CN109134660A

CN109134660A - Target the Chimeric antigen receptor of Mesothelin and the method and application thereof of the anti-PD1 antibody of Combined expression

Info

Publication number: CN109134660A
Application number: CN201710459212.XA
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2017-06-16
Filing date: 2017-06-16
Publication date: 2019-01-04
Anticipated expiration: 2037-06-16
Also published as: CN109134660B

Abstract

The present invention relates to the Chimeric antigen receptors and application thereof of targeting Mesothelin-aPD1.Specifically, the present invention provides a kind of polynucleotide sequence, is selected from: (1) containing the coded sequence of the coded sequence of sequentially connected anti-Meso single-chain antibody, the coded sequence of people's CD8 α hinge area, the coded sequence of people's CD8 transmembrane region, people 41BB intracellular region and anti-human PD1 single-chain antibody；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides the purposes of relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier.Mesothelin-aPD1 CAR-T cell prepared by the present invention has strong killing ability to specific tumor cell, and CAR-T cell prepared by the present invention, which can also secrete anti-PD1 antibody, to be had the function of adjusting immunosupress microenvironment.

Description

Target the Chimeric antigen receptor of Mesothelin and the side of the anti-PD1 antibody of Combined expression Method and application thereof

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to targeting Mesothelin (SS1)-CD28-BBz-aPD1 Chimeric antigen receptor and application thereof.

Background technique

Cancer of pancreas (Pancreatic Carcinoma) is clinically common alimentary system malignant tumour, is more common in 50 years old Above crowd.Its disease incidence has apparent regional disparity, and disease incidence has been in American-European countries in trend is gradually increasing in recent years 4th common malignant tumour occupies the 2nd of the alimentary tract cancer cause of the death, is only second to colorectal cancer, incidence of occult, early symptom Without specificity, Resection Rate is low.In the process of tumor development, very polygenic activation and its expression of product are played Important role, in it is not completely clear in exact molecular mechanism, with modern image and the hair at full speed of endoscopic technic Exhibition clarifies a diagnosis oneself without too big difficulty, but at this time mostly to some symptom and signs and the more apparent cancer of pancreas of Findings Oneself loses best opportunity of operation, and more difficult for the diagnosis of some early stage patients.Therefore seek new treatment means, for cancer of pancreas Treatment be the task of top priority.

In terms of the research of the metastasis and invasion of tumour, mesothelin (Mesothelin) is also the hot spot of current research. Chang in 1996 etc. clones the antigen of monoclonal antibody identification using Cervical Cancer HeLa Cells, and research finds that the antigen exists In normal rnesothelial cells, therefore it is named as Mesothelin.The main reason for tumor patient survival rates low poor prognosis with it Infiltration metastasis is related, and the infiltration metastasis Mechanism Study of tumour is current hot and difficult issue.Mesothelin gene encodes one kind The precursor protein of 69kDa, the processed embrane-associated protein (i.e. Mesothelin) for forming a 40kDa and a 3lkDa are referred to as For the segment that falls off of megakaryocyte-potentiating factor MPF.Mesothelin height is expressed in kinds of tumors tissue, in serum of ovarian cancer patients Mesothelin mRNA and the expression of protein level height, tissue section strain, which shows to have in Nonviscous protein oophoroma, 66% is in Mesothelin is positive；It being found in the detection of mesothelioma of pleura, 15 cases for being diagnosed as epithelial mesothelioma are all positive, and 4 The sarcomatous celiothelioma of example is all negative；The researchs such as Argani are reported, in the primary pancreatic carcinoma of excision, Immunohistochemical Method detects table Bright 60 have 54 strong positives, and surrounding normal pancreatic tissue is then without Mesothelin reactivity；In other entity tumors point In analysis, official's neck, head, neck, vagina, lung and oesophagus squamous carcinoma frozen section in can find mesothelin immunocompetence, adenocarcinoma of lung, son Endometrial carcinoma, borderline synovial sarcoma and desmoplastic small round cell tumor have a small amount of mesothelin to express, in breast cancer, Thyroid cancer, clear-cell carcinoma, bladder are moved only a little in cell cancer, black cancer and liver cancer or are expressed without Mesothelin.

The biological function of Mesothelin is not yet clear.It is small that Pastan etc. constructs a kind of Mesothelin gene mutation The wild-type mice growth of mouse, these mutant mouses and compatriot and breed identical, and the platelet count of the two does not have Statistical difference；There is researches show that Mesothelin to be combined energy mediate cell adhesion with CA 125, thus researchers also think CA 125 and Mesothelin may play an important role in the transfer diffusion of oophoroma；In addition, there is research also to show Adjusting of the expression of Mesothelin gene by the signal of interest approach such as Wnt, such as in oophoroma and cancer of pancreas, Wnt signal Transduction pathway sustained activation promotes Mesothelin expression to increase.Although.The function and its carcinogenesis of Mesothelin still has To in further clarifying, but the feature that its distribution in the normal tissue is limited and in the expression of certain tumor tissues height, thus Mesothelin can be used as the targeting of tumor specific antibody treatment.

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to repairs through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting way.It is 2012 international thin Born of the same parents, which treat association's annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns T Cell HLA non-dependent mode identifies the ability of tumour antigen, this makes the T cell being transformed by CAR compared to nave T cell Surface receptor TCR can identify wider target.It include a tumor associated antigen (tumor- in the basic engineering of CAR Associated antigen, TAA) combined area (the scFV section for being typically derived from monoclonal antibody antigen bond area), one Extracellular hinge area, a transmembrane region and an intracellular signal area.The selection of target antigen for the specificity of CAR, validity with It and is all crucial determinant for the safety of genetic modification T cell itself.

Have 10 in the anti-Mesothelin CAR-T cell therapy clinical test of ClinicalTrials.gov registration at present , mainly for malignant tumours such as cancer of pancreas, oophoroma, pleuroma, lung cancer and breast cancer.Carry out in the University of Pennsylvania I phase clinical research in, patient is that the state of an illness further developed after receiving first-line treatment, and expression of tumor tissue Mesothelin, they receive the T cell treatment for turning CAR mRNA wink.In two generations CAR of this Mesothelin specificity, have There is CD3 ξ and 4-1BB costimulating factor structural domain.The CAR T survival period of these Mesothelin specificity is short, in two patients In show antitumor action, it is seen that the antigen that Mesothelin can be identified as CAR T cell, and wink turns mRNA's Mode is also feasible.The I phase clinical research that another University of Pennsylvania carries out uses slow-virus transfection Mesothelin specific C AR.This research for starting from July, 2014 is the malignant pancreatic cancer, epithelial for resistance to chemotherapy Oophoroma and Malignant Epithelium mesothelioma of pleura.In the early stage result of study of 6 patients, 4 patients are transfused 28 in CAR T cell Stable disease after it.CAR T cell infusion does not cause acute side reaction, and turns compared to mRNA wink, slow-virus transfection building The duration of CAR T cell get a promotion.

