CN109097385A - A kind of production beta carotene hydrogenlike silicon ion engineered strain and its construction method - Google Patents

A kind of production beta carotene hydrogenlike silicon ion engineered strain and its construction method Download PDF

Info

Publication number
CN109097385A
CN109097385A CN201810835248.8A CN201810835248A CN109097385A CN 109097385 A CN109097385 A CN 109097385A CN 201810835248 A CN201810835248 A CN 201810835248A CN 109097385 A CN109097385 A CN 109097385A
Authority
CN
China
Prior art keywords
gene
crti
zwf
opt
silicon ion
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201810835248.8A
Other languages
Chinese (zh)
Other versions
CN109097385B (en
Inventor
孟永宏
强珊
苏安平
陈芝
李颖
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shaanxi Healthful Biological Engineering Co ltd
Original Assignee
XI'AN HEALTHFUL BIOTECHNOLOGY CO Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by XI'AN HEALTHFUL BIOTECHNOLOGY CO Ltd filed Critical XI'AN HEALTHFUL BIOTECHNOLOGY CO Ltd
Priority to CN201810835248.8A priority Critical patent/CN109097385B/en
Publication of CN109097385A publication Critical patent/CN109097385A/en
Application granted granted Critical
Publication of CN109097385B publication Critical patent/CN109097385B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1022—Transferases (2.) transferring aldehyde or ketonic groups (2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
    • C12Y103/99—Oxidoreductases acting on the CH-CH group of donors (1.3) with other acceptors (1.3.99)
    • C12Y103/99031—Phytoene desaturase (lycopene-forming) (1.3.99.31)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01007—1-Deoxy-D-xylulose-5-phosphate synthase (2.2.1.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y505/00—Intramolecular lyases (5.5)
    • C12Y505/01—Intramolecular lyases (5.5.1)
    • C12Y505/01018—Lycopene epsilon-cyclase (5.5.1.18)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a kind of production beta carotene hydrogenlike silicon ion engineered strain and its construction method, this method optimizes the lycopene cyclase gene crtY in pantoea agglomerans source firstPaCodon, obtain opt crtYPaGene, then with the opt crtY of the prrnB containing promoterPaFour step dehydrogenase gene crtI of gene and the phytoene in pantoea agglomerans sourcePaThe endogenous three step dehydrogenase gene crtI of phytoene of the seamless replacement hydrogenlike silicon ion of gene3Hydrogenlike silicon ion endogenous neurosporene hydroxylation enzyme gene crtC and glucose-6-phosphate dehydrogenase gene zwf are knocked out again, 1- deoxy-D-xylulose sugar -5- phosphate synthase gene dxs finally endogenous in the position integrant expression hydrogenlike silicon ion for knocking out zwf, it obtains producing beta carotene hydrogenlike silicon ion engineering bacteria, the fermented culture of the bacterial strain, the content of beta carotene is up to 30mg/g DCW.

