strain with unseparated characters in advance of flowering to obtain a rice restorer line or maintainer line variety with advanced flowering;

the rice restoring line or maintaining line strain is hybridized with its matched sterile line, its progeny seed is used for sterile line seed production or breeding early-flowering hybrid rice seed, and the sterile line strain of seed production is hybridized with its matched restoring line, its progeny is production seed.

One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

1. the related protein for controlling the advancing of rice flowering is named as OsEMT3, the gene advancing of rice flowering can be obtained by knocking out the coding gene of OsEMT3 protein through gene editing, the glume opening time is obviously advanced, and the seed production and pollination rate of hybrid rice is improved.

2. The coding gene of the related protein for controlling the advancing of the rice flowering is used as the coding gene of the protein OsEMT3, the gene advancing of the rice flowering can be obtained by gene editing and knockout, the glume opening time of the rice is obviously advanced, the coding gene is insensitive to high-temperature illumination and other teaching, the coding gene can be used for sterile line seed production and novel high-temperature resistant variety cultivation, and the application of the coding gene in the field of rice flowering regulation is provided for the first time.

Drawings

In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings needed to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on the drawings without creative efforts.

FIG. 1 is a photograph comparing plants of wild Jamaica 1B and mutant emt 3: the left side is wild type Yixiang 1B, and the right side is mutant emt 3;

fig. 2 is a plot of the comparison of the local spike glume opening of wild type yixiang 1B and mutant emt 3: the shooting time was 9 in the morning: 00; wherein the upper WT is wild type Yixiang 1B, and the lower mutant is emt 3;

FIG. 3 is a histogram of plant height, ear number of seeds, and thousand seed weight statistics of wild type Yixiang 1B and mutant emt 3: wherein WT is wild type Yixiang 1B, and mutant is emt 3.

FIG. 4 is a gene mapping: in the figure, 1 is a mutant emt3,2 is a parent Nip,3 and 34 are exchange single strains, and the rest are F2 mutant character single strains;

FIG. 5 is a diagram of a Manhattan analysis of a connecting chromosome by gene mapping combined with whole genome re-sequencing of a Mutatmap;

FIG. 6 is an electrophoretogram of the primer OsEMT3 after amplification: wherein 1 is 5000bp DNA Marker, and 2 is OsEMT3 gene in wild Yixiang 1B genome; 3 and 4 are Osemt3 genes in the genome of mutant emt 3.

FIG. 7 is an amino acid sequence diagram: the marked site is the mutation site of the mutant emt 3.

FIG. 8 is a comparison chart of T1 plants of CRISPR/CAS9-OsEMT3 knockout positive plants: wherein Nip is negative control japonica rice variety Nipponbare, KO-1, KO-2 and KO-3 are independent positive transgenic lines respectively;

FIG. 9 is a glume comparison graph of T1 of CRISPR/CAS9-OsEMT3 knockout positive plants: and (3) a comparison graph of spike open conditions at 9:30 am, wherein Nip is a negative control japonica rice variety Nipponbare, and KO-1, KO-2 and KO-3 are independent transgenic positive lines respectively.

FIG. 10 is a statistical chart of full-bloom period of T1 of CRISPR/CAS9-OsEMT3 transgenic positive plants: wherein Nip is negative control japonica rice variety Nipponbare, KO-1, KO-2 and KO-3 are independent positive transgenic lines respectively.

FIG. 11 is a bar graph showing the enzymatic activity of xyloglucan polygalactotransferase of wild type Yixiang 1B and mutant emt 3: wherein WT is wild type Jatropha 1B, and the mutant is emt 3.

FIG. 12 is a transmission electron micrograph of the tissue of the slurry of wild type Yixiang 1B and mutant emt 3: wherein WT is wild type Yixiang 1B, and mutant is emt 3.

Detailed Description

The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly apparent therefrom. It will be understood by those skilled in the art that these specific embodiments and examples are for the purpose of illustrating the invention and are not to be construed as limiting the invention.

Throughout the specification, unless otherwise specifically noted, terms used herein should be understood as having meanings as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is a conflict, the present specification will control.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.

In order to solve the technical problems, the embodiment of the invention provides the following general ideas:

the invention researches the functions of OsEMT3 protein and coding genes thereof, which is based on national hybrid rice backbone parent Yixiang 1B, and obtains a rice flower time (i.e. glume flower open time) advanced mutant by screening in a chemical mutagenesis reagent Ethyl Methane Sulfonate (EMS) mutagenesis library, and the mutant is named emt3(early morphing flowering time 3). The advanced character of the flowering time is found to be controlled by a single recessive nuclear gene through genetic analysis. After further research, the gene mutant is found to have a glume blooming period about 2 hours earlier than that of the wild type, but the plant height, the number of grains of ears, the thousand-grain weight, and other yield traits are reduced to a certain extent.

LOC _ Os03g05110 gene (named OsEMT3, early burning floating time3) encodes xyloglucan galactosyltransferase (related protein OsEMT3), and the main biological function of the xyloglucan galactosyltransferase is a key enzyme for hemicellulose synthesis and is involved in the biological establishment of serosal cell walls.

The serosal cell wall is a complex network structure mainly composed of cellulose, hemicellulose, pectin, and scalable protein, so that a change in its composition affects the structure establishment of the cell wall, changing its osmotic pressure and water absorption. emt3 mutant has significantly improved water absorption rate due to the change of the components of the cell wall of the serosa, and under certain humidity, serosa tissue is more likely to absorb water and swell, thus leading to early development.

Based on the protein, the application provides a related protein for controlling the advancing of rice flower and a coding gene thereof.

The following will describe in detail a related protein and its encoding gene that are advanced when controlling rice flowering according to the present application, with reference to examples and experimental data.

Example 1

The embodiment provides the flowering phenotype identification and genetic analysis of the premature flowering mutant emt3 and the wild type Yixiang 1B, and provides the early flowering rice variety and lays the theoretical basis of the flowering research by analyzing the mechanism research of the xyloglucan polygalactosyltransferase coded by the gene on the establishment of plasma cell walls and the function of the xyloglucan polygalactosyltransferase in improving the variety cultivation in the rice flowering process so as to solve the problem of flowering asynchronism in the three-line hybrid seed production.

(I) test materials

(1) Wild type Yixiang 1B (indica type rice maintainer line) is bred by Sichuan Yibin farm institute, introduced by Sichuan university of agriculture rice research institute and stored.

(2) The mutant emt3 is obtained by screening a mutant library constructed by EMS (ethyl methane sulfonate) mutagenesis constructed by using indica rice maintainer line variety as background, and backcrossing the mutant with wild type Yixiang 1B for multiple generations, wherein the mutant character advanced during the flowering can be stably inherited.

(II) test method

(1) The mutant emt3 and the wild type Yixiang 1B are planted in the test fields of the Yangjiang school district of Hainan Ling water and Sichuan agriculture university at the same time during the flowering, the whole plants and the rice ear parts of the wild type Yixiang 1B and the mutant emt3 are photographed at 9:00 a morning in the plant maturation period, and the blooming period is counted, so that the result is shown in figure 1, figure 2 and table 1.

Agrobacterium infected (Agrobacterium) EHA105 was purchased from Dougen horse Biotechnology Ltd; escherichia coli (Escherichia coli) DH 5. alpha. was purchased from Gentle Biotech, Inc. of Beijing.

TABLE 1 survey table of wild type Yixiang 1B and mutant emt3 full-bloom period under different temperature conditions

(2) Genetic analysis test of early flowering mutant

Wild type Yixiang 1B and Huashi advanced mutant emt3 were planted in Qingpu garden test field at the school of Wenjiang, Sichuan university of agriculture. Positive and negative hybridization (emt3 XYixiang 1B, Yixiang 1B X emt3) is respectively carried out on the mutant emt3 and the wild type Yixiang 1B, and a genetic segregation population is constructed and used for counting the segregation ratio of F1 representative type and F2 generation populations.