PD1 (programmed death 1) is initially obtained in the T cell hybridoma of apoptosis, due to itself and cell Apoptosis is related and is named as 1 receptor of programmed death.PD1 expression of receptor is in T cell surface and Primary B cells surface, at this It plays a role in the differentiation of a little cells and apoptosis.PD1 is PD-L1 (B7-H1) and PD-L2 (B7-DC) respectively there are two ligand, Belong to B7 family protein (Blood.2009.114 (8): p.1537-44.).PD-L1 albumen wide expression in antigen presenting cell, Activate T, B cell, macrophage, placental trophoblast, myocardium endothelium and thymic cortical epithelial cells.In PD-L1 and T cell by Body PD1 interaction, plays an important role in terms of the negativity regulation of immune response.Under normal circumstances, body encounters external When pathogen or antigen are invaded, antigen presenting cell captures antigen, carries out processing to antigen and makes what T cell can identify Epitope in conjunction with MHC molecule and is presented with cell outside for T cell identification.T cell passes through TCR and antigen presenting cell MHC molecule combine, in addition the B7-1 (CD80) or B7-2 (CD86) on costimulatory signal CD28 receptor and T cells surface are tied It closes, T cell is connected to positive regulation signal, and T cells activation is effector T cell, starts immune response.When there is lasting antigen to pierce When swashing, to avoid response excessive, activating T cell surface expression PD1 is thin to T in conjunction with the PD-L1 on antigen presenting cell surface Born of the same parents transmit negative regulation signal, and T cell proliferation reduces or apoptosis.The study found that detectable in many mankind tumor tissues To the expression of PD-L1 albumen, the microenvironment of tumor locus can induce the expression of PD-L1 on tumour cell, the PD-L1 and T of expression The PD1 of cell surface, which is combined, inhibits T cell anti-tumor activity, so that tumour cell be made to escape the monitoring of body immune system and clear It removes, is conducive to the generation and growth of tumour.

PD1/PD-L1 pathway inhibitor can block the combination of PD1 and PD-L1, block negative regulation signal, make T cell Activity recovery, to enhance immune response.PD1/PDL1 pathway inhibitor mainly includes anti-PD1 or anti-PD-L1 monoclonal antibody. In July, 2014, the Opdivo of Shi Guibao take the lead in granted for treating advanced melanoma in Japan, become in the first approval in the whole world The PD1 inhibitor in city.This is that PD1 inhibitor shows life cycle curative effect, and chemotherapeutic Dacca in III phase clinical trial for the first time Bar piperazine is compared to 1 year survival rate 73% to 42%, and response rate 40% is to 14%, and adverse reaction decreases.And Merck Keytruda (pembrolizumab) in September, 2014 is with a unconventional large-scale I phase clinical trial for having 1000 patients to participate in As a result with first PD-1 inhibitor identity successful log American market, being approved for treatment can not perform the operation excision or to have gone out It now shifts and to the unresponsive advanced melanoma patient of other drugs (N Engl J Med.2013Jul 11；369(2): 134-44.)。

Although compound combine foreground is wide, current antineoplastic treatment window is generally relatively narrow, the effect of drug combination Still it is difficult to predict seriously constrain the performance of PD1 effect.The fast development of CAR-T cell then provides new opportunity thus. CAR-T it is cell targeted it is strong, specificity is high, after being stimulated by tumour antigen can rapid, high volume proliferation, thus may be pressed down The limitation of property signal processed, so that its anti-tumor capacity be made to have a greatly reduced quality.If energy blocking t cell surface Inhibitory receptor PD1, can So that CAR-T cell is freed one's minds, gives full play to Tumor cytotoxicity.Based on this, by CAR-T cell and PD1/PD-L1 letter is blocked The strategy of number use in conjunction has obtained rapidly the concern (Oncoimmunology.2014Dec 21 of researchers；3(11): e970027.)。

University of Pennsylvania Edmund Moon professor and the team that he is led carry out for this use in conjunction strategy A series of researchs.In the TCR-T cell killing tumour cell experiment that NY-ESO-1 is Antigenic Target, anti-PD1 antibody is added, The phenomenon that T cell hypofunction can be significantly improved；Correspondingly, in mouse subcutaneous transplanting tumor model, the tumour of TCR-T cell is clear Removing solid capacity is limited, and after giving the processing of PD1 antibody at the same time, then it can achieve the purpose that completely eliminate tumour (Clin Cancer Res.2016.22(2):p.436-47.).Meanwhile the team devises CAR-T cell of new generation using technique for gene engineering, i.e., Be inserted into a transgene receptor PD1CD28 in CAR-T cell by viral vectors, this structure by PD1 extracellular fragment and total thorn The cross-film section and intracellular section of composition for swashing molecule CD28, can be after PD1 and tumor cell surface ligand PD-L1 be combined, by PD1/PD- L1 inhibits signal to be changed into activation signals, so that the function for CAR-T cell increases power.This effect is in preclinical animal model Also good authentication has been obtained in research, is loaded into the CAR-T cell of PD1CD28 compared to the T cell for being not inserted into PD1CD28, energy Stronger immune response is generated to mouse tumor model, increases the survival rate of mouse.

The above Preliminary Study shows CAR-T cell and blocks PD1/PD-L1 combined signal application strategy in oncotherapy In feasibility, it would be desirable to herein on basis, make full use of the genetic modification technology of mature now, realize the two Between best combination.Our patents are using the heavy chain of the scFV of Mesothelin antibody and light chain as the structure of CAR, for from now on Clinical trial established good research and development basis.

Summary of the invention

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from:

(1) code sequence of the coded sequence containing sequentially connected anti-Mesothelin single-chain antibody, people's CD8 α hinge area Column, the coded sequence of people's CD8 transmembrane region, the coded sequence of people's CD28 intracellular region, the coded sequence of people's 41BB intracellular region, people CD3 ζ The polynucleotide sequence of the coded sequence of intracellular region and anti-human PD1 single-chain antibody coded sequence；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, volume of the polynucleotide sequence in the anti-Mesothelin single-chain antibody Also containing the coded sequence of signal peptide before code sequence.In one or more embodiments, the amino acid sequence of the signal peptide As shown in SEQ ID NO:1 1-22 amino acids.In one or more embodiments, the anti-Mesothelin is single-stranded anti- The amino acid sequence of the light chain variable region of body is as shown in SEQ ID NO:1 23-128 amino acids.Implement in one or more In scheme, the amino acid sequence of the heavy chain variable region of the anti-Mesothelin single-chain antibody such as SEQ ID NO:1 141-259 Shown in amino acids.In one or more embodiments, the amino acid sequence such as SEQ ID NO:1 of the people CD8 α hinge area Shown in 260-306 amino acids.In one or more embodiments, the amino acid sequence such as SEQ of the people CD8 transmembrane region Shown in ID NO:1 307-328 amino acids.In one or more embodiments, the amino acid of the people CD28 intracellular region Sequence is as shown in SEQ ID NO:1 329-369 amino acids.In one or more embodiments, the people 41BB is intracellular The amino acid sequence in area is as shown in SEQ ID NO:1 370-417 amino acids.It is described in one or more embodiments The amino acid sequence of people's CD3 ζ intracellular region is as shown in SEQ ID NO:1 381-491 amino acids.In one or more embodiment party In case, the amino acid sequence of the people P2A is as shown in SEQ ID NO:1 529-554 amino acids.Implement in one or more In scheme, the amino acid sequence of human IL-2's signal peptide is as shown in SEQ ID NO:1 555-574 amino acids.At one Or in multiple embodiments, the amino acid sequence of the heavy chain variable region of the anti-PD1 single-chain antibody such as SEQ ID NO:1 575- Shown in 687 amino acids.In one or more embodiments, the amino acid of the light chain variable region of the anti-PD1 single-chain antibody Sequence is as shown in SEQ ID NO:1 703-809 amino acids.