Description

A kind of production beta carotene hydrogenlike silicon ion engineered strain and its construction method
Technical field
The invention belongs to metabolic engineering technology fields, and in particular to a kind of to be constructed using metabolic engineering hydrogenlike silicon ion The method for producing beta carotene bacterial strain.
Background technique
Beta carotene is widely present in the green vegetables such as carrot, fructus lycii and yellow, orange fruit, due to its insatiable hunger And structure, make it that there is stronger antioxidant activity and remove the ability of free radical, the immune function of body can be effectively improved, The fields such as functional food, medicines and health protection and cosmetics have been widely used in it at present, international market demand increasingly expands.
Natural beta-carotin is mainly derived from plant extract and microbial fermentation, but the beta carotene production of plant origin Cost remains high because being limited by raw material, and chemically synthesized beta carotene is mostly that alltrans structure, bioactivity are low And safety is by query.Microbe fermentation method due to being easy to extensive sustainable production, environmental-friendly and at low cost etc. characteristics, And with the fast development of modern metabolic engineering technology, inexorable trend is had become using microbial fermentation production beta carotene.
Currently, the bacterial strain for being uniquely used for industrialized production beta carotene is Blakeslea trispora (Blakeslea Trispora), but Blakeslea trispora lacks effective molecule manipulation technology, and its thallus is divided into positive and negative bacterium, and metabolic regulation is multiple Miscellaneous, there is also many problems in fermentation, unstable if zymotechnique is more complex, period length etc..Hydrogenlike silicon ion Platform cell production beta carotene (Rhodobacter sphaeroides) new as one has many inherent advantages: (1) hydrogenlike silicon ion belongs to photosynthetic bacteria, has photosynthesis gene cluster, there is 7 carotenogenic genes above, according to Coded sequence is followed successively by crtF, crtE, crtD, crtC, crtB, crtI and crtA, this almost meets the biology of beta carotene Synthesis；(2) hydrogenlike silicon ion has endomembrane system abundant, is very beneficial for fat-soluble compound beta carotene in cell membrane On accumulation, while under dark condition, cell membrane is easy to happen fold invagination, considerably increases beta carotene in cell Accumulation on film；(3) genetic manipulation method of hydrogenlike silicon ion is mature, is successfully used for ubiquinone at present10, fatty acid and 5- ammonia The large scale fermentation of the high added values native compound such as base levulic acid produces, and is produced further to explore using hydrogenlike silicon ion Beta carotene is laid a good foundation；(4) hydrogenlike silicon ion itself can synthesize carotenoid under anaerobism illumination condition, and Fermentation costs will be greatlyd save using anaerobism photo fermentation production beta carotene！
Summary of the invention
Technical problem to be solved by the present invention lies in provide it is a kind of produce beta carotene hydrogenlike silicon ion engineered strain with And the construction method of the bacterial strain.
It solves hydrogenlike silicon ion engineered strain used by above-mentioned technical problem to construct to obtain by following methods: optimize first The lycopene cyclase gene crtY in pantoea agglomerans sourcePaCodon, obtain opt crtYPaGene, then with containing starting The opt crtY of sub- prrnBPaFour step dehydrogenase gene crtI of gene and the phytoene in pantoea agglomerans sourcePaGene without Trace replaces the endogenous three step dehydrogenase gene crtI of phytoene of hydrogenlike silicon ion3, then to knock out hydrogenlike silicon ion endogenous Neurosporene hydroxylation enzyme gene crtC and glucose-6-phosphate dehydrogenase gene zwf finally integrates table in the position for knocking out zwf The 1- deoxy-D-xylulose sugar -5- phosphate synthase gene dxs endogenous up to hydrogenlike silicon ion obtains producing beta carotene hydrogenlike silicon ion work Journey bacterium.
Above-mentioned opt crtYPaThe nucleotide sequence of gene is as shown in SEQ ID NO:1.
The above-mentioned opt crtY with the prrnB containing promoterPaGene and crtIPaThe seamless replacement crtI of gene3The method of gene Are as follows: utilize primer opt-crtYPa- F and opt-crtYPa- R, with the opt of fidelity enzyme Pfu PCR amplification prrnB containing promoter crtYPaGene；Using the gene of pantoea agglomerans CGMCC 1.2244 as template, primer opt-crtI is utilizedPa- F and opt-crtIPa- R, with the four step dehydrogenase gene crtI of phytoene of fidelity enzyme Pfu PCR amplification pantoea agglomerans CGMCC 1.2244Pa；Benefit With primer opt-crtIPaYPa- F and opt-crtIPaYPa- R passes through Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus The prrnB containing promoter opt crtYPaGene and crtIPaGene obtains opt crtIPaYPaGene；With hydrogenlike silicon ion The gene of ATH2.4.1 is template, utilizes primer opt-crtIPaYPa- up-F and opt-crtIPaYPa- up-R, with fidelity enzyme PfuPCR expands crtI3The upstream homology arm of gene, utilizes primer opt-crtIPaYPa- down-F and opt-crtIPaYPa- Down-R expands crtI with fidelity enzyme PfuPCR3The downstream homology arm of gene；Utilize primer opt-crtIPaYPa- up-F and opt- crtIPaYPa- R passes through the crtI of Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus3The upstream homology arm of gene with opt crtIPaYPaGene recycles primer opt-crtIPaYPa- up-F and opt-crtIPaYPa- down-R uses high fidelity enzyme KOD-Plus passes through the crtI of Overlap extension PCR ligation amplification3The downstream homology arm of gene realizes crtI3The upstream of gene is homologous Arm-optcrtIPaYPaGene-crtI3The connection of these three genetic fragments of the downstream homology arm of gene, obtains △ crtI3::opt crtIPaYPaSegment；By △ crtI3::opt crtIPaYPaSegment is inserted into the bis- enzymes of EcoR I and XbaI of pK18mobsacB plasmid Enzyme site obtains plasmid pK18- △ crtI3::opt crtIPaYPa, the plasmid is heat-shock transformed to enter S17-1 competence, is supplied Body bacterial strain S17-1 Com △ crtI3::opt crtIPaYPa, parents' engagement is carried out by F-strain of hydrogenlike silicon ion, obtains bacterium Strain RC1.