The wild type Yixiang 1B and the mutant 0 are used for positive and negative hybridization to obtain F1 generation, F1 generation plants show normal glume opening time, and the plants do not appear earlier in flowering time like the wild type. The split ratio of wild type and early flower phenotype in F2 generation was 3:1, consistent with the split ratio of Mendelian single recessive gene, indicating that the premature character of mutant emt3 was controlled by the single recessive nuclear gene, as tested by the chi-square test (see Table 2).

TABLE 2 genetic analysis test results for the type flower time promontory variant emt3

Hybrid combinations	Normal plant	Early flower plant	Total number of plants	χc 2(3：1)	P
						Yixiang
1 Bx emt3	475	152	627	0.87	P<0.05
						emt3 XYixiang 1B	711	224	935	0.411	P<0.05

Example 2

In this example, agronomic traits of wild type Yixiang 1B, early flowering mutant emt3, and knockout strains KO-1, KO-2, KO-3 (early flowering gene sequences respectively correspond to SEQ ID NO. 3-5) of Cas9-OsEMT3 and wild type Nip are observed and counted.

Wild type Yixiang 1B, early flowering mutant emt3, transgenic CRISPR/Cas9 receptor material Nipponbare and CRISPR/Cas9 positive homozygous lines are respectively designed in Hainan water of Ling and Wenjiang according to random cell groups in summer in 2019 and spring and summer in 2020. The plant is set to repeat 3 rows, each row containing 10 plants. Randomly selecting 5 single plants with normal growth from each cell in the maturation period, respectively investigating related main agronomic characters, and setting three times of repetition. The seed test is carried out by adopting a ten thousand-deep SC-G automatic seed test analysis and a thousand-grain weight analyzer to investigate the grain type character, and the specific method is carried out according to the resource evaluation standard in the Chinese channel.

Example 3

This example performed a test for mapping and cloning of a candidate Gene for the premature flowering variant emt3

(I) test materials

The flowering time early mutant emt3, wild type Yixiang 1B and Nip (japonica rice variety) are provided by the genetic research laboratory of the rice institute of Sichuan university of agriculture.

(II) test method

(1) F is constructed by hybridizing the mutant emt3 with Nip of japonica rice variety₁Generation group, and selfing to obtain F₂Generation populations were used for genetic mapping. Construction of BC by backcrossing mutant emt3 with Yixiang 1B₁F₃The generation population is used for MutMap sequencing to perform gene fine positioning.

(2) Near isogenic pool construction

F from hybridization of emt3 with NIP₁Generation, F₁F obtained by selfing₂The population was isolated and gene mapping and analysis were performed using BAS (bulk stratification analysis). Firstly, 10 leaves of emt3 and Nip of a single plant are randomly and respectively selected, and DNA is extracted and built by equally mixing every 10 leaves to obtain 2 parent DNA mixed pools for screening the polymorphic molecular markers among parents. F resulting from hybridization of mutant emt3 with Nip₂Separation ofSelecting 10 leaves of single plants with early phenotype of flowering time and 10 leaves of single plants with wild normal phenotype from the population, mixing and extracting DNA (deoxyribonucleic acid) with equal amount of each 10 leaves, and respectively obtaining a dominant mixed pool and a recessive mixed pool for analyzing the linkage relation between the mutation character and the chromosome. Finally, F resulting from hybridization of mutant emt3 with Nip₂64 individual leaves with a flower time advancing phenotype are selected from the population, and the DNA is extracted by dividing the individual plants by adopting an improved CTAB method for gene localization.

(3) Mapping primer synthesis and Gene mapping

Firstly, carrying out PCR amplification by using 512 pairs of SSR primers (the specific sequences are shown in http:// www.gramene.org/bd/markers) which are stored in the research room and are evenly distributed on 12 chromosomes of rice, and screening out 68 pairs of primers with polymorphism between emt3 and an NIP genome by agarose gel electrophoresis; subsequently, the screened 68 pairs of polymorphic primers were used to detect dominant and recessive pools, and emt 3F constructed with NIP₂Recessive individuals in the population are subjected to gene primary positioning; in the initially positioned interval, according to the difference between nucleotide sequences of Nippon target regions of indica rice variety 9311 and japonica rice variety Nippon as published by (http:// www.gramene.org) website, Inde1 primers Indel 13 and Indel 14 (see table 3) are designed, the test result is shown in an electrophoresis chart 4, and the F constructed by a near isogenic pool emt3 and Nip is continuously detected₂200 recessive individuals in the population were mapped.

TABLE 3 PCR primers used in this experiment

Primer name	Forward primer sequence (5 '-3')	Reverse primer sequence (5 '-3')
			3-13	CATACTTCAGAACCAGACAAGC	CTCTTGAGTCACAACTGAAACC
3-15	TATCCAAGCCTCCATACACATAGTGC	ACAAGAGGTGAAGAACTGGATGAGC
			Indel 13	GACTTCTCCACTGTAGCATCTGTAGC	GAAGGTATCCATATGTGGAGGTAGGG
Indel
	14	AAGCAGGTCTTATTCAGCAACAGC	CAAGCCTGAAGCAGTAAATGTGC

Wherein the PCR reaction system (20 uL): taq enzyme (5U/uL)0.2uL, Primer (10mmol/L)2uL, dNTP (10mmol/L)0.3uL, DNA template (50-200 ng/. mu.L) 2uL, 10 XBuffer (25mM)2uL, ddH₂O13.5 uL. PCR reaction procedure: 95 ℃/5 min; 95 ℃/30s, 55 ℃/30s, 72 ℃/1min, steps 2-4, 34 cycles; 72 ℃/10min, 12 ℃/1 min.

The PCR amplification product was dissolved in 3.0% (7.5g agar powder in 300ml ddH)₂O), electrophoresed for about 45min-1h under the condition of constant voltage of 180V-200V, imaged by a Gel scanning imager (Bio-rad Gel Doc 2000) and recorded.

(4) Construction of linkage map

The individuals with the same type as emt3, II, III, IV and F were identified by using the biological analysis software Mapmake3.0₂Performing linkage analysis on the separation data of the molecular marker and the mutation character in the separation population, and converting the recombination value into a genetic map distance (cM, cent Morgan))。

The result shows that the two SSR markers 3-11 and 3-13 at the short arm end of chromosome 3 have close linkage relation with target traits, and the genetic distance is 0.16cM and 0.23cM respectively.

(5) Fine localization and prediction of candidate genes

To further narrow the localization zone, emt3 was used to hybridize with Yixiang 1B, followed by BCF₃Respectively randomly selecting 30 mutant plants with the phenotype of flower time advancing and 30 mutant plants with the phenotype of wild flower time similar in the population, and respectively forming a mutant mixed pool and a wild mixed pool by using the same amount of DNA for MutMap whole genome sequencing. And analyzing and reading the whole genome high-throughput sequencing result of the mutant by taking the wild type mixed pool genome sequence with normal phenotype as a reference group, wherein the sequencing depth is 30 layers. The sequencing data are completely compared with published Japanese fine reference genome (MSU Osa1 Release 7Annotation) by SOAP2 software, and short sequence segments at specific positions of chromosomes are screened out according to the initial positioning interval. Analyzing and interpreting Single Nucleotide Polymorphisms (SNP) SVs and InDels between the mutant and a Nipponbare reference group by using data analysis software such as SOAPsnp, SOAPsv, SOAPindel and the like, and screening out that 7 SNPs sites, 13bp base deletion at 1 position and 1 SVs specifically exist in the mutant ema-1 in a positioning interval. And (4) selecting continuously distributed high-delta SNP index readings with F2-read being more than or equal to 15 by calculating the delta SNP index. As shown in FIG. 5, the data analysis resulted in a scatter plot of SNP sites on 12 chromosomes. The high-Delta SNP index score and continuous distribution appear on the short arm of chromosome III, and are consistent with the initial localization interval of the chromosome III. Therefore, the interval of the candidate gene is positioned between the short arm physical distance 18M and 19M of the third chromosome, no gene related to the flowering time is reported, and the research result shows that the OsEMT3 is a new gene for controlling the flowering time.