The letter in one or more embodiments, before the coded sequence of the anti-Mesothelin single-chain antibody The coded sequence of number peptide is as shown in SEQ ID 1-66 nucleotide sequences of NO:2.It is described in one or more embodiments The coded sequence of the light chain variable region of anti-Mesothelin single-chain antibody such as 67-384 nucleotide sequence institutes of SEQ ID NO:2 Show.In one or more embodiments, the coded sequence such as SEQ of the heavy chain variable region of the anti-Mesothelin single-chain antibody Shown in 421-777 nucleotide sequences of ID NO:2.In one or more embodiments, the volume of the people CD8 α hinge area Code sequence is as shown in SEQ ID 778-918 nucleotide sequences of NO:2.In one or more embodiments, the people CD8 The coded sequence of transmembrane region is as shown in SEQ ID 919-984 nucleotide sequences of NO:2.In one or more embodiments In, the coded sequence of the people CD28 intracellular region is as shown in SEQ ID 985-1107 nucleotide sequences of NO:2.At one or In multiple embodiments, the coded sequence of the people 41BB intracellular region such as 1108-1251 nucleotide sequences of SEQ ID NO:2 It is shown.In one or more embodiments, the coded sequence of the people CD3 ζ intracellular region such as SEQ ID NO:2 1252- Shown in 1584 nucleotide sequences.In one or more embodiments, the coded sequence of the people P2A such as SEQ ID NO:2 Shown in 1585-1662 nucleotide sequences.In one or more embodiments, the coded sequence of human IL-2's signal peptide As shown in SEQ ID 1663-1722 nucleotide sequences of NO:2.In one or more embodiments, the anti-PD1 is single-stranded The coded sequence of the heavy chain variable region of antibody is as shown in SEQ ID 1723-2061 nucleotide sequences of NO:2.At one or more In a embodiment, the coded sequence of the light chain variable region of the anti-PD1 single-chain antibody such as SEQ ID NO:2 2107-2427 Shown in the nucleotide sequence of position.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from:

(1) contain sequentially connected anti-Mesothelin single-chain antibody, people CD8 α hinge area, people CD8 transmembrane region, people CD28 Intracellular region, people 41BB intracellular region, people's CD3 ζ intracellular region and anti-human PD1 single-chain antibody fusion protein；With

(2) it lives in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein as derived from (1) of T cell；

Preferably, the anti-Mesothelin single-chain antibody is anti-Mesothelin monoclonal antibody SS1.

In one or more embodiments, volume of the polynucleotide sequence in the anti-Mesothelin single-chain antibody Also containing the coded sequence of signal peptide before code sequence.In one or more embodiments, the amino acid sequence of the signal peptide As shown in SEQ ID NO:1 1-22 amino acids.In one or more embodiments, the anti-Mesothelin is single-stranded anti- The amino acid sequence of the light chain variable region of body is as shown in SEQ ID NO:1 23-128 amino acids.Implement in one or more In scheme, the amino acid sequence of the heavy chain variable region of the anti-Mesothelin single-chain antibody such as SEQ ID NO:1 141-259 Shown in amino acids.In one or more embodiments, the amino acid sequence such as SEQ ID NO:1 of the people CD8 α hinge area Shown in 260-306 amino acids.In one or more embodiments, the amino acid sequence such as SEQ of the people CD8 transmembrane region Shown in ID NO:1 307-328 amino acids.In one or more embodiments, the amino acid of the people CD28 intracellular region Sequence is as shown in SEQ ID NO:1 329-369 amino acids.In one or more embodiments, the people 41BB is intracellular The amino acid sequence in area is as shown in SEQ ID NO:1 370-417 amino acids.It is described in one or more embodiments The amino acid sequence of people's CD3 ζ intracellular region is as shown in SEQ ID NO:1 381-491 amino acids.In one or more embodiment party In case, the amino acid sequence of the people P2A is as shown in SEQ ID NO:1 529-554 amino acids.Implement in one or more In scheme, the amino acid sequence of human IL-2's signal peptide intracellular region is as shown in SEQ ID NO:1 555-574 amino acids. In one or more embodiments, the amino acid sequence such as SEQ ID NO:1 of the heavy chain variable region of the anti-PD1 single-chain antibody Shown in 575-687 amino acids.In one or more embodiments, the light chain variable region of the anti-PD1 single-chain antibody Amino acid sequence is as shown in SEQ ID NO:1 703-809 amino acids.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute Stating nucleic acid constructs is retroviral vector, contains replication origin, 3 ' LTR, 5 ' LTR, polynucleotides as described herein Sequence, and optional selectable label.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of gene modification, and the cell contains polynucleotides as described herein Sequence, or contain nucleic acid constructs as described herein, or infected retrovirus as described herein, or stablize expression this paper institute The fusion protein stated.

Sixth aspect present invention provides a kind of pharmaceutical composition of T cell containing gene modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell of preparation activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Use of the T cell or its pharmaceutical composition of poison or gene modification in the drug of the preparation treatment Mesothelin disease mediated On the way.

In one or more embodiments, it is preferable that the disease that the Mesothelin is mediated is between oophoroma, pleura The squamous carcinoma of rind gall, cancer of pancreas and uterine neck, head, neck, vagina, lung and oesophagus, preferably malignant pleural mesothelioma, cancer of pancreas, ovum Nest cancer and lung cancer.

Detailed description of the invention

Fig. 1 is RV-Mesothelin-aPD1-CAR retrovirus expression vector schematic diagram.SP: signal peptide；VL: light chain Variable region；Lk: connector (G₄S)₃；VH: heavy chain variable region；H:CD8 α hinge area；TM:CD8 transmembrane region.