The method of the endogenous neurosporene hydroxylation enzyme gene crtC of above-mentioned knockout hydrogenlike silicon ion are as follows: with hydrogenlike silicon ion The gene of ATH2.4.1 is template, using primer crtC-up-F and crtC-up-R, with fidelity enzyme Pfu PCR amplification crtC gene Upstream homology arm, using primer crtC-down-F and crtC-down-R, under fidelity enzyme Pfu PCR amplification crtC gene Swim homology arm；Using primer crtC-up-F and crtC-down-R, connected with high fidelity enzyme KOD-Plus by Overlap extension PCR The upstream homology arm and downstream homology arm of the crtC gene of amplification, obtain △ crtC segment；△ crtC segment is inserted into III double enzyme site of EcoR I and Hind of pK18mobsacB plasmid, obtain plasmid pK18- △ crtC, the plasmid it is heat-shock transformed into Enter S17-1 competence, obtain F+strain S17-1Com △ crtC, carries out parents' engagement by F-strain of RC1, obtain basis Bacterial strain RC2.
The method of the endogenous glucose-6-phosphate dehydrogenase gene zwf of above-mentioned knockout hydrogenlike silicon ion are as follows: red thin with class ball The gene of bacterium ATH 2.4.1 is template, using primer zwf-up-F1 and zwf-up-R1, with fidelity enzyme Pfu PCR amplification zwf base The upstream homology arm of cause is expanded under zwf gene using primer zwf-down-F1 and zwf-down-R1 with fidelity enzyme PfuPCR Swim homology arm；Using primer zwf-up-F1 and zwf-down-R1, connected with high fidelity enzyme KOD-Plus by Overlap extension PCR The upstream homology arm and downstream homology arm of the zwf gene of amplification, obtain △ zwf segment；△ zwf segment is inserted into III double enzyme site of Xba I and Hind of pK18mobsacB plasmid obtains plasmid pK18- △ zwf, the heat-shock transformed entrance of the plasmid S17-1 competence obtains F+strain S17-1 Com △ zwf, carries out parents' engagement by F-strain of RC2, obtains basic bacterium Strain RC3.
The above-mentioned 1- deoxy-D-xylulose sugar -5- phosphate synthase base endogenous in the position integrant expression hydrogenlike silicon ion for knocking out zwf Because of the method for dxs are as follows: using the gene of hydrogenlike silicon ion ATH 2.4.1 as template, using primer dxs-F and dxs-R, with fidelity enzyme Pfu PCR amplification dxs gene expands the upper of zwf gene with fidelity enzyme PfuPCR using primer zwf-up-F2 and zwf-up-R2 Homology arm is swum, using primer zwf-down-F2 and zwf-down-R2, with the downstream of fidelity enzyme Pfu PCR amplification class zwf gene Homology arm；Using primer zwf-up-F2 and dxs-R, pass through Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus The upstream homology arm and dxs gene of zwf gene, recycle primer zwf-up-F2 and zwf-down-R2, with high fidelity enzyme KOD- Plus realizes the upstream homology arm-dxs of zwf gene by the downstream homology arm of the zwf gene of Overlap extension PCR ligation amplification The connection of these three genetic fragments of the downstream homology arm of gene-zwf gene, obtains △ zwf::dxs segment；By △ zwf::dxs Segment is inserted into III double enzyme site of Xba I and Hind of pK18mobsacB plasmid, obtains plasmid pK18- △ zwf::dxs, should Plasmid it is heat-shock transformed enter S17-1 competence, obtains F+strain S17-1 Com △ zwf::dxs, using RC3 as F-strain into Row parents engagement obtains producing beta carotene hydrogenlike silicon ion engineering bacteria.
Above-mentioned each primer sequence is as follows:
opt-crtYPa- F:CAACGAAAAACGCCAAGATTTCTTGGC
opt-crtYPa- R:TGTAGTTCTATTCATTCACTGCATCGCCTGCTG
opt-crtIPa- F:AGGCGATGCAGTGAATGAATAGAACT
opt-crtIPa- R:TCAAGCCAGATCCTCCAGCA
opt-crtIPaYPa- F:AGTTCGCGCCCAACGAAAAACGCCAAGATTTCTTGG
opt-crtIPaYPa- R:CAGAGGCAATCATTCAAGCCAGATCCTCCAGCAT
opt-crtIPaYPa- up-F:CCGGAATTCCTCTCGTCGGCCATCTTG
opt-crtIPaYPa- up-R:GTTTTTCGTTGGGCGCGAACTCCTGCA
opt-crtIPaYPa- down-F:GGATCTGGCTTGAATGATTGCCTCTGCCGATCT
opt-crtIPaYPa- down-R:CTAGTCTAGACGCCCGAGAAACTGTCGTAG
CrtC-up-F:CCGGAATTCTCATCATGAACGGACCGCC
CrtC-up-R:GGGATGTCAGGAAAAGGACACGCCGTCGATATACCA
CrtC-down-F:ATCGACGGCGTGTCCTTTTCCTGACATCCCGGCC
CrtC-down-R:CCCCAAGCTTGCCTTCAACACGCTCTGGAC
Zwf-up-F1:CTAGTCTAGATGATCGAGATGGCGGGAGG
Zwf-up-R1:GGCCTCTCAGCGGATAACCATGGGCTCTCCCGC
Zwf-down-F1:GGAGAGCCCATGGTTATCCGCTGAGAGGCCGCCG
Zwf-down-R1:CCCCAAGCTTGGTGATGAGGACATGGATGGC
Zwf-up-F2:CTAGTCTAGATGATCGAGATGGCGGGAGGC
Zwf-up-R2:GTCGGTCATGGGCTCTCCCGCTGCCT
Dxs-F:GAGAGCCCATGACCGACAGACCCTGCAC
Dxs-R:GGCGGCCTCTTCCGATCGCCCTCCTC
Zwf-down-F2:CGATCGGAAGAGGCCGCCGGGC
Zwf-down-R2:CCCCAAGCTTGGTGATGAGGACATGGATGGC
Beneficial effects of the present invention are as follows:
1, the lycopene cyclase gene crtY that the present invention passes through optimization pantoea agglomerans sourcePaCodon, obtain opt crtYPaGene, then with the optcrtY of the prrnB containing promoterPaFour step of gene and the phytoene in pantoea agglomerans source Dehydrogenase gene crtIPaThe endogenous three step dehydrogenase gene crtI of phytoene of the seamless replacement hydrogenlike silicon ion of gene3, Beta carotene synthesis access is constructed in hydrogenlike silicon ion.
2, the present invention passes through the glucose-6-phosphate dehydrogenase gene zwf for knocking out hydrogenlike silicon ion, while integrant expression class The 1- deoxy-D-xylulose sugar -5- phosphate synthase gene dxs of the red bacterium MEP approach of ball makes containing for hydrogenlike silicon ion production beta carotene Amount reaches 30mg/gDCW.
3, the genetic manipulation of production beta-carotene engineering bacteria strain that the present invention constructs be hydrogenlike silicon ion chromosome it is enterprising Capable, the maintenance of resistance or auxotrophy is not needed, and strain stability is strong.
Detailed description of the invention
Fig. 1 is building hydrogenlike silicon ion biosynthesis of beta-carotene engineered strain whole strategy figure.
Specific embodiment
The present invention is described in more detail with reference to the accompanying drawings and examples, but protection scope of the present invention is not limited only to These embodiments.