Mutmap whole genome sequencing data analysis result, mutant emt3 mutant phenotype and rice genome annotation website: (http://rice.plantbiology.msu.ed/cgi-bin) And (a)http://plants.ensembl.org/ index.html) Combining the medium indica rice databases, and screening according to the gene function annotationWithin the localization interval, further analysis shows that most of the SNP sites are located in intergenic, intronic or synonymous mutation, and only one SNP site is located in the first exon of the gene LOC _ Os03g05110 and belongs to non-synonymous mutation. In order to confirm the reliability of the result of Mutmap re-sequencing, primers were designed for three SNP sites and deletion fragment given by the analysis company, PCR amplification was performed in the wild type and mutant respectively, and Sanger sequencing was performed (as shown in FIG. 6), and the result shows that SNP in which the site is not synonymous mutation is a single base mutation that is indeed occurred in the wild type and mutant, and matches the result given by the analysis company. The 1063 th base of CDS region of said coding protein gene is converted from G (guanine) to A (thymine), resulting in that the 355 th amino acid is mutated from G (neuraminic acid) to L (tryptophan), said base mutation can damage the normal coding sequence of protein, resulting in the damage of protein function, so that said gene LOC _ Os03G05110 is listed as the candidate gene of emt3 mutant.

Example 4

This example performs a CRISPR/CAS9 (Gene knockout) experiment on a premature flowering mutant emt3 candidate gene.

(I) test materials

Coli competence DH5 α used in this experiment was purchased from Beijing Panzhiji Biotechnology Ltd, and Agrobacterium EHA105 competent strain was purchased from Sichuan Mare Biotechnology Ltd.

(II) test method

1. CRISPR/Cas9-OsEMT3 gene knockout vector construction

The gene is amplified by respectively using cDNA of the mutant emt3 and Yixiang 1B, Nip as templates, and the condition that the gene has high homology with the amino acid sequences of the coding regions in Nip of indica rice Yixiang 1B and japonica rice is found, so that the protein coded by the gene can possibly exert similar biological functions in the indica rice Yixiang 1B and japonica rice Zhonghua 11.

A nucleotide sequence of OsEMT3(LOC _ Os03g05110) gene in Nippon rice variety Nip is taken as a template, a specific region is selected, 1 independent knockout target site is designed, BWA (V) H-CAS9 BGK03 gene knockout vector and CRISPR/CAS9-OsEMT3 vector are constructed by using a reference kit (Hangzhou Baige biology company). The specific construction process is as follows:

(1) the following adapter primers were designed and synthesized to form sgRNA target sequences:

F:5’-GTTTTAGAGCTAGAAATAGCAAGTTAAAAT-3’(SEQ ID NO.7)，

R:5’-CAAAATCTCGATCTTTATCGTTCAATTTTA-3’(SEQ ID NO.8)；

OsU6 promoter for knock-out

F:5’-AACTTATAAACCGCGCGCT-3’(SEQ ID NO.9)

R:5’-TTGAATATTTGGGCGCGCGA-3’(SEQ ID NO.10)

The target sequence for knocking out the target gene is as follows:

5’-GCAGGATAGAATGAGGAGCC-3’(SEQ ID NO.11)

5’-CGGCTCCTCATTCTATCCTGC-3’(SEQ ID NO.12)

(2) preparation of primer dimer

Dissolving the primer pair synthesized in the step (1) to 10 mu M by adding water, mixing according to the following reaction system, heating for 3 minutes at 95 ℃ in a PCR instrument, and then slowly reducing to 20 ℃ at about 0.2 ℃/second to obtain a primer dimer. The reaction system is as follows: annealing Buffer 18ul, gRNA target primer 1ul, adding ddH₂O, make up to 20 ul.

(3) The primer dimer was constructed into BWA (V) H vector. Mixing the components on ice according to the following reaction system, uniformly mixing, reacting at 20 ℃ for 1 hour, and transforming escherichia coli for later use to obtain an expression vector containing elements such as a promoter, a target sequence, gRNA and the like. The reaction system comprises the following steps: BWA (V) 2ul of H vector, 1ul of Oligo dimer, 1ul of enzyme mixture, and ddH₂O, make up to 10 ul.

2. Transformation of E.coli

(1) Taking out a tube of prepared escherichia coli competent cells from a refrigerator at the temperature of-80 ℃, and putting the escherichia coli competent cells on ice for thawing;

(2) adding 100 μ L of competent cell suspension into each 100ng of ligation product, mixing, and standing on ice for 30 min;

(3) heat shock is carried out for 30s at 42 ℃, and the mixture is quickly taken out and immediately placed on ice for 2 min;

(4) adding 500 μ L LB liquid culture medium without antibiotic, culturing at 37 deg.C and 200rpm for 1 hr to obtain activated bacteria liquid;

(5) centrifuging the activated bacterial liquid at 5000rpm for 1min, pouring out most of supernatant under aseptic condition, gently sucking and beating the mixed precipitate by using a pipette gun, sucking 100 mu L, transferring the bacterial liquid on a super clean bench and coating the bacterial liquid on an LB screening plate containing kanamycin;

(6) placing the LB solid culture medium plate coated with the bacterial liquid for about 10 minutes from the front side upwards, inverting the culture medium coated with the plate after the bacterial liquid is completely absorbed by the LB solid culture medium, and culturing overnight in a thermostat at 37 ℃;

(7) and (4) selecting a single colony, and carrying out PCR detection on the bacterial liquid by using a P-OsEMT3 primer. The P-OsEMT3 primer pair is as follows:

P-OsEMT3 KO-F:5'CCCAGTCACGACGTTGTAAA 3'(SEQ ID NO.13)；

P-OsEMT3 KO-R:5'TTGGGATGAGACTAATGACC 3'(SEQ ID NO.14)

wherein the PCR reaction program: 95 ℃/5 min; 35 cycles of 95 ℃/30s, 55 ℃/30s, 72 ℃/30 s; 72 ℃/10min, 12 ℃/1 min.

(8) The positive clones were picked up in 5ml of LB medium containing kanamycin (50mg/L), cultured at 37 ℃ for about 16 hours at 200rpm, and the resulting culture was stored and plasmids were extracted.

3. The E.coli Plasmid was extracted according to the instructions of the OMEGA Plasmid Extraction Kit, and the extracted Plasmid DNA was collected in a clean centrifuge tube and stored at-20 ℃.

4. Determination of plasmid sequence and sequence analysis

The positive clone plasmid was sent to Chengdu science and technology Co., Ltd for sequencing. And (3) carrying out sequence alignment on the sequencing result by using DNAMAN software, confirming the correctness of the gRNA sequence, and naming the positive cloning plasmid as CRISPR/Cas9-OsEMT 3.

5. Agrobacterium transformation

(1) Chemical transformation method of agrobacterium

According to one plasmid: 50ul of competent cells were taken out at-80 ℃ and thawed quickly; adding 0.4-1 ug of the constructed CRISPR/Cas9-OsEMT3 plasmid into 50ul of competent cells, and placing the competent cells on ice for 30 min; freezing in liquid nitrogen for 2 min; water bath at 37 deg.C for 2min to melt cells; immediately adding 5 times of LB liquid culture medium without antibiotics, and performing shake cultivation for 2-3 h at 28 ℃ and 170 rpm;

centrifuging at 7000rpm for 2 minutes, and suspending the cells in 100ul of LB liquid medium; coating on rifampicin and cana resistant plate, blow drying, and culturing at 28 deg.C for 2-3 days; carrying out PCR detection on bacteria liquid by using a hygromycin molecular marker P-OsEMT3 primer, adding glycerol serving as a protective agent into a positive agrobacterium monoclonal capable of amplifying a target strip, and storing at-80 ℃ for later use.

(2) Agrobacterium impregnation method for transforming rice

(a) Induction of callus: sterilizing Nipponbare seeds with 75% alcohol for 1min, rinsing with sterile water for 3 times, rinsing with 40% sodium hypochlorite for 30min, rinsing with sterile water for 5 times, placing in a culture dish with filter paper, draining, inoculating on NMB culture medium with tweezers, and culturing at 28 deg.C under illumination for 7 days. Subcultured every 7 days. After 2-3 subcultures, good calli grown from the seeds were picked, subcultured on NMB medium, and cultured in the dark at 28 ℃ for 4 days.