Fig. 2 is the part sequencing result peak value figure of RV-Mesothelin CAR-aPD1 retrovirus expression plasmid

The Mesothelin-aPD1 CAR-T table that Fig. 3 is FCM results show retroviral infection T cell 72 hours Up to efficiency

Fig. 4 293T-PD1 cell and Mesothelin-28BBz-aPD1 virus incubation 30min after stain anti-Human Fab result

Fig. 5 be prepare 5 days Mesothelin-tEGFR CAR-T/Mesothelin-aPD1 CAR-T cell and target it is thin Born of the same parents co-culture CD107a expression in 5 hours

Fig. 6 is that the Mesothelin-tEGFR CAR-T/Mesothelin-aPD1 CAR-T for preparing 5 days and target cell are total to The surface CAR-T PD1 is expressed after culture 24 hours

Fig. 7 be prepare 5 days Mesothelin-tEGFR CAR-T/Mesothelin-aPD1 CAR-T cell and target it is thin To the lethal effect of tumour cell after born of the same parents' co-cultivation 16 hours

Specific embodiment

The present invention provides a kind of Chimeric antigen receptor (CAR) for targeting Mesothelin.The CAR contains sequentially connected anti- Mesothelin single-chain antibody, people CD8 α hinge area, people CD8 transmembrane region, people CD28 intracellular region, people 41BB intracellular region, people CD3 ζ The segment of intracellular region and anti-human PD1 single-chain antibody.

Various anti-Meso (SS1) well known in the art can be derived from by being suitable for the invention anti-Mesothelin single-chain antibody Monoclonal antibody.

Various anti-mesothelin monoclonals well known in the art can be derived from by being suitable for the invention anti-mesothelin single-chain antibody Antibody.Preferably, these monoclonal antibody specificities identify the 296 to 390th amino acids section of mesothelin.

Therefore, in certain embodiments, it is suitable for the invention anti-mesothelin single-chain antibody and contains specific recognition people The light chain variable region and heavy chain variable region of the monoclonal antibody of 296 to 390th amino acids section of mesothelin.Optionally, institute Stating light chain variable region and heavy chain variable region can be linked together by joint sequence.This kind of single-chain antibody that can be illustrated includes but not It is limited to YP218Fv-PE38, YP223 and SS1.In certain embodiments, the monoclonal antibody is SS1.

Fusion protein of the invention is formed, such as the light chain variable region and heavy chain variable region, people CD8 of anti-mesothelin single-chain antibody α hinge area, people CD8 transmembrane region, people CD28 intracellular region, 41BB and people's CD3 ζ intracellular region etc., can be directly connected between each other, or It can be connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as containing G and S Joint sequence.In general, connector contains duplicate motif before and after one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, and amino acid is not inserted between repetition Residue.Joint sequence may include 1,2,3,4 or 5 repetition motif composition.It is residual that the length of connector can be 3~25 amino acid Base, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine linlcers Sequence.The quantity of glycine is not particularly limited in joint sequence, and usually 2~20, such as 2~15,2~10,2~8.It removes Glycine and serine come, and also contain other known amino acid residue in connector, for example, alanine (A), leucine (L), Threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to construct Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into outside host cell automatically or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the end N-, the end C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also be containing one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes CAR, SEQ ID NO:1 22- shown in SEQ ID NO:1 22-491 amino acids sequence CAR shown in 809 amino acids sequences, CAR or SEQ ID NO:1 shown in SEQ ID NO:1 1-491 amino acids sequence Shown in CAR mutant.These mutant include: with the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity simultaneously retains the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further include: amino acid sequence, SEQ ID NO:1 22- shown in SEQ ID NO:1 22-491 Amino acid sequence shown in 809, shown in amino acid sequence or SEQ ID NO:1 shown in SEQ ID NO:1 1-491 Still retain the biological activity of the CAR in amino acid sequence with one or several mutation (insertion, deletion or substitution), simultaneously Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferably Conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid similar in performance, usually will not Change the function of protein or polypeptide." amino acid similar in performance " includes for example, the amino acid with similar side chain The family of residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, have acid The amino acid (such as aspartic acid, glutamic acid) of property side chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), the amino acid (example with non-polar sidechain Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, with another amino acid residue replacement one from the same side chain class in polypeptide of the present invention A or several sites, will not be in substantially influences its activity.

The present invention includes the polynucleotide sequence for encoding fusion protein of the present invention.Polynucleotide sequence of the invention can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually be obtained with PCR amplification method.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, and with the commercially available library cDNA or press art technology The library cDNA prepared by conventional method known to personnel expands as template and obtains related sequence.When sequence is longer, usually need Twice or repeatedly PCR amplification is carried out, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, polynucleotide sequence such as 67-1107 cores of SEQ ID NO:2 of fusion protein described herein are encoded Shown in thuja acid, or as shown in SEQ ID 1-1107 nucleotide of NO:2.

It in addition to this, can be by the coded sequence of P2A polypeptide by people in the coded sequence of the signal peptide and CAR of the present invention The coded sequence of CD3 ζ intracellular region is connected.In one or more embodiments, the amino acid sequence of the P2A peptide such as SEQ ID Shown in NO:1 529-554 amino acids.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operate the expression to guarantee the fusion protein (CAR).It can be according to expression vector before nucleic acid constructs is inserted into carrier Difference is required and is operated to nucleic acid constructs.The technology for changing polynucleotide sequence using recombinant DNA method is this Known to field.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can be any nucleotide sequence that transcriptional activity is shown in selected host cell, including prominent Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence is also possible to suitable transcription terminator sequences, is identified by host cell to terminate the sequence of transcription Column.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence is also possible to suitable leader sequence, to host cell translation The non-translational region of important mRNA.5 ' ends of leader sequence and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.It is usually of the invention more by being operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier It can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting desired nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

Polynucleotide sequence of the invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but is not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier includes the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, which contains multiple Initiation site processed, 3 ' LTR, 5 ' LTR, pis packaging signal, restriction enzyme site, groundhog hepatitis virus posttranscriptional regulatory element, herein The polynucleotide sequence, and optional selectable label.The groundhog hepatitis virus posttranscriptional regulatory element can The stability of enhanced virus transcript.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Column are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Column.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, also it is contemplated that being started using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptide or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and for corotation Contaminate program.The flank of selectable label and both reporters can all have adjusting sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and for evaluating the functionality for adjusting sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include coding Luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene base Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

Gene is introduced into cell and is well known in the art the method that gene expression enters cell.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

It include calcium phosphate precipitation by the physical method that polynucleotides introduce host cell, lipofection, particle bombardment, micro- Injection, electroporation etc..It include being carried using DNA and RNA by the biological method that interested polynucleotides introduce host cell Body.It include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

It include using viral vectors, especially retrovirus vector by the biological method that polynucleotides introduce host cell Body, this has become the most widely used method by gene insertion mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and retroviral particle is packaged into using technology as known in the art.It should Recombinant virus then can be separated and be transferred to internal or external subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art.? In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

Being suitable for the invention T cell can be various types of T cells in various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulate activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture medium carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of gene modification, the T cell of the gene modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or infected as described herein Retrovirus, or be prepared using method described herein.

CAR-T cell of the invention can undergo firm internal T cell to extend and be held in blood and marrow with high level Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cell of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein and optionally by gene modification Anti-PD1 and CAR-T cell needed in its recipient by injection.The tumour that the cell of injection can kill recipient is thin Born of the same parents.Unlike antibody therapy, CAR-T cell can replicate in vivo, generate the long-term persistence that can lead to continued tumor control.