DNA Maker used in embodiment (Maker III, Maker IV), bacterial genomes DNA extraction kit, quickly The small extraction reagent kit of plasmid (centrifugal column type) and plain agar sugar gel DNA QIAquick Gel Extraction Kit are purchased from Tiangeng biochemical technology (Beijing) Co., Ltd；Tap, Pfu enzyme used in PCR are purchased from the east Beijing Hui Tian Science and Technology Ltd., high fidelity enzyme KOD-Plus purchase From Japanese TOYOBO company；Restriction enzyme enzyme and pK18mobsacB plasmid are purchased from Takara company；Primer synthesis by Shanghai Invitrogen | Thermo Fisher Scientific is completed；It is limited that DNA sequencing by Beijing holds up the new industry biotechnology of section Company completes.
Each primer sequence is as follows in embodiment:
opt-crtYPa- F:CAACGAAAAACGCCAAGATTTCTTGGC
opt-crtYPa- R:TGTAGTTCTATTCATTCACTGCATCGCCTGCTG
opt-crtIPa- F:AGGCGATGCAGTGAATGAATAGAACT
opt-crtIPa- R:TCAAGCCAGATCCTCCAGCA
opt-crtIPaYPa- F:AGTTCGCGCCCAACGAAAAACGCCAAGATTTCTTGG
opt-crtIPaYPa- R:CAGAGGCAATCATTCAAGCCAGATCCTCCAGCAT
opt-crtIPaYPa- up-F:CCGGAATTCCTCTCGTCGGCCATCTTG
opt-crtIPaYPa- up-R:GTTTTTCGTTGGGCGCGAACTCCTGCA
opt-crtIPaYPa- down-F:GGATCTGGCTTGAATGATTGCCTCTGCCGATCT
opt-crtIPaYPa- down-R:CTAGTCTAGACGCCCGAGAAACTGTCGTAG
CrtC-up-F:CCGGAATTCTCATCATGAACGGACCGCC
CrtC-up-R:GGGATGTCAGGAAAAGGACACGCCGTCGATATACCA
CrtC-down-F:ATCGACGGCGTGTCCTTTTCCTGACATCCCGGCC
CrtC-down-R:CCCCAAGCTTGCCTTCAACACGCTCTGGAC
Zwf-up-F1:CTAGTCTAGATGATCGAGATGGCGGGAGG
Zwf-up-R1:GGCCTCTCAGCGGATAACCATGGGCTCTCCCGC
Zwf-down-F1:GGAGAGCCCATGGTTATCCGCTGAGAGGCCGCCG
Zwf-down-R1:CCCCAAGCTTGGTGATGAGGACATGGATGGC
Zwf-up-F2:CTAGTCTAGATGATCGAGATGGCGGGAGGC
Zwf-up-R2:GTCGGTCATGGGCTCTCCCGCTGCCT
Dxs-F:GAGAGCCCATGACCGACAGACCCTGCAC
Dxs-R:GGCGGCCTCTTCCGATCGCCCTCCTC
Zwf-down-F2:CGATCGGAAGAGGCCGCCGGGC
Zwf-down-R2:CCCCAAGCTTGGTGATGAGGACATGGATGGC
crtIPaYPa- S-F:CGATCATGTGCGAGATGG
crtIPaYPa- S-R:TGTTGGTGAGCTGCATGG
Each promoter sequence is as follows in embodiment:
BBa_J95025:AAATTGTTACGGAGCCCAAAAAATCCGCTTGCGCCCGGGGCCGTC TGCTCCTAGAAA CCGCTTCACCGAGACGAAGACCGGCAGCGCCGGACGGAGACGAGGGAGCGGATGACAGAAACGTCGGCCGCGACAAT TGAAGATGAGGCGGACGGGATCGCTGGTTGTCTG
BBa_J95027:AGCCCAAAAAATCCGCTTGCGCCCGGGGCCGTCTGCTCCTAGAAA CCGCTTCATGTG GAATTGTGAGCGCTCACAATTCCACA
BBa_J95026:AGCCCAAAAAATCCGCTTGCGCCCGGGGCCGTCTGCTCCTAGAAA CCGCTTCAAATT GTGAGCGGATAACAATT
Tac:TTGACAATTAATCATCGGCTCGTATAATG
PrrnB:CAACGAAAAACGCCAAGATTTCTTGGCTGCGACATGAAATTGTTACGGAG CCCAAAAAATCC GC
Embodiment 1
Beta carotene biosynthesis pathway in hydrogenlike silicon ion according to figure 1, building produce the class ball of beta carotene Red bacterium engineered strain, specific construction method are as follows:
1, optimize the lycopene cyclase gene crtY in pantoea agglomerans sourcePaCodon and promoter
The lycopene cyclase gene crtY in pantoea agglomerans sourcePaThrough codon optimization, nucleotide sequence such as SEQ is obtained Opt crtY shown in ID NO:1PaGene (by Nanjing, Jin Sirui Bioisystech Co., Ltd is synthesized).5 different startings will be contained The free plasmid pIND of sub- BBa_J95025, BBa_J95027, BBa_J95026, tac and prrnB4-opt crtYPa(by Nanjing The synthesis of Jin Sirui Bioisystech Co., Ltd) it is heat-shock transformed into S17-1 competence, conversion operation method are as follows: use liquid relief respectively Rifle takes 1 μ L plasmid to mix gently with S17-1 competent cell, and ice bath stands 30min, 42 DEG C of metal bath heat shock 90s, ice bath 2min；Then 1mL is added in super-clean bench without resistant to liquids LB, 37 DEG C, 200rpm rejuvenation 45min；50 μ L rejuvenation liquid are taken uniformly to apply It is distributed on the LB solid plate containing 50 μ g/mL Km resistances, 37 DEG C of inversion overnight incubations obtain 5 F+strain S17-1 pIND4-opt crtYPa, with RL1 bacterial strain (Su A, Chi S, Li Y, the et al.Journal of of this seminar Agricultural and food chemistry, 2018) it is F-strain, parents' engagement is carried out, five different bacterium are obtained Strain, this five different bacterial strains carry out fermented and cultured, the composition of fermentation medium respectively are as follows: glucose 30g/L, Dried Corn Steep Liquor Powder 3g/L, sodium glutamate 3g/L, NaCl 2.8g/L, (NH4)2SO4 3g/L、KH2PO4 3g/L、MgSO4 6.3g/L、CaCO3 2g/ L, niacin 1mg/L, niacin thiamines 1mg/L, 15 μ g/L of biotin.The fermentation training of 50% liquid amount is forwarded to by 2% inoculum concentration It supports in base, 34 DEG C of 150rpm dark culturing 4d.The content of HPLC quantitative analysis beta carotene, as opt crtYPaGene opens When mover is prrnB, the content highest of beta carotene.
2, with the opt crtY of the prrnB containing promoterPaGene and crtIPaThe seamless replacement hydrogenlike silicon ion itself of gene crtI3Gene
With the opt crtY of the prrnB containing promoter of synthesisPaGene (is closed by Nanjing Jin Sirui Bioisystech Co., Ltd At) it is template, design primer opt-crtYPa- F and opt-crtYPa- R contains promoter using fidelity enzyme Pfu PCR amplification The opt crtY of prrnBPaGene, PCR amplification system are as follows: 2 × Pfu PCR mix, 10 μ L, opt-crtYPa-F(10μM)1μL、 opt-crtYPa- R (10 μM) 1 μ L, synthesis gene (20 μ g/ μ L) 1 μ L, ddH27 μ L of O, response procedures are as follows: 94 DEG C of denaturation 3min, Then 94 DEG C of denaturation 30s, 62 DEG C of annealing 30s, 72 DEG C of extension 3min totally 35 circulation after, 72 DEG C of extension 10min.Use plain agar The opt crtY of the prrnB containing promoter of sugared gel DNA QIAquick Gel Extraction Kit recycling amplificationPaGenetic fragment (1259bp)；With agglomerating The gene of general bacterium CGMCC 1.2244 is template, design primer opt-crtIPa- F and opt-crtIPa- R utilizes fidelity enzyme Pfu PCR amplification opt crtIPaGene, PCR amplification system are as follows: 2 × Pfu PCR mix, 10 μ L, opt-crtIPa-F(10μM)1μL、 opt-crtIPa- R (10 μM) 1 μ L, synthesis gene (20 μ g/ μ L) 1 μ L, ddH27 μ L of O, response procedures are as follows: 94 DEG C of denaturation 3min, Then 94 DEG C of denaturation 30s, 62 DEG C of annealing 30s, 72 DEG C of extension 2min totally 35 circulation after, 72 DEG C of extension 10min.Recycling amplification opt crtIPaGenetic fragment (1480bp)；Design primer opt-crtIPaYPa- F and opt-crtIPaYPa- R uses high fidelity enzyme KOD-Plus passes through the opt crtY of Overlap extension PCR ligation amplificationPaGene and crtIPaGene, Overlap extension PCR amplification are anti- Answer system are as follows: 10 × PCR buffer for KOD-Plus, 5 μ L, 5 μ L of dNTPs (2mM), MgSO4(25mM)2μL、opt- crtIPaYPa-F(10μM)1.5μL、opt-crtIPaYPa-R(10μM)1.5μL、opt crtYPaGenetic fragment (20 μ g/ μ L) 2 μ L、opt crtIPaGenetic fragment (20 μ g/ μ L) 2 μ L, KOD-Plus (1U/ μ L) 1 μ L, ddH230 μ L of O, response procedures are as follows: 94 DEG C Be denaturalized 2min, then 94 DEG C of denaturation 15s, 65 DEG C of annealing 30s, 68 DEG C of extension 3min totally 35 recycle after, 68 DEG C of extension 10min. Recycle opt crtIPaYPaGenetic fragment (2746 bp).