(b) Activation of agrobacterium strain: adding 30ul of Agrobacterium stored at-80 ℃ in (1) into 3mL of YEP liquid medium containing rifampicin and kanamycin, and performing shake culture at 28 ℃ for 14 h; then 1mL of the suspension is taken to be put into 50mLYEP liquid culture medium containing rifampicin and kanamycin, and the suspension is subjected to shaking culture for 4 hours at the temperature of 28 ℃ to obtain activated agrobacterium liquid.

(c) Co-culture transformation: centrifuging the activated bacteria liquid of (b) at 5000rpm to collect thallus, resuspending thallus with AAM liquid culture medium 30mL containing 100 μ M/L acetosyringone, soaking the callus selected in (a) in the bacteria liquid for 20min, sucking off the excess bacteria liquid, spreading on co-culture solid culture medium, and dark culturing at 28 deg.C for 2 d.

(d) Callus degerming culture and callus resistance screening: washing the callus after co-culture for 2d with sterile water until the water is clear, then shaking with sterile water containing cefamycin (500mg/L) for 30min for sterilization, thoroughly sucking the callus with sterile filter paper or absorbent paper, and then inoculating on a selective culture medium for about 3 weeks.

(e) Differentiation and rooting of transgenic plants: inoculating the newly grown resistant callus in the step (d) to a differentiation culture medium, culturing for 1-2 months under illumination, then transferring the grown seedlings with the height of about 3cm to a rooting culture medium for rooting culture, taking leaves to extract DNA when the seedlings grow to about 10cm, and finally obtaining 3 transgenic positive plants by utilizing p-OsEMT3 sexual plantlets of the amplified target gene full-length DNA. The 5 transgenic positive plants were named: KO-1, KO-2, KO-3;

(f) and (4) hardening seedlings indoors for 2-3 days, and transplanting the positive transgenic plants into a field.

6. Detection of transgenic Rice

(1) Extracting the DNA of the positive transgenic plant obtained in the step 5 by using an improved CTAB method, amplifying the full-length sequence of the knockout target gene in the transgenic plant by using a Pemf1-2 primer pair, wherein the size of the PCR product fragment is 780 bp. The Pemf1-2 primer pair is as follows:

the Pemf1-2 primer pair is:

Pemf1-2 F:5'TGATAGATTGGCTGAGGAAG 3'(SEQ ID NO.15)，

Pemf1-2 R:5'TTGGGATGAGACTAATGACC 3'(SEQ ID NO.16)；

wherein the PCR reaction system (25 uL): tap enzyme (5U/. mu.L) 0.5ul, Primer (10 mmol/. mu.L) 2ul, dNTP (2.5 mmol/. mu.L) 0.5ul, DNA (20-100 ng/. mu.L) 2ul, 2 XBuffer (25mM)12.5ul, ddH₂O7.5 ul. The PCR reaction program is: 5min at 95 ℃; 30 cycles of 95 ℃ for 30s, 56 ℃ for 5s, and 72 ℃ for 2.5 min; 72 ℃ for 10min and 12 ℃ for 1 min.

(2) Recovery and sequencing of PCR products

Adding bromophenol blue indicator into the product after the reaction is finished after PCR amplification, performing electrophoresis in 2% agarose, recovering by using a Tiangen PCR product recovery kit, and storing, wherein the reaction system specifically comprises the following components:

1) after the segments are completely separated, rapidly cutting the target strip with a knife under an ultraviolet lamp, and placing the cut strip into a new EP tube

2) Weighing gel block on electronic balance, adding appropriate amount of Binding Buffer according to the proportion of 1g gel to 1ml Binding Buffer, and water-bathing in 60 deg.C water bath for 10min until gel block is completely dissolved, and gently inverting once every 2-3min

3) The HiBind DNA column was fitted into a 2ml collection tube

4) Transferring the gel mixture to Hibind DNA column, centrifuging at 10000xg/min for 1min

5) Discarding the filtrate, reloading the column into the collection tube (the Hibind column can contain 700 mul of solution once), and repeating the steps 4-5.

6) The column was returned to the collection tube, 300. mu.l of Bind Buffer was added thereto, and the mixture was centrifuged at 10000Xg/min for 1min, and the filtrate was discarded

7) The column was returned to the collection tube, 700. mu.l of SPW Wash Buffer, 10000Xg/min centrifugation 1 dish was added, the bottom solution was discarded (SPW Wash Buffer was diluted with absolute ethanol first)

8) Repeat step 8 once

9) Discarding the filtrate, knocking the column into collecting tube again, centrifuging at 13000Xg idle for 2min

10) The column was re-loaded in a sterilized 1.5ml EP tube, 40. mu.l of Elution Buffer heated in a bath at 65 ℃ was added, the mixture was left to stand at room temperature for 2min, centrifuged at 13000Xg/min for 2min to elute the DNA, gel electrophoresis was performed, Maker was spotted on the gel to analyze the integrity and concentration of the purified DNA, and the DNA was then detected and sent to Duke science and technology Co., Ltd for sequencing.

Results (see FIGS. 8-9) all 3 independent transgenic positive lines showed early floral mutations. Compared with a negative control, 3 transgenic plants respectively generate single base mutation in the CDS coding region of the OsEMT3 gene (see SEQ ID NO. 3-SEQ ID NO. 5). Knockout experiments of the OsEMT3 gene show that the OsEMT3 gene is a gene for controlling early phenotype of flowering; OsEMT3 was also shown to be the gene controlling the mutant emt3 early flowering phenotype.

7. The transgenic knockout lines KO-1, KO-2, KO-3 and the control variety Nipponbare were subjected to the counting of the glume-opening time in the blooming period by the method described in example 2.

The results (see FIG. 10, Table 4) show that similar to the early flowering trait of mutant emt3, the glume opening time of transgenic lines KO-1, KO-2, KO-3 knock-out OsEMT3 gene compared to the control Nip compared to the negative control Nip, indicating that editing (including one or more additions, substitutions and deletions) of the other CDS coding region (relative to mutant emt3 mutation site) of OsEMT3 gene also results in the phenotype advanced when mutant emt3 flowers; the Osemt3 gene is a related gene for spikelet glume opening, and rice glume opening can be performed in advance after the gene is knocked out.

TABLE 4 comparison of glume opening times of knockout OsEMT3 transgenic lines relative to flower 11 in negative control

Example 5

In this example, the enzymatic activities of the precocious flowering mutant emt3 and the wild xyloglucan galactosyltransferase of Yixiang 1B were measured, and the measurement kit was purchased from Chengdu horse Biotechnology Ltd.

Tissue specimen: after the glume flowers of the wild type yixiang 1B and the mutant emt3 were selected, respectively, the weights were weighed. An amount of PBS, pH7.4 was added. And (5) rapidly freezing and storing the mixture by using liquid nitrogen for later use. The temperature of the specimen is still kept between 2 and 8 ℃ after the specimen is melted. An amount of PBS (pH7.4) was added and the specimen was homogenized thoroughly by hand or using a homogenizer. Centrifugation was carried out for about 20 minutes (2000-. The supernatant was carefully collected. Subpackaging the obtained product, detecting one part of the obtained product, and freezing the rest part of the obtained product for later use.

The specific operation steps are as follows:

1. sample adding of the standard: and arranging a standard product hole and a sample hole, wherein 50 mu L of standard products with different concentrations are added into the standard product hole respectively.

2. Sample adding: blank holes (blank reference holes are not added with samples and enzyme labeling reagents, and the rest steps are operated in the same way) are respectively arranged in the sample holes to be detected. And adding 40 mul of sample diluent into the sample hole to be detected on the enzyme-labeled coated plate, and then adding 10 mul of sample to be detected (the final dilution of the sample is 5 times). Adding sample to the bottom of the plate hole of the enzyme label, keeping the sample from touching the hole wall as much as possible, and gently shaking and mixing the sample and the hole wall.

3. Adding an enzyme: add 100. mu.l of enzyme labeling reagent to each well except for blank wells.

4. And (3) incubation: the plates were sealed with a sealing plate and incubated at 37 ℃ for 60 minutes.

5. Preparing liquid: diluting the 20 times of concentrated washing solution with 20 times of distilled water for later use.