The anti-tumor immune response as caused by CAR-T cell can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part of adoptive immunotherapy step, and wherein the induction of CAR-T cell is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, it is thin that CAR of the invention, its coded sequence, nucleic acid constructs, expression vector, virus and CAR-T can be used The disease of born of the same parents' treatment is preferably the disease that mesothelin mediates.

Specifically, herein, " disease that mesothelin mediates " especially includes various types of oophoromas, mesothelioma of pleura The squamous carcinoma of (such as epithelial mesothelioma), cancer of pancreas and uterine neck, head, neck, vagina, lung and oesophagus.In certain embodiments, The disease that the mesothelin mediates is malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.

The T cell of CAR- modification of the invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cell as described herein, in conjunction with one or more pharmacy or physiologically acceptable carriers, diluent or excipient. Such composition may include buffer such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that pharmaceutical composition of the invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out: the pharmaceutical composition including T cell described herein It can be with 10⁴To 10⁹A cell/kg weight dosage, preferably 10⁵To 10⁶A cell/kg weight dosage.T cell composition It can also be with these dosage multiple applications.Cell can be by using injection technique well known in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) application.Optimal dose and treatment for specific patient Scheme can be by monitoring the disease indication of patient and therefore adjustment for the treatment of is readily determined by medical domain technical staff.

The application of object composition object can carry out in any convenient manner, including pass through spray-on process, inject, swallow, is defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein Patient is administered in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention preferably passes through intravenous injection application.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cell of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but is not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art Treatment mesothelin mediate disease radiotherapy or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the increase of life expectancy or the improvement expression of various physiological signs relevant to cancer for reducing, shifting number.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but is not limited to people, dog, cat, mouse, rat and its genetically modified organism.

Gene order of the present invention using Anti-mesothelin antibodies (being specifically derived from the scFV of SS1), full genome of the present invention The genetic fragment for synthesizing Chimeric antigen receptor Mesothelin scFv-CD8H&TM-CD28-41BB-CD3 ζ-PD1, is inserted into inverse Transcription vector MSCV, empty carrier MSCV can be used for recombinating introducing purpose nucleic acid sequence, that is, encode the nucleic acid sequence of CAR Column.Recombinant plasmid packaging virus in 293T cell infects T cell, T cell is made to express the Chimeric antigen receptor.In the present invention An embodiment in, realize that the method for transformation of the T lymphocyte of Chimeric antigen receptor gene modification is based on reverse transcription disease Malicious method for transformation.This method has high conversion efficiency, and foreign gene can stablize expression, and can shorten in vitro culture T lymph Cell reaches the advantages that time of clinical number of stages.On the transgenosis T lymphocyte surface, the nucleic acid of conversion is by transcribing, turning over Translate expression on it.The retrovirus of present invention expression CAR obtained prepares CAR-T cell by Retronectin method, The efficiency of infection of CAR-T cell flow cytometer detection CAR after preparation 3 days detects the expression of supernatant PD1 antibody, after preparation 5 days CAR-T cell co-cultures 5 hours with the tumour cell of the Mesothelin positive (SKOV3 and SKOV3-Mesothelin) in vitro CD107a and PD1 expression is detected, the CAR-T cell tumour cell (SKOV3 with the Mesothelin positive in vitro after preparation 5 days And SKOV3-Mesothelin) co-culture 16 hours specific killing action (cell toxicants for detecting CAR-T cells against tumor cells Property).Therefore Mesothelin CAR-aPD1 of the present invention can be answered in the treatment such as celiothelioma, cancer of pancreas, oophoroma With.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, being the method and reagent of this field routine.

NT cell used in embodiment is the T cell of the untransfected in source same as Example 4, is used as control cell. K562 cell and ATCC cell bank is derived from, for the cell of negative expression Mesothelin, is used as control cell.SKOV3 cell With from ATCC cell bank, it is the cell of positive expression Mesothelin, is used as control cell.SKOV3-Mesothelin is thin Born of the same parents (referred to as, SKOV3-Meso) are the SKOV3 stable cell lines for making its height expression Mesothelin through genetic engineering means.

The determination of embodiment 1:Mesothelin CAR-aPD1 gene order

Anti- Mesothelin heavy chain of antibody and light-chain variable region gene sequence information are searched from NCBI site databases (SS1), sequence carries out codon optimization on the http://sg.idtdna.com/site of website, guarantees in coding amino acid sequence Arrange it is constant in the case where be more suitable for human cell expression.

Each amino acid and gene sequence information are shown in SEQENCE LISTING (SEQUNCE ID NO.1-2)

Above-mentioned sequence is successively attached, different restriction enzyme sites is introduced in each sequence junction, is formed complete MesothelinCAR-aPD1 gene sequence information.

Embodiment 2: the building of the viral vectors of the nucleic acid sequence comprising CAR molecule

By the nucleotide sequence of the CAR molecule prepared in embodiment 1 through NotI (NEB) and EcoRI (NEB) double digestion, warp The site NotI-EcoRI of T4 ligase (NEB) connection insertion retrovirus RV (MSCV) carrier, is transformed into competence Recombinant plasmid is served Hai Sheng work Bioisystech Co., Ltd and is sequenced by E.coli (DH5 α), by sequencing result be fitted to Meso CAR-aPD1 sequence alignment it is whether correct to verify sequence.Sequencing primer are as follows:

Sense sequences: AGCATCGTTCTGTGTTGTCTC (SEQUNCE ID NO.3)

Antisense sequences: TGTTTGTCTTGTGGCAATACAC (SEQUNCE ID NO.4)

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen company, plasmid purification Plasmid calcium phosphate method transfects 293T cell and carries out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 3: retrovirus packaging

1. 293T cell should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed board, 10cm Ware adds the DMEM culture medium of 10ml, mixes well cell, 37 degree of overnight incubations；

2. the 2nd day 293T cell fusion degree, which reaches 90% or so, is transfected (usually bed board 14-18h or so)；Prepare Plasmid composite, it is 12.5ug, Gag-pol 10ug, VSVg 6.25ug that the amount of various plasmids, which is Retro backbone, CaCl₂250ul, H₂O is that 1ml total volume is 1.25ml；The HBS, Bian Jia isometric with plasmid composite are added in another pipe Plasmid composite side, which is vortexed, shakes 20s.Softly mixture is added in 293T ware along side, 37 degree of culture 4h, removal training Base is supported, PBS is washed one time, rejoins the fresh culture of preheating.

3. the 4th day: collecting supernatant after transfection 48h and be stored in -80 degree with packing after the filtering of 0.45um filter, continue to add The fresh DMEM medium of preheating.