Using the gene of hydrogenlike silicon ion ATH 2.4.1 as template, design primer opt-crtIPaYPa- up-F and opt- crtIPaYPa- up-R utilizes fidelity enzyme Pfu PCR amplification crtI3The upstream homology arm of gene, PCR amplification system are as follows: 2 × Pfu PCR mix 10μL、opt-crtIPaYPa-up-F(10μM)1μL、opt-crtIPaYPa- up-R (10 μM) 1 μ L, hydrogenlike silicon ion Gene (20 μ g/ μ L) 1 μ L, ddH27 μ L of O, response procedures are as follows: 94 DEG C of denaturation 3min, then 94 DEG C of denaturation 30s, 62 DEG C annealing 30s, 72 DEG C of extension 1min totally 35 circulation after, 72 DEG C of extension 10min.Recycle crtI3Upstream homology arm genetic fragment (453 bp)。
Using the gene of hydrogenlike silicon ion ATH 2.4.1 as template, design primer opt-crtIPaYPa- down-F and opt- crtIPaYPa- down-R utilizes fidelity enzyme Pfu PCR amplification crtI3Downstream homology arm, PCR amplification system are as follows: 2 × Pfu PCR mix 10μL、opt-crtIPaYPa-down-F(10μM)1μL、opt-crtIPaYPa- down-R (10 μM) 1 μ L, class ball are red Bacterial gene (20 μ g/ μ L) 1 μ L, ddH27 μ L of O, response procedures are as follows: 94 DEG C of denaturation 3min, then 94 DEG C of denaturation 30s, 64 DEG C move back Fiery 30s, 72 DEG C of extension 1min totally 35 circulation after, 72 DEG C of extension 10min.It is returned with plain agar sugar gel DNA QIAquick Gel Extraction Kit Receive crtI3Downstream homology arm genetic fragment (411bp).
Utilize primer opt-crtIPaYPa- up-F and opt-crtIPaYPa- R is prolonged with high fidelity enzyme KOD-Plus by overlapping Stretch the crtI of PCR ligation amplification3The upstream homology arm and opt crtI of genePaYPaGene, Overlap extension PCR amplification reaction system Are as follows: 10 × PCR buffer for KOD-Plus, 5 μ L, 5 μ L of dNTPs (2mM), MgSO4(25mM)2μL、opt-crtIPaYPa- up-F(10μM)1.5μL、opt-crtIPaYPa-R(10μM)1.5μL、opt crtIPaYPaGenetic fragment (20 μ g/ μ L) 2 μ L, crtI3Upstream homology arm genetic fragment (20 μ g/ μ L) 2 μ L, KOD-Plus (1U/ μ L) 1 μ L, ddH230 μ L of O, response procedures Are as follows: 94 DEG C of denaturation 2min, then 94 DEG C of denaturation 15s, 64 DEG C of annealing 30s, 68 DEG C of extension 2min totally 35 circulation after, 68 DEG C extension 10min.Recycle crtI3Upstream homology arm-the optcrtI of genePaYPaGene junction fragment.Recycle primer opt- crtIPaYPa- up-F and crtIPaYPa- down-R, with high fidelity enzyme KOD-Plus ligation amplification crtI3The downstream of gene is homologous Arm, Overlap extension PCR amplification reaction system are as follows: 10 × PCR buffer for KOD-Plus, 5 μ L, 5 μ L of dNTPs (2mM), MgSO4(25mM)2μL、opt-crtIPaYPa-up-F(10μM)1.5μL、crtIPaYPa-down-R(10μM)1.5μL、crtI3Base Upstream homology arm-the optcrtI of causePaYPaGene junction fragment (20 μ g/ μ L) 2 μ L, crtI3Downstream homology arm genetic fragment (20μg/μL)2μL、KOD-Plus(1U/μL)1μL、ddH230 μ L of O, response procedures are as follows: 94 DEG C of denaturation 2min, then 94 DEG C of changes Property 15s, 64 DEG C of annealing 30s, 68 DEG C of extension 150s totally 30 circulation after, 68 DEG C of extension 10min.After Overlap extension PCR, add 10 μ L Taq Mix enzymes continue 72 DEG C of PCR and extend 30min, recycle crtI after mixing3Upstream homology arm-the opt of gene crtIPaYPaGene-crtI3The junction fragment of three genes of downstream homology arm of gene, obtains △ crtI3::opt crtIPaYPa Segment.
By △ crtI3::opt crtIPaYPaSegment with after EcoR I and XbaI double digestion through T4Ligase is connected to The EcoR I and XbaI double enzyme site of pK18mobsacB plasmid, double enzyme digestion reaction system are as follows: 10 × M buffer, 5 μ L, EcoR Ⅰ2.5μL、XbaI 2.5μL、△crtI3::crtIPaYPa40 μ L of/pK18mobsacB, reaction condition are as follows: 37 DEG C of digestion 2h are obtained Obtain plasmid pK18- △ crtI3::opt crtIPaYPa, the plasmid is heat-shock transformed into S17-1 competence, obtain F+strain S17-1 Com△crtI3::opt crtIPaYPa, parents' engagement is carried out by F-strain of hydrogenlike silicon ion, obtains bacterial strain RC1, Save strain.
3, crtC gene disruption beta carotene metabolic exhaustion approach is knocked out
According to the method for constructing bacterial strain RC in step 1, using the gene of hydrogenlike silicon ion ATH 2.4.1 as template, using drawing Object crtC-up-F and crtC-up-R, with the neurosporene hydroxylation enzyme gene of fidelity enzyme Pfu PCR amplification hydrogenlike silicon ion The upstream homology arm (427bp) of crtC, using primer crtC-down-F and crtC-down-R, with fidelity enzyme Pfu PCR amplification The downstream homology arm (428bp) of crtC gene, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, then 94 DEG C of denaturation 30s, 60 DEG C annealing 30s, 72 DEG C of extensions 1min totally 35 recycle after, 72 DEG C of extension 10min.Utilize primer crtC-up-F and crtC- Down-R, upstream homology arm and downstream with high fidelity enzyme KOD-Plus by the crtC gene of Overlap extension PCR ligation amplification Homology arm, Overlap extension PCR amplified reaction program are as follows: 94 DEG C of denaturation 2min, then 94 DEG C of denaturation 15s, 60 DEG C of annealing 30s, 68 DEG C extend 60s totally 35 circulation after, 68 DEG C of extension 10min obtain △ crtC segment；△ crtC segment is inserted into III double enzyme site of EcoR I and Hind of pK18mobsacB plasmid, obtain plasmid pK18- △ crtC, the plasmid it is heat-shock transformed into Enter S17-1 competence, obtain F+strain S17-1 Com △ crtC, carries out parents' engagement by F-strain of RC1, obtain base Plinth bacterial strain RC2.