6. Washing: carefully uncovering the sealing plate film, discarding liquid, spin-drying, filling washing liquid into each hole, standing for 30 seconds, then discarding, repeating the steps for 5 times, and patting dry.

7. Color development: adding 50 μ l of color-developing agent A and 50 μ l of color-developing agent B into each well, shaking gently, mixing, and developing at 37 deg.C in dark for 15 min.

8. And (4) terminating: the reaction was stopped by adding 50. mu.l of stop solution to each well (blue color immediately turned yellow).

9. And (3) determination: the absorbance (OD value) of each well was measured sequentially at a wavelength of 450nm with the blank well being zeroed. The measurement should be performed within 15 minutes after the addition of the stop solution.

Example 6

In this example, transmission electron microscopy images of plasma slice tissues of the premature flowering mutant emt3 and wild type Yixiang 1B were prepared by Biotech Inc. in Chengdu, and the specific steps were as follows:

1 materials and methods

1.1 specimen

Fixing with 3% glutaraldehyde; the fixation state was good.

TABLE 5 organizational grouping and numbering

1.2 reagent consumables

812 epoxy resin embedding set: GP18010, Standard 1375g, Beijing Zhongke Chinesemeter technologies, Inc.

Uranyl acetate: GS02624, 25 g/bottle, Beijing Mitsugaku Instrument technologies, Inc.

Lead citrate dye solution: GZ02616, 1ml × 10 pieces/box, Beijing Zhongjing Chinacolo instruments technology Co.

Osmium tetroxide: the sample number GP18456, specification 1 g/count, import split charging, comes card.

1.3 instruments

Transmission electron microscope: model JEM-1400PLUS, manufactured by Japanese Electron (JEOL).

Leica tissue processor: EM TP, come card production.

Glass cutter making machine: EM KMR3, produced by Leica.

Ultra-thin slicer: EM UC7, comes card production.

1.4 fixation

The samples were pre-fixed with 3% glutaraldehyde and re-fixed with 1% osmium tetroxide.

1.5 dehydration

The acetone is gradually dehydrated, and the concentration gradient of the dehydrating agent is 30% → 50% → 70% → 80% → 90% → 95% → 100% (3 times of exchange in 100% concentration).

1.6 infiltration and embedding

And (3) passing the dehydrated sample through a dehydrating agent and an epoxy resin (Epon 812) penetrating fluid in a ratio of 3:1, 1:1 and 1:3 respectively, wherein each step is 30-60 min. The infiltrated sample block is placed in a suitable mold, filled with embedding fluid to embed and form a solid matrix (embedding block) by heating polymerization, and the next section is prepared.

1.7 ultrathin section

An ultrathin section with the thickness of about 50nm is prepared by an ultrathin slicer, then floats on the liquid surface of the cutter groove, and is fished to a copper net.

1.8 section staining (double staining method)

And (3) dyeing for 10-15 min by using uranium acetate, dyeing for 1-2 min by using lead citrate, dyeing at room temperature, and observing by using a JEM-1400PLUS transmission electron microscope.

Detailed description of the drawings fig. 12:

FIG. 12 is a transmission electron micrograph of the serosa tissues of wild-type Jatropha 1B and mutant emt3, wherein WT is wild-type Jatropha 1B and mutant is emt 3.

The main body OsEMT3 protein is xyloglucan polygalactotransferase reported by system research, which is a type of regulatory protein existing on cell walls, can cut off and re-link one xyloglucan chain to another non-reducing group of the xyloglucan chain, regulates the rearrangement of polysaccharide chains and the deposition of newly-combined polysaccharide chains on the cell walls in the cell growth process, and the xyloglucan polygalactotransferase regulates the synthesis and modification of xyloglucan in the cell walls, and the xyloglucan is a main raw material for forming hemicellulose.

The loss of function of the OsEMT3 gene in the mutant emt3 causes the relative content of xyloglucan galactosyltransferase in the serosa to be reduced (as shown in figure 11), the content of hemicellulose to be reduced, and the 'fillers' (mostly polymers of pectin-hemicellulose-scalable protein) between serosa cells to be reduced, so that the serosa cells are easier to absorb water and swell, the flowering time of the serosa cells is remarkably advanced, and the early flowering mutation phenomenon occurs.

One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

(1) the related protein for controlling the advancing of rice flowering is named as OsEMT3, the gene advancing of rice flowering can be obtained by knocking out the coding gene of OsEMT3 protein through gene editing, the glume opening time is obviously advanced, and the seed production and pollination rate of hybrid rice is improved.

(2) The coding gene of the related protein for controlling the rice flowering process advancing is used as the coding gene of the protein OsEMT3, the gene for controlling the rice flowering process advancing can be obtained by gene editing and knocking out, the glume opening time of rice is obviously advanced, the coding gene is insensitive to high-temperature illumination and other regulating teachings, the coding gene can be used for sterile line seed production and novel high-temperature resistant variety cultivation, and the application of the coding gene in the field of rice flowering process regulation is firstly proposed.

Finally, it should also be noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> Sichuan university of agriculture

<120> a related protein for controlling rice flowering and a gene encoding the same

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 604

<212> PRT

<213> 1 (Artificial sequence)