Embodiment 4: the T cell of retroviral infection people

1. purer CD3+T cell is obtained with Ficcol separating liquid (ocean Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the hole 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml CD28 antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), restrovirus infection in 48 hours is cultivated in stimulation；

After 2.T cell activation culture every other day, PBS is diluted to Retronectin (Takara) packet of final concentration of 15 μ g/ml By non-tissue treated culture plate, the every 250 μ l of hole of 24 orifice plates.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activation two days later, takes out 2 pieces of 24 orifice plates being coated with, and inhales and abandons coating buffer, is added containing 2%BSA's HBSS room temperature closes 30min.Confining liquid volume is every 500 μ l of hole, inhales and abandons confining liquid, with the HBSS board-washing two containing 2.5%HEPES It is secondary.

4. in virus liquid adding hole, every hole adds 2ml virus liquid, 32 DEG C, 2000g, it is centrifuged 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added in the every hole of 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml is added in born of the same parents' culture medium.30 DEG C, 1000g, it is centrifuged 10min.

6. culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubator after centrifugation.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, it is centrifuged 7min.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, expands cell.

Embodiment 5: the ratio of T lymphocyte and the expression of surface C AR albumen after flow cytomery infection

72 hours after infecting CAR-T cells and NT cell (control group) are collected by centrifugation respectively, PBS is abandoned after washing 1 time Clearly, PBS after corresponding antibody is protected from light 30min is added to wash, is resuspended, last flow cytomery.CAR+ is by Anti-mouse IgG F (ab') antibody (Jackson Immunoresearch) and APC-Anti EGFR antibody test.

The present embodiment result shows in Fig. 3, the retroviral infection T cell being prepared using embodiment 3 72 hours Afterwards, the expression efficiency of the expression efficiency of Mesothelin-aPD1 CAR+ up to 58.31%, Mesothelin-tEGFR CAR+ reach 65.61%.

Embodiment 6: the expression of PD1 antibody is secreted in flow cytometer detection virus

Mesothelin-tEGFR/MesothelinCAR-aPD1 virus respectively with 293T-PD1 (our company preparation mistake Express the cell of PD1) it is incubated for 30min, then machine testing is gone up after dyeing 30min with anti-human Fab.

The present embodiment result such as Fig. 4 shows that streaming result detects that the anti-PD1 expression rate that can be secreted is 96.3%.

CD107a detection of expression after embodiment 7:CAR-T cell and target cell co-culture

1. taking one piece of 96 orifice plate of the bottom V, every hole adds CAR-T/NT cell 2*10⁵A and target cell (SKOV3 and SKOV3- Meso)/control cell (K562) 2*10⁵It is a, the X-VIVO complete medium for being free of IL-2 for 100ul is resuspended, BD is added GolgiStop (contains monesin, 1 μ l BD GolgiStop is added in every 1ml culture medium), and 2ul CD107a antibody is added in every hole (1:50), 37 DEG C are incubated for 5 hours, collect cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C are centrifuged 5 minutes.Supernatant is abandoned, every pipe adds Enter appropriate specific surfaces antibody CAR, CD3, CD4, CD8, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS per effective 3mL is cleaned cell 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CAR, CD3, CD4, CD8, CD107a.

The present embodiment is as the result is shown in Fig. 5.Fig. 5 shows, Mesothelin-tEGFR CAR-T cell and For Mesothelin-aPD1 CAR-T cell after co-culturing with target cell, Mesothelin-tEGFR CAR-T and two kinds of targets are thin Born of the same parents co-culture CD107a and reach 60% or so, and Mesothelin-aPD1 CAR-T cell CD107a expression then reaches 70% or so.

Embodiment 8:CAR-T cell and target cell co-culture rear surface PD1 detection of expression

1. taking one piece of 96 orifice plate of the bottom V, every hole adds CAR-T/NT cell 2*10⁵A and target cell (SKOV3 and SKOV3- Meso), setting plus K562 groups of cells are negative control, and the X-VIVO complete medium for 100ul containing IL-2,37 DEG C of incubations are resuspended 24 hours and 48 hours, collect cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C are centrifuged 5 minutes.Supernatant is abandoned, every pipe adds Enter appropriate specific surfaces antibody CD3, CAR, PD1, resuspension volume 100ul is protected from light incubation 30 minutes on ice.

4. appropriate PBS is resuspended, flow cytomery CD3, PD1, PD1 expression in CD3+ cell mass is analyzed.

The present embodiment is as the result is shown in Fig. 6.Fig. 6 shows that CAR-T and target cell co-culture rear surface PD1 and have obviously It improves.

Embodiment 9:CAR-T cell and target cell detect tumor specific cell lethal effect after co-culturing

1.K562 cell (negative control cell) is resuspended in serum free medium (1640), adjustment cell concentration be 1 × 10⁶/ ml, addition fluorescent dye BMQC (2,3,6,7-tetrahydro-9-bromomethyl-1H, 5Hquinolizino (9, 1-gh) coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm is centrifuged 5min, abandons supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. fresh cells toxicity culture medium cleans twice of cell, and is resuspended in fresh cells toxicity culture medium, and density 1 × 10⁶/ml。

5. target cell (SKOV3 and SKOV3-Meso) is suspended in the PBS containing 0.1%BSA, adjustment concentration is 1 × 10⁶/ml。

6. fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added to end Concentration is 1 μM.

7. mixing, 37 DEG C of incubation 10min.

8. after being incubated for, being added and being reacted with the isometric FBS of cell suspension, incubation at room temperature 2min with end mark.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning effector T cell is simultaneously suspended in cytotoxicity culture medium, adjustment concentration is 5 × 10⁶/ml。

11. in all experiments, the cytotoxicity of CAR-T cell and the negative control effector T cell (NT) being uninfected by Cytotoxicity compare.

12.CAR-T and NT, according to effector cell: target cell=5:1,1:1, ratio, in 5ml sterility test pipe (BD Biosciences it) is cultivated, every group of two multiple holes of setting.In each co-cultivation group, target cell 50,000 (50 μ l), yin Property control cell be 50,000 (50 μ l).One group of setting only includes target cell and negative control cell simultaneously.

13. co-cultured cell is placed in 37 DEG C of incubation 16h.

14. after the completion of being incubated for, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated for 30min on ice.

15. being not required to clean, directly machine testing in progress streaming, data are analyzed with Flow Jo.

16. analysis uses the living cells gating of 7AAD feminine gender, it is thin to measure the U266 target lived after T cell and target cell co-cultivation The ratio of born of the same parents and K562 negative control cell living.

17. T cell and target cell for each group of co-cultivation

The % 18. target cell of cytotoxic killer cell %=100- calibration survives, i.e., (target cell is living when no effector cell Cell number-the target cell of when containing effector cell viable count)/control cell viable count ratio.

The present embodiment is as the result is shown in Fig. 7.Fig. 6 is shown, when effect target ratio is E:T=5:1, Meso-aPD1 CAR-T couple Two kinds of target cell killings are all 20% or so.