4, it knocks out central metabolic pathway key gene zwf and blocks competition of the pentose phosphate pathway to carbon source
Primer is utilized using the gene of hydrogenlike silicon ion ATH2.4.1 as template according to the method for constructing bacterial strain RC in step 1 Zwf-up-F1 and zwf-up-R1, with the glucose-6-phosphate dehydrogenase gene zwf of fidelity enzyme Pfu PCR amplification hydrogenlike silicon ion Upstream homology arm (582bp), using primer zwf-down-F1 and zwf-down-R1, with fidelity enzyme Pfu PCR amplification zwf base The downstream homology arm (639bp) of cause, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, then 94 DEG C of denaturation 30s, 66 DEG C annealing 30s, 72 DEG C of extension 1min totally 35 circulation after, 72 DEG C of extension 10min.Using primer zwf-up-F1 and zwf-down-R1, use Upstream homology arm and downstream homology arm of the high fidelity enzyme KOD-Plus by the zwf gene of Overlap extension PCR ligation amplification, overlapping Extension PCR amplified reaction program are as follows: 94 DEG C of denaturation 2min, then 94 DEG C of denaturation 15s, 67 DEG C of annealing 30s, 68 DEG C of extension 40s are total After 35 circulations, 68 DEG C of extension 10min obtain △ zwf segment；△ zwf segment is inserted into the Xba I of pK18mobsacB plasmid With III double enzyme site of Hind, plasmid pK18- △ zwf is obtained, the plasmid is heat-shock transformed to enter S17-1 competence, obtains donor Bacterial strain S17-1 Com △ zwf carries out parents' engagement by F-strain of RC2, obtains basic bacterial strain RC3.
5, integrant expression MEP approach rate limiting gene dxs improves the supply of beta carotene direct precursor substance
According to the method for constructing bacterial strain RC in step 1, using the gene of hydrogenlike silicon ion ATH 2.4.1 as template, using drawing Object dxs-F and dxs-R, with the endogenous 1- deoxy-D-xylulose sugar -5- phosphate synthase gene of fidelity enzyme Pfu PCR amplification hydrogenlike silicon ion Dxs (1953 bp), pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, then 94 DEG C of denaturation 30s, 68 DEG C of annealing 30s, 72 DEG C Extend 4min totally 30 circulation after, 72 DEG C of extension 10min.Using primer zwf-up-F2 and zwf-up-R2, with fidelity enzyme Pfu The upstream homology arm (560bp) of PCR amplification zwf gene, using primer zwf-down-F2 and zwf-down-R2, with fidelity enzyme PfuPCR expands the downstream homology arm (614bp) of zwf gene, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, then 94 DEG C Be denaturalized 30s, 68 DEG C of annealing 30s, 72 DEG C of extension 1min totally 35 recycle after, 72 DEG C of extension 10min.Utilize primer zwf-up-F2 With dxs-R, the upstream homology arm and dxs base for passing through the zwf gene of Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus Cause recycles primer zwf-up-F2 and zwf-down-R2, passes through Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus Zwf gene downstream homology arm, realize zwf gene upstream homology arm-dxs gene-zwf gene downstream homology arm this three The connection of a genetic fragment, Overlap extension PCR amplified reaction program are as follows: 94 DEG C of denaturation 2min, then 94 DEG C of denaturation 15s, 68 DEG C After totally 35 circulations, 68 DEG C of extension 10min obtain △ zwf::dxs segment by annealing 30s, 68 DEG C of extension 100s；By △ zwf:: Dxs segment is inserted into III double enzyme site of Xba I and Hind of pK18mobsacB plasmid, obtains plasmid pK18- △ zwf::dxs, The plasmid is heat-shock transformed to enter S17-1 competence, F+strain S17-1 Com △ zwf::dxs is obtained, using RC3 as F-strain Parents' engagement is carried out, beta carotene hydrogenlike silicon ion engineering bacteria is obtained.
Inventor carries out fermented and cultured, the composition of fermentation medium using the hydrogenlike silicon ion engineering bacteria that embodiment 1 obtains Are as follows: glucose 30g/L, Dried Corn Steep Liquor Powder 3g/L, sodium glutamate 3g/L, NaCl 2.8g/L, (NH4)2SO4 3g/L、KH2PO4 3g/L、MgSO4 6.3g/L、CaCO32g/L, niacin 1mg/L, niacin thiamines 1mg/L, 15 μ g/L of biotin.By 6% inoculation Amount is forwarded in the fermentation medium of 60% liquid amount, 34 DEG C of 150rpm dark culturings.In beta carotene hydrogenlike silicon ion engineering Bacterium early stage fermentation stage (0-48h), fermentation liquid be it is light yellow, then become yellow (48-96h) at leisure until crocus (96- 168h).When hydrogenlike silicon ion engineering bacterium fermentation 168h, biomass reaches 6.5g/L, and through HPLC quantitative analysis, beta carotene contains Amount is 30mg/gDCW.
Sequence table
<110>Xi'an Hai Sifu Biotechnology Co., Ltd
<120>a kind of production beta carotene hydrogenlike silicon ion engineered strain and its construction method
<141> 2018-07-26
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1161
<212> DNA
<213> Erwinia herbicola
<400> 1
atgccccgct atgacctcat cctggtgggc gcgggcctcg ccaacggcct gatcgccctc 60
cgcctgcgcc agcagcgccc ctcgctgcgc atcctgctga tcgacgccga gcgcgagccc 120
ggcgccaacc acacctggtc gttccatgcg gaggacctca cggagaccca gcaccgctgg 180
atcgccccgc tcgtggtgca ccattggccg ggctatgagg tgcgcttccc ccagcgctcg 240
cgctcgctca actcgggcta tttctgcgtg acctcggagc gcttcgtgca ggtgatccgc 300
gaccgcttcg cccccgacct gctcctgaac acccgcgtgg ccggcatcgc ctcgcgcacg 360
gtgaccctgg acgacggccg cgtgctggag tcggacgcgg tgatcgacgg ccgcggctac 420
cagccggacg ccgcgctgtg catgggcttc cagtcgttcg tgggccagga gtggcagctg 480
tcggagcccc atggcctgac ggcccccatc atcatggacg ccaccgtgga ccagcaggcc 540
ggctaccgct tcgtgtattc gctcccgttc tcggccgaca ccctcctgat cgaggacacg 600
cattacatcg acaacgccac cctggagggc gaccgcgccc gccagaacat ccgcgcctat 660
gcggcccagc agggctggcg cctcgaccgc ctcctgcgcg aggagcaggg cgccctcccc 720
atcacgctca ccggcgacgt ggcggccttc tggcagaagc atgacctgcc ctgctcgggc 780
ctccgcgccg gcctgttcca tccgacgacc ggctattcgc tgcccctggc ggtggccctg 840
gcggaccgcc tggcccagat gcagaccttc acgtcggaga ccctgcacgc gacgatccag 900
cagttcgcct cgcaggcctg gcagcagcag cgcttcttcc gcatgctcaa ccgcatgctc 960
ttcctggccg gcccggcgga ccagcgctgg caggtgatgc agcgcttcta tggcctcccc 1020
gagggcctga tcgcccgctt ctatgcgggc aagctgaccc tgccggaccg cctccgcatc 1080
ctgtcgggca agccgcccgt gccggtgctg gcggccctgc aggccatcat gacgccgcat 1140
cgccagcagg cgatgcagtg a 1161