<400> 1

Met Ser Ala Met Arg Arg Arg Pro Val Leu Pro Thr His Gln Asp Asp

1 5 10 15

Met Glu Lys Val Gly Gly Lys Pro Pro Gln Ser Arg Leu Cys Phe Leu

20 25 30

Ala Thr Leu Cys Ala Met Phe Trp Val Leu Ile Phe Tyr Phe His Phe

35 40 45

Phe Val Ile Ala Asn Glu Pro Gly Ser Ala Gly Ala Asp Thr Ala Ala

50 55 60

Gly Ala Ala Ala Ser Ile Ala Arg Ala Glu Leu Pro Leu Pro Glu Pro

65 70 75 80

Glu Arg Val Ser Asp Pro Ala Val Pro Leu Pro Pro Pro Ala Leu Val

85 90 95

Ser Glu Pro Pro Pro Thr Thr Ala Thr Val Ala Lys Val Glu Asp Glu

100 105 110

Glu Lys Pro Thr Ala Val Ala His Gln Glu Ala Ala Pro Arg Asp Tyr

115 120 125

Ala Phe Gln Arg Ala Leu Lys Thr Ala Glu Asn Lys Ser Asp Pro Cys

130 135 140

Gly Gly Arg Tyr Ile Tyr Val His Glu Leu Pro Pro Arg Phe Asn Asp

145 150 155 160

Asp Met Leu Arg Glu Cys Glu Arg Leu Ser Leu Trp Thr Asn Met Cys

165 170 175

Lys Phe Met Ser Asn Glu Gly Leu Gly Pro Pro Leu Gly Asn Glu Glu

180 185 190

Gly Val Phe Ser Asn Thr Gly Trp Tyr Ala Thr Asn Gln Phe Met Val

195 200 205

Asp Val Ile Phe Arg Asn Arg Met Lys Gln Tyr Glu Cys Leu Thr Lys

210 215 220

Asp Ser Ser Ile Ala Ala Ala Val Phe Val Pro Phe Tyr Ala Gly Phe

225 230 235 240

Asp Val Ala Arg Tyr Leu Trp Gly His Asn Ile Ser Thr Arg Asp Ala

245 250 255

Ala Ser Leu Asp Leu Ile Asp Trp Leu Arg Lys Arg Pro Glu Trp Asn

260 265 270

Val Met Gly Gly Arg Asp His Phe Leu Val Gly Gly Arg Ile Ala Trp

275 280 285

Asp Phe Arg Arg Leu Thr Asp Glu Glu Ser Asp Trp Gly Asn Lys Leu

290 295 300

Leu Phe Met Pro Ala Ala Lys Asn Met Ser Met Leu Val Val Glu Ser

305 310 315 320

Ser Pro Trp Asn Ala Asn Asp Phe Ala Ile Pro Tyr Pro Thr Tyr Phe

325 330 335

His Pro Ala Lys Asp Ala Asp Val Leu Leu Trp Gln Asp Arg Met Arg

340 345 350

Ser Leu Glu Arg Pro Trp Leu Phe Ser Phe Ala Gly Ala Pro Arg Pro

355 360 365

Asp Asp Pro Lys Ser Ile Arg Ser Gln Leu Ile Asp Gln Cys Arg Thr

370 375 380

Ser Ser Val Cys Lys Leu Leu Glu Cys Asp Leu Gly Glu Ser Lys Cys

385 390 395 400

His Ser Pro Ser Ala Ile Met Asn Met Phe Gln Asn Ser Leu Phe Cys

405 410 415

Leu Gln Pro Gln Gly Asp Ser Tyr Thr Arg Arg Ser Ala Phe Asp Ser

420 425 430

Met Leu Ala Gly Cys Ile Pro Val Phe Phe His Pro Gly Ser Ala Tyr

435 440 445

Val Gln Tyr Thr Trp His Leu Pro Lys Asn Tyr Thr Arg Tyr Ser Val

450 455 460

Phe Ile Pro Glu Asp Gly Val Arg Lys Gly Asn Val Ser Ile Glu Asp

465 470 475 480

Arg Leu Lys Ser Ile His Arg Asp Met Val Lys Lys Met Arg Glu Glu

485 490 495

Val Ile Ser Leu Ile Pro Arg Val Ile Tyr Ala Asp Pro Arg Ser Lys

500 505 510

Leu Glu Thr Leu Lys Asp Ala Phe Asp Val Ser Val Glu Ala Ile Ile

515 520 525

Asn Lys Val Thr Gln Leu Arg Arg Asp Ile Ile Glu Asp His Glu Asp

530 535 540

Lys Asp Phe Val Glu Glu Asn Ser Trp Lys Tyr Asp Leu Leu Glu Glu

545 550 555 560

Gly Gln Arg Thr Ile Gly Pro His Glu Trp Asp Pro Phe Phe Ser Lys

565 570 575

Pro Lys Asp Lys Gly Gly Asp Ser Thr Asn Pro Ser Thr Asn Ala Ala

580 585 590

Lys Asn Ser Trp Lys Asn Glu Gln Arg Gly Gln Asn

595 600

<210> 2

<211> 1815

<212> DNA

<213> 2 (Artificial sequence)

<400> 2

atgtctgcta tgaggcggcg gccggtgctg ccgactcacc aggacgacat ggagaaggtg 60

ggcgggaagc cgccgcagtc gcgcctctgc ttcctcgcca cgctctgcgc catgttctgg 120

gtcctcatct tctacttcca tttcttcgtc atcgccaacg agcctggctc cgcgggggcg 180

gacaccgccg ccggcgccgc ggcgagcatt gcccgcgcag aacttccgct ccccgaaccc 240

gagcgcgtct ccgatcccgc ggttcccctc cctccgcctg ccctcgtctc ggagccgcca 300

cctaccaccg ctactgtcgc caaagtggaa gatgaggaga agcccacggc cgtcgcccac 360

caggaggcgg cgcccaggga ttacgcgttc cagcgagcgc tcaagaccgc ggagaacaag 420

agcgacccgt gcggcggccg gtacatctac gtgcacgagc tgccgccgcg gttcaacgac 480

gacatgctcc gggagtgcga gaggctcagc ctctggacca atatgtgcaa gttcatgagc 540

aacgaagggc ttggtccgcc gttgggcaac gaggaagggg tgttctccaa caccggctgg 600

tacgcgacga accagtttat ggtggatgtc atcttcagga accggatgaa gcagtacgag 660

tgcctgacca aggactcatc catcgctgcc gcggtgtttg tgccgttcta cgccgggttt 720

gatgtggcga ggtatctttg ggggcacaac atttcgacga gggatgccgc gtcgctggat 780

ttgatagatt ggctgaggaa gaggcctgaa tggaatgtga tgggcgggcg tgaccatttc 840

ttagttggcg gcaggattgc gtgggatttc aggcgcttga cggacgaaga gtcggattgg 900

ggcaacaagc tgcttttcat gccggctgcg aagaatatgt cgatgttggt ggtggagtca 960

agcccatgga atgccaatga ttttgcgata ccatatccta cttacttcca ccctgccaag 1020

gatgctgatg ttttgctttg gcaggataga atgaggagcc tggaacgacc atggttgttc 1080

tcgtttgctg gggctcctcg tcctgatgat cccaagtcca tcagaagtca gcttattgat 1140

caatgcagga catcaagtgt ctgtaaattg ctggagtgtg atcttgggga gagcaagtgc 1200

cattccccta gcgcaatcat gaatatgttc cagaactctt tgttctgctt gcagccccaa 1260

ggtgattcgt atacgagaag atctgccttc gactcgatgc tggctggttg cattcctgtt 1320

ttctttcatc ctggttcagc gtatgtccaa tatacgtggc atcttccgaa gaactataca 1380

cggtactctg tcttcatccc tgaagatggc gtccgtaagg gaaatgtcag cattgaggac 1440

aggcttaaaa gtatccatcg agatatggtc aagaagatga gggaagaggt cattagtctc 1500

atcccaaggg tgatatatgc tgatccaagg tcaaagctgg agaccctgaa ggatgcattc 1560

gatgtttctg tagaggcaat aattaacaag gtgacacagt tgagaagaga tatcatcgaa 1620

gatcatgaag ataaagattt tgttgaagag aatagctgga agtatgatct gttggaagaa 1680

gggcagagga caattggacc tcatgaatgg gacccgttct tctctaagcc caaggacaag 1740

ggtggagatt ctactaatcc atctactaat gctgccaaga actcctggaa aaacgaacaa 1800

agaggtcaga actaa 1815

<210> 3

<211> 1814

<212> DNA

<213> 3 (Artificial sequence)

<400> 3

atgtctgcta tgaggcggcg gccggtgctg ccgactcacc aggacgacat ggagaaggtg 60

ggcgggaagc cgccgcagtc gcgcctctgc ttcctcgcca cgctctgcgc catgttctgg 120

gtcctcatct tctacttcca cttcttcgtc atcgccaacg agcctggctc cgcgggggcg 180

gacaccgccg ccggcgccgc ggcgagcatt gcccgcgcag aacttccgct ccccgaaccc 240

gagcgcgtct ccgatcccgc ggttcccctc cctccgcctg ccctcgtctc ggagccgcca 300

cctaccaccg ctactgtcgc caaagtggaa gatgaggaga agcccacggc cgtcgcccac 360

caggaggcgg cgcccaggga ttacgcgttc cagcgagcgc tcaagaccgc ggagaacaag 420

agcgacccgt gcggcggccg gtacatctac gtgcacgagc tgccgccgcg gttcaacgac 480

gacatgctcc gggagtgcga gaggctcagc ctctggacca atatgtgcaa gttcatgagc 540

aacgaagggc ttggtccgcc gttgggcaac gaggaagggg tgttctccaa caccggctgg 600

tacgcgacga accagtttat ggtggatgtc atcttcagga accggatgaa gcagtacgag 660

tgcctgacca aggactcgtc catcgctgcc gcggtgtttg tgccgttcta cgccgggttt 720

gatgtggcga ggtatctttg ggggcacaac atttcgacga gggatgccgc gtcgctggat 780

ttgatagatt ggctgaggaa gaggcctgaa tggaatgtga tgggcgggcg tgaccatttc 840

ttagttggcg gcaggattgc gtgggatttc aggcgcttga cggacgaaga gtcggattgg 900

ggcaacaagc tgcttttcat gccggctgcg aagaatatgt cgatgttggt ggtggagtca 960

agcccatgga atgccaatga ttttgcgata ccatatccta cttacttcca ccctgccaag 1020

gatgctgatg ttttgctttg gcaggataga atgaggagcc tggaacgacc atggttgttc 1080

tcgttgctgg ggctcctcgt cctgatgatc ccaagtctat cagaagtcag cttattgatc 1140

aatgcaggac atcaagtgtc tgtaaattgc tggagtgtga tcttggggag agcaagtgcc 1200

attcccctag cgcaatcatg aatatgttcc agaactcttt gttctgcttg cagccccaag 1260

gtgattcgta tacgagaaga tctgccttcg actcgatgct ggctggttgc attcctgttt 1320

tctttcatcc tggttcagcg tatgtccaat atacgtggca tcttccgaag aactatacac 1380

ggtactctgt cttcatccct gaagatggcg tccgtaaggg aaatgtcagc attgaggaca 1440

ggcttaaaag tatccatcca gatatggtca agaagatgag ggaagaggtc attagtctca 1500

tcccaagggt gatatatgct gatccaaggt caaagctgga gaccctgaag gatgcattcg 1560

atgtttctgt agaggcaata attaacaagg tgacacagtt gagaagagat atcatcgaag 1620

atcatgaaga taaagatttt gttgaagaga atagctggaa gtatgatctg ttggaagaag 1680

ggcagaggac aattgggcct catgaatggg acccgttctt ctctaagccc aaggacaagg 1740

gtggagattc tactaatcca tctactaatg ctgccaagaa ctcctggaaa aacgaacaaa 1800

gaggtcagaa ctaa 1814

<210> 4

<211> 1815

<212> DNA

<213> 4 (Artificial sequence)