Sequence table

<110>Shanghai Heng Run Da Sheng Biotechnology Co., Ltd

<120>Chimeric antigen receptor of Mesothelin and the method and application thereof of the anti-PD1 antibody of Combined expression are targeted

<170> PatentIn version 3.3

<210> 1

<211> 809

<212> PRT

<213>artificial sequence

<400> 1

Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser

1 5 10 15

Val Ile Met Ser Arg Gly Asp Ile Glu Leu Thr Gln Ser Pro Ala Ile

20 25 30

Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser

35 40 45

Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Ser Gly Thr Ser

50 55 60

Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro

65 70 75 80

Gly Arg Phe Ser Gly Ser Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile

85 90 95

Ser Ser Val Glu Ala Glu Asp Asp Ala Thr Tyr Tyr Cys Gln Gln Trp

100 105 110

Ser Lys His Pro Leu Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys

115 120 125

Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Gln Val Gln Leu

130 135 140

Gln Gln Ser Gly Pro Glu Leu Glu Lys Pro Gly Ala Ser Val Lys Ile

145 150 155 160

Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp

165 170 175

Val Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile Gly Leu Ile Thr

180 185 190

Pro Tyr Asn Gly Ala Ser Ser Tyr Asn Gln Lys Phe Arg Gly Lys Ala

195 200 205

Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Asp Leu Leu

210 215 220

Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg Gly Gly

225 230 235 240

Tyr Asp Gly Arg Gly Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr

245 250 255

Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro

260 265 270

Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro

275 280 285

Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp

290 295 300

Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu

305 310 315 320

Ser Leu Val Ile Thr Leu Tyr Cys Arg Ser Lys Arg Ser Arg Leu Leu

325 330 335

His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg

340 345 350

Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg

355 360 365

Ser Lys Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile

370 375 380

Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp

385 390 395 400

Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu

405 410 415

Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly

420 425 430

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

435 440 445

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

450 455 460

Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys

465 470 475 480

Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg

485 490 495

Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala

500 505 510

Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

515 520 525

Arg Ala Lys Arg Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln

530 535 540

Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Tyr Arg Met Gln Leu

545 550 555 560

Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu Val Thr Asn Ser Gln Val

565 570 575

Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg Ser Leu

580 585 590

Arg Leu Asp Cys Lys Ala Ser Gly Ile Thr Phe Ser Asn Ser Gly Met

595 600 605

His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Val

610 615 620

Ile Trp Tyr Asp Gly Ser Lys Arg Tyr Tyr Ala Asp Ser Val Lys Gly

625 630 635 640

Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe Leu Gln

645 650 655

Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Thr

660 665 670

Asn Asp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly

675 680 685

Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Ile

690 695 700

Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly Glu Arg

705 710 715 720

Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Ser Ser Tyr Leu Ala

725 730 735

Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu Ile Tyr Asp

740 745 750

Ala Ser Asn Arg Ala Thr Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly

755 760 765

Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Glu Pro Glu Asp

770 775 780

Phe Ala Val Tyr Tyr Cys Gln Gln Ser Ser Asn Trp Pro Arg Thr Phe

785 790 795 800

Gly Gln Gly Thr Lys Val Glu Ile Lys

805

<210> 2

<211> 2427

<212> DNA

<213>artificial sequence

<400> 2

atggacttcc aggtgcagat ttttagtttt cttttgatct ccgccagcgt gataatgtca 60

cgaggagata tagagctcac ccagagtccc gcaatcatgt cagcctctcc cggcgaaaaa 120

gtgaccatga cctgtagtgc ttccagttct gttagttata tgcactggta tcaacagaag 180

tccgggacaa gtcctaaacg ctggatttat gacacttcca aactggcttc tggagtgcct 240

gggcggttca gcgggagcgg ttccggtaac tcttacagcc tgaccatctc ttcagtcgaa 300

gctgaagacg atgccacgta ttattgccag caatggagta agcacccact gacatttggg 360

tgcgggacca agcttgaaat aaagggtggc ggcagcgggg gcggaagcgg cgggggaagc 420

caggtgcaac ttcagcaatc aggtcccgag ttggaaaagc cgggagccag cgttaagatc 480

tcatgcaaag ctagcggcta ctctttcaca ggatatacca tgaattgggt caagcaaagc 540

catggaaaat gtttggaatg gatcggactg attaccccct acaacggggc cagctcctac 600

aatcagaaat ttaggggtaa ggccactctc acagtggata aaagctcaag tactgcctat 660

atggacctgc ttagtctgac ctcagaggat agtgccgtgt acttttgtgc cagaggcggt 720

tacgacgggc gagggtttga ctactggggg caggggacga cggttactgt gtctagtacg 780

acaactcccg ctccccggcc tcccacccct gccccaacta ttgcctccca gcctctttcc 840

ttgcgccccg aagcctgcag gcccgcagct gggggcgctg tgcatacaag gggtctcgac 900

ttcgcatgcg acatctacat ttgggcaccc ttggccggga cctgtggagt gctcctcctc 960

agcctggtga tcacactgta ctgcaggtcc aaaagatcta ggctgctgca ttctgattac 1020

atgaacatga cgccgcgccg ccctggtcca accagaaagc attatcagcc ctatgcaccc 1080

cctagagact ttgccgccta tcgttcgaag ttcagtgtcg tgaagagagg ccggaagaag 1140

ctgctgtaca tcttcaagca gcctttcatg aggcccgtgc agactaccca ggaggaagat 1200

ggatgcagct gtagattccc tgaagaggag gaaggaggct gtgagctgag agtgaagttc 1260

tcccgaagcg cagatgcccc agcctatcag cagggacaga atcagctgta caacgagctg 1320

aacctgggaa gacgggagga atacgatgtg ctggacaaaa ggcggggcag agatcctgag 1380

atgggcggca aaccaagacg gaagaacccc caggaaggtc tgtataatga gctgcagaaa 1440

gacaagatgg ctgaggccta ctcagaaatc gggatgaagg gcgaaagaag gagaggaaaa 1500

ggccacgacg gactgtacca ggggctgagt acagcaacaa aagacaccta tgacgctctg 1560

cacatgcagg ctctgccacc aagaagagct aagcgcggct caggcgcgac caacttttct 1620

ctgcttaagc aggcaggcga cgtggaagag aaccccgggc ccatgtacag aatgcagctg 1680

ttgtcttgta ttgccctttc tctcgccctc gtaacaaatt cacaagtcca attggtggag 1740

tctggcggtg gggtagttca gcccggccga tccctgcgcc tggactgcaa agcttctgga 1800

attacgttct caaactccgg aatgcactgg gtgcggcaag cacctgggaa agggctggag 1860

tgggttgcgg tgatttggta cgatggctct aagaggtact acgcagacag cgttaaaggc 1920

agatttacta tatcccgaga taactctaaa aatacgctct tcctccaaat gaatagcctg 1980

agggcagaag acacagccgt ttactattgt gctaccaatg atgattactg gggacagggc 2040

accctggtta ccgtaagttc cggcggtggt ggaagtggag gagggggatc cggaggcggg 2100

ggttctgaga tcgtcctgac ccagtctcca gccactctct ccctgtctcc aggcgagcgc 2160

gctacactga gttgtagagc ttcccagtcc gtgagcagct atctggcctg gtatcagcag 2220

aagcctgggc aggctccacg gttgctgatt tatgacgcct ccaaccgcgc gactgggata 2280

ccagctaggt tttccggatc aggcagcggc actgatttta cactgaccat ctcatctctc 2340

gagccggaag atttcgccgt ttactattgt caacagagtt caaactggcc acggacattc 2400

ggtcagggga ccaaggttga aattaag 2427

<210> 3

<211> 21

<212> DNA

<213>artificial sequence

<223>primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>artificial sequence