Claims (7)

1. a kind of construction method for producing beta carotene hydrogenlike silicon ion engineering bacteria, it is characterised in that: optimization pantoea agglomerans first The lycopene cyclase gene crtY in sourcePaCodon, obtain opt crtYPaGene, then with the prrnB's containing promoter opt crtYPaFour step dehydrogenase gene crtI of gene and the phytoene in pantoea agglomerans sourcePaThe seamless replacement class ball of gene The endogenous three step dehydrogenase gene crtI of phytoene of red bacterium3, then knock out the endogenous neurosporene hydroxyl of hydrogenlike silicon ion Base enzyme gene crtC and glucose-6-phosphate dehydrogenase gene zwf is finally red thin in the position integrant expression class ball for knocking out zwf The endogenous 1- deoxy-D-xylulose sugar -5- phosphate synthase gene dxs of bacterium obtains producing beta carotene hydrogenlike silicon ion engineering bacteria.
2. the construction method according to claim 1 for producing beta carotene hydrogenlike silicon ion engineering bacteria, it is characterised in that: institute State opt crtYPaThe nucleotide sequence of gene is as shown in SEQ ID NO:1.
3. the construction method according to claim 2 for producing beta carotene hydrogenlike silicon ion engineering bacteria, it is characterised in that with containing The opt crtY of promoter prrnBPaGene and crtIPaThe seamless replacement crtI of gene3The method of gene are as follows: utilize primer opt- crtYPa- F and opt-crtYPa- R, with the opt crtY of fidelity enzyme Pfu PCR amplification prrnB containing promoterPaGene；With agglomerating The gene of general bacterium CGMCC 1.2244 is template, utilizes primer opt-crtIPa- F and opt-crtIPa- R, with fidelity enzyme Pfu The four step dehydrogenase gene crtI of phytoene of PCR amplification pantoea agglomerans CGMCC 1.2244Pa；Utilize primer opt- crtIPaYPa- F and opt-crtIPaYPa- R contains promoter by Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus The opt crtY of prrnBPaGene and crtIPaGene obtains opt crtIPaYPaGene；With hydrogenlike silicon ion ATH 2.4.1's Gene is template, utilizes primer opt-crtIPaYPa- up-F and opt-crtIPaYPa- up-R, with fidelity enzyme Pfu PCR amplification crtI3The upstream homology arm of gene, utilizes primer opt-crtIPaYPa- down-F and opt-crtIPaYPa- down-R uses fidelity Enzyme Pfu PCR amplification crtI3The downstream homology arm of gene；Utilize primer opt-crtIPaYPa- up-F and opt-crtIPaYPa- R, Pass through the crtI of Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus3The upstream homology arm and opt crtI of genePaYPa Gene recycles primer opt-crtIPaYPa- up-F and opt-crtIPaYPa- down-R passes through weight with high fidelity enzyme KOD-Plus The crtI of folded extension PCR ligation amplification3The downstream homology arm of gene realizes crtI3Upstream homology arm-the optcrtI of genePaYPa Gene-crtI3The connection of these three genetic fragments of the downstream homology arm of gene, obtains △ crtI3::opt crtIPaYPaSegment； By △ crtI3::opt crtIPaYPaSegment is inserted into the EcoR I and XbaI double enzyme site of pK18mobsacB plasmid, obtains matter Grain pK18- △ crtI3::opt crtIPaYPa, the plasmid is heat-shock transformed to enter S17-1 competence, obtains F+strain S17- 1Com△crtI3::opt crtIPaYPa, parents' engagement is carried out by F-strain of hydrogenlike silicon ion, obtains bacterial strain RC1；
Above-mentioned each primer sequence is as follows:
opt-crtYPa- F:CAACGAAAAACGCCAAGATTTCTTGGC
opt-crtYPa- R:TGTAGTTCTATTCATTCACTGCATCGCCTGCTG
opt-crtIPa- F:AGGCGATGCAGTGAATGAATAGAACT
opt-crtIPa- R:TCAAGCCAGATCCTCCAGCA
opt-crtIPaYPa- F:AGTTCGCGCCCAACGAAAAACGCCAAGATTTCTTGG
opt-crtIPaYPa- R:CAGAGGCAATCATTCAAGCCAGATCCTCCAGCAT
opt-crtIPaYPa- up-F:CCGGAATTCCTCTCGTCGGCCATCTTG
opt-crtIPaYPa- up-R:GTTTTTCGTTGGGCGCGAACTCCTGCA
opt-crtIPaYPa- down-F:GGATCTGGCTTGAATGATTGCCTCTGCCGATCT
opt-crtIPaYPa- down-R:CTAGTCTAGACGCCCGAGAAACTGTCGTAG.
4. the construction method according to claim 3 for producing beta carotene hydrogenlike silicon ion engineering bacteria, it is characterised in that knock out The method of the endogenous neurosporene hydroxylation enzyme gene crtC of hydrogenlike silicon ion are as follows: with the gene of hydrogenlike silicon ion ATH 2.4.1 For template, using primer crtC-up-F and crtC-up-R, with the upstream homology arm of fidelity enzyme Pfu PCR amplification crtC gene, Using primer crtC-down-F and crtC-down-R, with the downstream homology arm of fidelity enzyme Pfu PCR amplification crtC gene；It utilizes Primer crtC-up-F and crtC-down-R pass through the crtC base of Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus The upstream homology arm and downstream homology arm of cause, obtain △ crtC segment；△ crtC segment is inserted into pK18mobsacB plasmid III double enzyme site of EcoR I and Hind obtains plasmid pK18- △ crtC, and the plasmid is heat-shock transformed to enter S17-1 competence, obtains To F+strain S17-1Com △ crtC, parents' engagement is carried out by F-strain of RC1, obtains basic bacterial strain RC2；
Above-mentioned each primer sequence is as follows:
CrtC-up-F:CCGGAATTCTCATCATGAACGGACCGCC
CrtC-up-R:GGGATGTCAGGAAAAGGACACGCCGTCGATATACCA
CrtC-down-F:ATCGACGGCGTGTCCTTTTCCTGACATCCCGGCC
CrtC-down-R:CCCCAAGCTTGCCTTCAACACGCTCTGGAC.
5. the construction method according to claim 4 for producing beta carotene hydrogenlike silicon ion engineering bacteria, it is characterised in that knock out The method of the endogenous glucose-6-phosphate dehydrogenase gene zwf of hydrogenlike silicon ion are as follows: with the gene of hydrogenlike silicon ion ATH 2.4.1 It is sharp with the upstream homology arm of fidelity enzyme Pfu PCR amplification zwf gene using primer zwf-up-F1 and zwf-up-R1 for template With primer zwf-down-F1 and zwf-down-R1, with the downstream homology arm of fidelity enzyme Pfu PCR amplification zwf gene；Using drawing Object zwf-up-F1 and zwf-down-R1 pass through the zwf gene of Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus Upstream homology arm and downstream homology arm, obtain △ zwf segment；△ zwf segment is inserted into I He of Xba of pK18mobsacB plasmid III double enzyme site of Hind obtains plasmid pK18- △ zwf, and the plasmid is heat-shock transformed to enter S17-1 competence, obtains donor bacterium Strain S17-1Com △ zwf carries out parents' engagement by F-strain of RC2, obtains basic bacterial strain RC3；
Above-mentioned each primer sequence is as follows:
Zwf-up-F1:CTAGTCTAGATGATCGAGATGGCGGGAGG
Zwf-up-R1:GGCCTCTCAGCGGATAACCATGGGCTCTCCCGC
Zwf-down-F1:GGAGAGCCCATGGTTATCCGCTGAGAGGCCGCCG
Zwf-down-R1:CCCCAAGCTTGGTGATGAGGACATGGATGGC.
6. the construction method according to claim 5 for producing beta carotene hydrogenlike silicon ion engineering bacteria, it is characterised in that striking Except the method for the endogenous 1- deoxy-D-xylulose sugar -5- phosphate synthase gene dxs of the position integrant expression hydrogenlike silicon ion of zwf are as follows: with The gene of hydrogenlike silicon ion ATH 2.4.1 is template, using primer dxs-F and dxs-R, with fidelity enzyme Pfu PCR amplification dxs base Cause, using primer zwf-up-F2 and zwf-up-R2, with the upstream homology arm of fidelity enzyme Pfu PCR amplification zwf gene, using drawing Object zwf-down-F2 and zwf-down-R2, with the downstream homology arm of fidelity enzyme Pfu PCR amplification class zwf gene；Utilize primer Zwf-up-F2 and dxs-R, it is homologous by the upstream of the zwf gene of Overlap extension PCR ligation amplification with high fidelity enzyme KOD-Plus Arm and dxs gene recycle primer zwf-up-F2 and zwf-down-R2, pass through overlap-extension PCR with high fidelity enzyme KOD-Plus The downstream homology arm of the zwf gene of PCR ligation amplification, realize zwf gene upstream homology arm-dxs gene-zwf gene under The connection for swimming these three genetic fragments of homology arm, obtains △ zwf::dxs segment；△ zwf::dxs segment is inserted into III double enzyme site of Xba I and Hind of pK18mobsacB plasmid, obtains plasmid pK18- △ zwf::dxs, which turns Change and enter S17-1 competence, obtain F+strain S17-1Com △ zwf::dxs, carries out parents' engagement by F-strain of RC3, It obtains producing beta carotene hydrogenlike silicon ion engineering bacteria；
Above-mentioned each primer sequence is as follows:
Zwf-up-F2:CTAGTCTAGATGATCGAGATGGCGGGAGGC
Zwf-up-R2:GTCGGTCATGGGCTCTCCCGCTGCCT
Dxs-F:GAGAGCCCATGACCGACAGACCCTGCAC
Dxs-R:GGCGGCCTCTTCCGATCGCCCTCCTC
Zwf-down-F2:CGATCGGAAGAGGCCGCCGGGC
Zwf-down-R2:CCCCAAGCTTGGTGATGAGGACATGGATGGC.
7. the production beta carotene hydrogenlike silicon ion engineered strain that the construction method of claim 1 obtains.
CN201810835248.8A 2018-07-26 2018-07-26 Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof Active CN109097385B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810835248.8A CN109097385B (en) 2018-07-26 2018-07-26 Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810835248.8A CN109097385B (en) 2018-07-26 2018-07-26 Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof

Publications (2)

Publication Number Publication Date
CN109097385A true CN109097385A (en) 2018-12-28
CN109097385B CN109097385B (en) 2022-05-20

Family

ID=64847748

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810835248.8A Active CN109097385B (en) 2018-07-26 2018-07-26 Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof

Country Status (1)

Country Link
CN (1) CN109097385B (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109609519A (en) * 2018-10-31 2019-04-12 昆明理工大学 A kind of gene RKcrtYB and its application
CN111304138A (en) * 2020-02-03 2020-06-19 天津大学 Recombinant escherichia coli for producing β -carotene and construction method and application thereof
CN114686385A (en) * 2022-04-11 2022-07-01 陕西海斯夫生物工程有限公司 Recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103509729A (en) * 2012-06-15 2014-01-15 浙江新和成股份有限公司 Construction method of engineering bacterium for producing coenzyme Q10, engineering bacterium and application of engineering bacterium
CN103740744A (en) * 2014-01-17 2014-04-23 河北大学 Zeaxanthin synthetic gene recombinant plasmid and preparation method and use thereof
CN104962488A (en) * 2015-07-22 2015-10-07 天津大学 Recombinant yeast strain, and construction method and application thereof
CN105087406A (en) * 2015-07-22 2015-11-25 天津大学 Recombinant yeast strain as well as construction method and application thereof
CN105420134A (en) * 2015-12-25 2016-03-23 天津大学 Recombinant yeast strain, and construction method and application thereof
CN105779319A (en) * 2016-03-23 2016-07-20 天津大学 Recombinant yeast strain, and building method and application thereof
CN106801028A (en) * 2017-01-17 2017-06-06 中山大学 Produce high-content zeaxanthin or astaxanthin engineering bacteria and its application
CN106987550A (en) * 2017-05-18 2017-07-28 陕西师范大学 A kind of recombinant bacterium for producing bata-carotene and its construction method and application

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103509729A (en) * 2012-06-15 2014-01-15 浙江新和成股份有限公司 Construction method of engineering bacterium for producing coenzyme Q10, engineering bacterium and application of engineering bacterium
CN103740744A (en) * 2014-01-17 2014-04-23 河北大学 Zeaxanthin synthetic gene recombinant plasmid and preparation method and use thereof
CN104962488A (en) * 2015-07-22 2015-10-07 天津大学 Recombinant yeast strain, and construction method and application thereof
CN105087406A (en) * 2015-07-22 2015-11-25 天津大学 Recombinant yeast strain as well as construction method and application thereof
CN105420134A (en) * 2015-12-25 2016-03-23 天津大学 Recombinant yeast strain, and construction method and application thereof
CN105779319A (en) * 2016-03-23 2016-07-20 天津大学 Recombinant yeast strain, and building method and application thereof
CN106801028A (en) * 2017-01-17 2017-06-06 中山大学 Produce high-content zeaxanthin or astaxanthin engineering bacteria and its application
CN106987550A (en) * 2017-05-18 2017-07-28 陕西师范大学 A kind of recombinant bacterium for producing bata-carotene and its construction method and application

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ANPING SU等: "Metabolic Redesign of Rhodobacter sphaeroides for Lycopene Production", 《JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY》 *
JING ZHAO等: "Engineeringcentralmetabolicmodulesof Escherichiacoli for improving b-carotene production", 《METABOLICENGINEERING》 *
SHUANG C.CHI等: "Assembly of functional photosystem complexes in Rhodobacter sphaeroides incorporating carotenoids from the spirilloxanthin pathway", 《BIOCHIMICA ET BIOPHYSICA ACTA》 *
SONG X等: "1-deoxy-d-xylulose 5-phosphate synthase (DXS), a crucial enzyme for isoprenoids biosynthesis", 《SPRINGER: NEW YORK》 *
YAN ZHOU等: "Lycopene production in recombinant strains of Escherichia coli is improved by knockout of the central carbon metabolism gene coding for glucose-6-phosphate dehydrogenase", 《BIOTECHNOL LETT》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109609519A (en) * 2018-10-31 2019-04-12 昆明理工大学 A kind of gene RKcrtYB and its application
CN111304138A (en) * 2020-02-03 2020-06-19 天津大学 Recombinant escherichia coli for producing β -carotene and construction method and application thereof
CN111304138B (en) * 2020-02-03 2021-12-24 天津大学 Recombinant escherichia coli for producing beta-carotene and construction method and application thereof
CN114686385A (en) * 2022-04-11 2022-07-01 陕西海斯夫生物工程有限公司 Recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof
CN114686385B (en) * 2022-04-11 2022-10-11 陕西海斯夫生物工程有限公司 Recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof

Also Published As

Publication number Publication date
CN109097385B (en) 2022-05-20

Similar Documents

Publication Publication Date Title
Jiang et al. Enhanced astaxanthin production in yeast via combined mutagenesis and evolution
Zhang et al. Two-step cultivation for production of astaxanthin in Chlorella zofingiensis using a patented energy-free rotating floating photobioreactor (RFP)
CN109097385A (en) A kind of production beta carotene hydrogenlike silicon ion engineered strain and its construction method
Xie et al. Bioprocess operation strategies with mixotrophy/photoinduction to enhance lutein production of microalga Chlorella sorokiniana FZU60
CN104651287B (en) A kind of engineering bacteria and application for synthetic glycerine glucoside
Guo et al. Development of a multi-stage continuous fermentation strategy for docosahexaenoic acid production by Schizochytrium sp.
CN105087604B (en) A kind of application of sll0147 gene in synthesis cytoalgae carotenoid
CN109666596A (en) A method of it producing the recombinant bacterium of beta carotene and is constructed using Crispr-Cas9 technology
CN108795789A (en) A kind of high-yield itaconic acid Yarrowia lipolytica engineered strain and its construction method, zymotechnique and application
CN104419701A (en) Rapid assembling method of multi-fragment DNA yeast
CN103865818A (en) Construction method of genetically engineered bacterium for producing astaxanthin
CN110184193B (en) Continuous gradient material supplementing method and device applied to efficient propagation of haematococcus pluvialis
CN110195023A (en) A kind of Wine brewing yeast strain and its application
CN105861538A (en) Recombinant plasmid and recombinant yeast strain and establishing method and application thereof
CN104388371A (en) Genetic engineering bacterium for high-yield phloroglucinol as well as construction method and application of genetic engineering bacterium
Ding et al. Directed evolution of the fusion enzyme for improving astaxanthin biosynthesis in Saccharomyces cerevisiae
CN109266592A (en) A kind of l-tyrosine genetic engineering bacterium and its method for producing l-tyrosine
Kim et al. High-level production of lycopene in metabolically engineered E. coli
CN104388457A (en) Gene modification method for increasing yield of phloroglucinol and application of same
CN108611360A (en) A kind of production lycopene hydrogenlike silicon ion engineered strain and its construction method
CN107384847A (en) A kind of recombinant bacterium of Efficient Conversion xylose production ethylene glycol and its application
Tsai et al. Cooperation of phytoene synthase, pyridoxal kinase and carbonic anhydrase for enhancing carotenoids biosynthesis in genetic Chlamydomonas reinhardtii
CN106801028A (en) Produce high-content zeaxanthin or astaxanthin engineering bacteria and its application
CN104404077B (en) A method of multiple foreign genes are cloned into microbial genome simultaneously
CN106282208A (en) Stigma Croci and Stigma Croci endogenetic fungus GGPPS gene, gene clone method and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20220621

Address after: 712100 C1, torch Park, free trade street, Yangling Demonstration Zone, Xi'an City, Shaanxi Province

Patentee after: SHAANXI HEALTHFUL BIOLOGICAL ENGINEERING Co.,Ltd.

Address before: Room 804, block a, Huihang Plaza, Hangtuo Road, Xi'an space base, Shaanxi 710100

Patentee before: XI'AN HEALTHFUL BIOTECHNOLOGY Co.,Ltd.