<400> 4

atgtctgcta tgaggcggcg gccggtgctg ccgactcacc aggacgacat ggagaaggtg 60

ggcgggaagc cgccgcagtc gcgcctctgc ttcctcgcca cgctctgcgc catgttctgg 120

gtcctcatct tctacttcca cttcttcgtc atcgccaacg agcctggctc cgcgggggcg 180

gacaccgccg ccggcgccgc ggcgagcatt gcccgcgcag aacttccgct ccccgaaccc 240

gagcgcgtct ccgatcccgc ggttcccctc cctccgcctg ccctcgtctc ggagccgcca 300

cctaccaccg ctactgtcgc caaagtggaa gatgaggaga agcccacggc cgtcgcccac 360

caggaggcgg cgcccaggga ttacgcgttc cagcgagcgc tcaagaccgc ggagaacaag 420

agcgacccgt gcggcggccg gtacatctac gtgcacgagc tgccgccgcg gttcaacgac 480

gacatgctcc gggagtgcga gaggctcagc ctctggacca atatgtgcaa gttcatgagc 540

aacgaagggc ttggtccgcc gttgggcaac gaggaagggg tgttctccaa caccggctgg 600

tacgcgacga accagtttat ggtggatgtc atcttcagga accggatgaa gcagtacgag 660

tgcctgacca aggactcgtc catcgctgcc gcggtgtttg tgccgttcta cgccgggttt 720

gatgtggcga ggtatctttg ggggcacaac atttcgacga gggatgccgc gtcgctggat 780

ttgatagatt ggctgaggaa gaggcctgaa tggaatgtga tgggcgggcg tgaccatttc 840

ttagttggcg gcaggattgc gtgggatttc aggcgcttga cggacgaaga gtcggattgg 900

ggcaacaagc tgcttttcat gccggctgcg aagaatatgt cgatgttggt ggtggagtca 960

agcccatgga atgccaatga ttttgcgata ccatatccta cttacttcca ccctgccaag 1020

gatgctgatg ttttgctttg gcaggataga atgaggagcc tggaacgacc atggttgttc 1080

tcatttgctg gggctcctcg tcctgatgat cccaagtcta tcagaagtca gcttattgat 1140

caatgcagga catcaagtgt ctgtaaattg ctggagtgtg atcttgggga gagcaagtgc 1200

cattccccta gcgcaatcat gaatatgttc cagaactctt tgttctgctt gcagccccaa 1260

ggtgattcgt atacgagaag atctgccttc gactcgatgc tggctggttg cattcctgtt 1320

ttctttcatc ctggttcagc gtatgtccaa tatacgtggc atcttccgaa gaactataca 1380

cggtactctg tcttcatccc tgaagatggc gtccgtaagg gaaatgtcag cattgaggac 1440

aggcttaaaa gtatccatcc agatatggtc aagaagatga gggaagaggt cattagtctc 1500

atcccaaggg tgatatatgc tgatccaagg tcaaagctgg agaccctgaa ggatgcattc 1560

gatgtttctg tagaggcaat aattaacaag gtgacacagt tgagaagaga tatcatcgaa 1620

gatcatgaag ataaagattt tgttgaagag aatagctgga agtatgatct gttggaagaa 1680

gggcagagga caattgggcc tcatgaatgg gacccgttct tctctaagcc caaggacaag 1740

ggtggagatt ctactaatcc atctactaat gctgccaaga actcctggaa aaacgaacaa 1800

agaggtcaga actaa 1815

<210> 5

<211> 1815

<212> DNA

<213> 5 (Artificial sequence)

<400> 5

atgtctgcta tgaggcggcg gccggtgctg ccgactcacc aggacgacat ggagaaggtg 60

ggcgggaagc cgccgcagtc gcgcctctgc ttcctcgcca cgctctgcgc catgttctgg 120

gtcctcatct tctacttcca cttcttcgtc atcgccaacg agcctggctc cgcgggggcg 180

gacaccgccg ccggcgccgc ggcgagcatt gcccgcgcag aacttccgct ccccgaaccc 240

gagcgcgtct ccgatcccgc ggttcccctc cctccgcctg ccctcgtctc ggagccgcca 300

cctaccaccg ctactgtcgc caaagtggaa gatgaggaga agcccacggc cgtcgcccac 360

caggaggcgg cgcccaggga ttacgcgttc cagcgagcgc tcaagaccgc ggagaacaag 420

agcgacccgt gcggcggccg gtacatctac gtgcacgagc tgccgccgcg gttcaacgac 480

gacatgctcc gggagtgcga gaggctcagc ctctggacca atatgtgcaa gttcatgagc 540

aacgaagggc ttggtccgcc gttgggcaac gaggaagggg tgttctccaa caccggctgg 600

tacgcgacga accagtttat ggtggatgtc atcttcagga accggatgaa gcagtacgag 660

tgcctgacca aggactcgtc catcgctgcc gcggtgtttg tgccgttcta cgccgggttt 720

gatgtggcga ggtatctttg ggggcacaac atttcgacga gggatgccgc gtcgctggat 780

ttgatagatt ggctgaggaa gaggcctgaa tggaatgtga tgggcgggcg tgaccatttc 840

ttagttggcg gcaggattgc gtgggatttc aggcgcttga cggacgaaga gtcggattgg 900

ggcaacaagc tgcttttcat gccggctgcg aagaatatgt cgatgttggt ggtggagtca 960

agcccatgga atgccaatga ttttgcgata ccatatccta cttacttcca ccctgccaag 1020

gatgctgatg ttttgctttg gcaggataga atgaggagcc tggaacgacc atggttgttc 1080

ccgtttgctg gggctcctcg tcctgatgat cccaagtcta tcagaagtca gcttattgat 1140

caatgcagga catcaagtgt ctgtaaattg ctggagtgtg atcttgggga gagcaagtgc 1200

cattccccta gcgcaatcat gaatatgttc cagaactctt tgttctgctt gcagccccaa 1260

ggtgattcgt atacgagaag atctgccttc gactcgatgc tggctggttg cattcctgtt 1320

ttctttcatc ctggttcagc gtatgtccaa tatacgtggc atcttccgaa gaactataca 1380

cggtactctg tcttcatccc tgaagatggc gtccgtaagg gaaatgtcag cattgaggac 1440

aggcttaaaa gtatccatcc agatatggtc aagaagatga gggaagaggt cattagtctc 1500

atcccaaggg tgatatatgc tgatccaagg tcaaagctgg agaccctgaa ggatgcattc 1560

gatgtttctg tagaggcaat aattaacaag gtgacacagt tgagaagaga tatcatcgaa 1620

gatcatgaag ataaagattt tgttgaagag aatagctgga agtatgatct gttggaagaa 1680

gggcagagga caattgggcc tcatgaatgg gacccgttct tctctaagcc caaggacaag 1740

ggtggagatt ctactaatcc atctactaat gctgccaaga actcctggaa aaacgaacaa 1800

agaggtcaga actaa 1815

<210> 6

<211> 2581

<212> DNA

<213> 6 (Artificial sequence)