<223>primer

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims

1. a kind of amino acid sequence, the amino acid sequence is selected from:

(1) coding of the encoding amino acid sequence containing sequentially connected anti-Mesothelin single-chain antibody, people's CD8 α hinge area Amino acid sequence, the encoding amino acid sequence of people's CD8 transmembrane region, the encoding amino acid sequence of people's CD28 intracellular region, people 41BB born of the same parents The coding amino acid of the encoding amino acid sequence of inner region, people CD3 ζ intracellular region encoding amino acid sequence and anti-human PD1 single-chain antibody Sequence；With

(2) (1) amino acid sequence.

2. amino acid sequence as described in claim 1, which is characterized in that

The amino acid sequence is before the coded sequence of the anti-Mesothelin single-chain antibody also containing the code sequence of signal peptide Column, it is preferable that the amino acid sequence of the signal peptide is as shown in SEQ ID NO:1 1-22 amino acids；And/or

The amino acid sequence of the light chain variable region of the anti-Mesothelin single-chain antibody such as 23-128 ammonia of SEQ ID NO:1 Shown in base acid；And/or

Amino acid sequence such as SEQ ID NO:1 141-259 of the heavy chain variable region of the anti-Mesothelin single-chain antibody Shown in amino acid；And/or

The amino acid sequence of the people CD8 α hinge area is as shown in SEQ ID NO:1 260-306 amino acids；And/or

The amino acid sequence of the people CD8 transmembrane region is as shown in SEQ ID NO:1 307-328 amino acids；And/or

The amino acid sequence of the people CD28 intracellular region is as shown in SEQ ID NO:1 329-369 amino acids；And/or

The amino acid sequence of the people 41BB intracellular region is as shown in SEQ ID NO:1 370-417 amino acids；And/or

The amino acid sequence of the people CD3 ζ intracellular region is as shown in SEQ ID NO:1 418-528 amino acids；And/or

The P2A amino acid sequence is as shown in SEQ ID NO:1 529-554 amino acids；And/or

Human IL-2's signal peptide amino acid sequence is as shown in SEQ ID NO:1 555-574 amino acids；And/or

The amino acid sequence of the heavy chain variable region of the anti-PD1 single-chain antibody such as SEQ ID NO:1 575-687 amino acids institute Show；And/or

The amino acid sequence of the light chain variable region of the anti-PD1 single-chain antibody such as SEQ ID NO:1 703-809 amino acids institute Show.

3. polynucleotide sequence as claimed in claim 2, which is characterized in that

The coded sequence such as SEQ ID NO:2 of the signal peptide before the coded sequence of the anti-Mesothelin single-chain antibody Shown in 1-66 nucleotide sequences；And/or

The coded sequence of the light chain variable region of the anti-Mesothelin single-chain antibody such as 67-384 nucleosides of SEQ ID NO:2 Shown in acid sequence；And/or

The coded sequence of the heavy chain variable region of the anti-Mesothel in single-chain antibody such as 421-777 cores of SEQ ID NO:2 Shown in nucleotide sequence；And/or

The coded sequence of the people CD8 α hinge area is as shown in SEQ ID 778-918 nucleotide sequences of NO:2；And/or

The coded sequence of the people CD8 transmembrane region is as shown in SEQ ID 919-984 nucleotide sequences of NO:2；And/or

The coded sequence of the people CD28 intracellular region is as shown in SEQ ID 985-1107 nucleotide sequences of NO:2；And/or

The coded sequence of the people 41BB intracellular region is as shown in SEQ ID 1108-1251 nucleotide sequences of NO:2；And/or

The coded sequence of the people CD3 ζ intracellular region is as shown in SEQ ID 1252-1584 nucleotide sequences of NO:2；And/or

The coded sequence of the people P2A is as shown in SEQ ID 1585-1662 nucleotide sequences of NO:2；And/or

The coded sequence of human IL-2's signal peptide is as shown in SEQ ID 1663-1722 nucleotide sequences of NO:2；And/or

The coded sequence of the heavy chain variable region of the anti-PD1 single-chain antibody such as 1723-2061 nucleotides sequences of SEQ ID NO:2 Shown in column；And/or

The coded sequence of the light chain variable region of the anti-PD1 single-chain antibody such as 2107-2427 nucleotides sequences of SEQ ID NO:2 Shown in column.

4. a kind of fusion protein, the fusion protein is selected from:

(1) intracellular containing sequentially connected anti-Mesothelin single-chain antibody, people CD8 α hinge area, people CD8 transmembrane region, people CD28 Area, people 41BB intracellular region, people's CD3 ζ intracellular region and anti-human PD1 single-chain antibody (2) are in the amino acid sequence that (1) limits by taking In generation, lacks or adds one or several amino acid and retains the active fusion protein as derived from (1) of activating T cell；

5. fusion protein as claimed in claim 4, which is characterized in that the fusion protein has following one or more special Sign:

The fusion protein also contains signal peptide in the N-terminal of the anti-Mesothelin single-chain antibody, it is preferable that the signal peptide Amino acid sequence as shown in SEQ ID NO:1 1-22 amino acids；And/or

6. a kind of nucleic acid constructs, the nucleic acid constructs contains polynucleotide sequence described in claim 3；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, and containing replication origin, 3 ' LTR, 5 ' LTR, and Polynucleotide sequence described in claim 3.

7. a kind of retrovirus, the retrovirus contains nucleic acid constructs as claimed in claim 6, preferably comprises described Carrier, the further preferably described retroviral vector.

8. the pharmaceutical composition of a kind of T cell of gene modification or the T cell containing the gene modification, which is characterized in that described thin Born of the same parents contain polynucleotide sequence described in claim 3, or contain nucleic acid constructs as claimed in claim 6, or infection Retrovirus as claimed in claim 7.

9. fusion protein described in any one of polynucleotide sequence described in claim 3, claim 4-5, right are wanted The application of nucleic acid constructs described in asking 6 or retrovirus as claimed in claim 7 in the T cell of preparation activation.

10. fusion protein described in any one of polynucleotide sequence described in claim 3, claim 4-5, right are wanted The T of nucleic acid constructs described in asking 6, retrovirus as claimed in claim 7 or gene modification according to any one of claims 8 is thin The purposes of born of the same parents or its pharmaceutical composition in the drug of the preparation treatment Mesothelin disease mediated；

Preferably, the disease that the Mesothelin is mediated be oophoroma, mesothelioma of pleura, cancer of pancreas and uterine neck, head, neck, The squamous carcinoma of vagina, lung and oesophagus, preferably malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.