<400> 6

agtttcctcc tcattattcc tcctcttccc ccctcgccgc ttacaacatc catccccaaa 60

cccgcattca aaacaagcaa ccctcctccc gaatcgaaca aggaaacaga tatcgcctct 120

aaaaccccca tcgtctcgtc tcgtctcgtt cccctctcca tcttccgcgg ctttccgcgc 180

gatccaccga tccggtttcc ccgcgccgtg cccggagtcg gcgctccatt cccgcgccgg 240

gttttggggt ggtgtgttga tgcggcggga ttcgagccct ggcctgtgag ttgggcgtcg 300

gctcggcggc tgcggggtcg gcgcgggcgc ggacgcggcg gatgtctgct atgaggcggc 360

ggccggtgct gccgactcac caggacgaca tggagaaggt gggcgggaag ccgccgcagt 420

cgcgcctctg cttcctcgcc acgctctgcg ccatgttctg ggtcctcatc ttctacttcc 480

acttcttcgt catcgccaac gagcctggct ccgcgggggc ggacaccgcc gccggcgccg 540

cggcgagcat tgcccgcgca gaacttccgc tccccgaacc cgagcgcgtc tccgatcccg 600

cggttcccct ccctccgcct gccctcgtct cggagccgcc acctaccacc gctactgtcg 660

ccaaagtgga agatgaggag aagcccacgg ccgtcgccca ccaggaggcg gcgcccaggg 720

attacgcgtt ccagcgagcg ctcaagaccg cggagaacaa gagcgacccg tgcggcggcc 780

ggtacatcta cgtgcacgag ctgccgccgc ggttcaacga cgacatgctc cgggagtgcg 840

agaggctcag cctctggacc aatatgtgca agttcatgag caacgaaggg cttggtccgc 900

cgttgggcaa cgaggaaggg gtgttctcca acaccggctg gtacgcgacg aaccagttta 960

tggtggatgt catcttcagg aaccggatga agcagtacga gtgcctgacc aaggactcgt 1020

ccatcgctgc cgcggtgttt gtgccgttct acgccgggtt tgatgtggcg aggtatcttt 1080

gggggcacaa catttcgacg agggatgccg cgtcgctgga tttgatagat tggctgagga 1140

agaggcctga atggaatgtg atgggcgggc gtgaccattt cttagttggc ggcaggattg 1200

cgtgggattt caggcgcttg acggacgaag agtcggattg gggcaacaag ctgcttttca 1260

tgccggctgc gaagaatatg tcgatgttgg tggtggagtc aagcccatgg aatgccaatg 1320

attttgcgat accatatcct acttacttcc accctgccaa ggatgctgat gttttgcttt 1380

ggcaggatag aatgaggagc ctggaacgac catggttgtt ctcgtttgct ggggctcctc 1440

gtcctgatga tcccaagtct atcagaagtc agcttattga tcaatgcagg acatcaagtg 1500

tctgtaaatt gctggagtgt gatcttgggg agagcaagtg ccattcccct agcgcaatca 1560

tgaatatgtt ccagaactct ttgttctgct tgcagcccca aggtgattcg tatacgagaa 1620

gatctgcctt cgactcgatg ctggctggtt gcattcctgt tttctttcat cctggttcag 1680

cgtatgtcca atatacgtgg catcttccga agaactatac acggtactct gtcttcatcc 1740

ctgaagatgg cgtccgtaag ggaaatgtca gcattgagga caggcttaaa agtatccatc 1800

cagatatggt caagaagatg agggaagagg tcattagtct catcccaagg gtgatatatg 1860

ctgatccaag gtcaaagctg gagaccctga aggatgcatt cgatgtttct gtagaggcaa 1920

taattaacaa ggtgacacag ttgagaagag atatcatcga agatcatgaa gataaagatt 1980

ttgttgaaga gaatagctgg aagtatgatc tgttggaaga agggcagagg acaattgggc 2040

ctcatgaatg ggacccgttc ttctctaagc ccaaggacaa gggtggagat tctactaatc 2100

catctactaa tgctgccaag aactcctgga aaaacgaaca aagaggtcag aactaaaata 2160

caggtagtta gatatgtgat cgaggaaagg aactagatat cctctctaga gaagctcctt 2220

gcaaatacct tgcccatatg tcaaagatcc tccaacgcag tagctctgat gatcatgtat 2280

gttcttgatg atctagcccc tacaggtgta agtggtggta gaaaagatgc ttggggaaaa 2340

aaatgcacgg ccttcgagtt gcccttataa ataccatttc acactctatt tttgttttgc 2400

tttgctcaat aatcctttgt aagtccttac gggatttata ggtatatcaa ttttgctgtt 2460

gtttctgttt tgtttgcttt gatctgtatg tgtatggttt agaatttgtg tatactacct 2520

ttttatactc acaattagta agcaatcaaa gagatttttg tagatatgac ttttttcaag 2580

c 2581

<210> 7

<211> 30

<212> DNA

<213> 7 (Artificial sequence)

<400> 7

gttttagagc tagaaatagc aagttaaaat 30

<210> 8

<211> 30

<212> DNA

<213> 8 (Artificial sequence)

<400> 8

caaaatctcg atctttatcg ttcaatttta 30

<210> 9

<211> 19

<212> DNA

<213> 9 (Artificial sequence)

<400> 9

aacttataaa ccgcgcgct 19

<210> 10

<211> 20

<212> DNA

<213> 10 (Artificial sequence)

<400> 10

ttgaatattt gggcgcgcga 20

<210> 11

<211> 20

<212> DNA

<213> 11 (Artificial sequence)

<400> 11

gcaggataga atgaggagcc 20

<210> 12

<211> 21

<212> DNA

<213> 12 (Artificial sequence)

<400> 12

cggctcctca ttctatcctg c 21

<210> 13

<211> 20

<212> DNA

<213> 13 (Artificial sequence)

<400> 13

cccagtcacg acgttgtaaa 20

<210> 14

<211> 20

<212> DNA

<213> 14 (Artificial sequence)

<400> 14

ttgggatgag actaatgacc 20

<210> 15

<211> 20

<212> DNA

<213> 15 (Artificial sequence)

<400> 15

tgatagattg gctgaggaag 20

<210> 16

<211> 20

<212> DNA

<213> 16 (Artificial sequence)

<400> 16

ttgggatgag actaatgacc 20

Claims (5)

1. The application of the coding gene of the related protein for controlling the rice flowering advancing in the breeding of the rice variety advancing in the flowering phase is characterized in that the nucleotide sequence of the coding gene of the related protein for controlling the rice flowering advancing is shown as SEQ ID No. 2.

2. The application of the early flowering gene for controlling the advancing of rice flowering in the breeding of early rice varieties is characterized in that the nucleotide sequence of the early flowering gene for controlling the advancing of rice flowering is shown as any one of SEQ ID No.3, SEQ ID No.4 and SEQ ID No. 5.

3. The application of sgRNAs in early-flowering rice variety breeding is characterized in that nucleotide sequences of the sgRNAs are shown as SEQ ID No.7 and SEQ ID No.8, the sgRNAs are used for knocking out coding genes of related proteins for controlling rice flowering early, and the nucleotide sequences of the coding genes of the related proteins for controlling rice flowering early are shown as SEQ ID No. 2.

4. The application of the knockout carrier in breeding early-maturing rice varieties is characterized in that the nucleotide sequence of a promoter of the knockout carrier OsU6 is shown as SEQ ID No.9 and SEQ ID No.10, the knockout carrier is used for knocking out coding genes of related proteins for controlling the early maturing of rice flowers, and the nucleotide sequence of the coding genes of the related proteins for controlling the early maturing of rice flowers is shown as SEQ ID No. 2.

5. The application of a target sequence in breeding early-flowering rice varieties is characterized in that the nucleotide sequence of the target sequence is shown as SEQ ID No.11 and SEQ ID No.12, the target sequence is used for knocking out a coding gene of related protein for controlling the early flowering of rice, and the nucleotide sequence of the coding gene of the related protein for controlling the early flowering of rice is shown as SEQ ID No. 2.

Images