CN109666596A - A method of it producing the recombinant bacterium of beta carotene and is constructed using Crispr-Cas9 technology - Google Patents
A method of it producing the recombinant bacterium of beta carotene and is constructed using Crispr-Cas9 technology Download PDFInfo
- Publication number
- CN109666596A CN109666596A CN201811543192.5A CN201811543192A CN109666596A CN 109666596 A CN109666596 A CN 109666596A CN 201811543192 A CN201811543192 A CN 201811543192A CN 109666596 A CN109666596 A CN 109666596A
- Authority
- CN
- China
- Prior art keywords
- plasmid
- primer
- gut2
- mfe
- pjn44
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
- C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/905—Stable introduction of foreign DNA into chromosome using homologous recombination in yeast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Mycology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plant Pathology (AREA)
- General Chemical & Material Sciences (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a kind of recombinant bacterium for producing beta carotene and utilize the method for Crispr-Cas9 technology building, ku70 gene is knocked out in solution rouge Asia sieve yeast, then phytoene synthetase/lycopene cyclase (carRA) of Blakeslea trispora will be derived from, phytoene dehydrogenase (carB), from the Mang ox base Mang ox base pyrophosphate synthetase (GGS1) of solution rouge Asia sieve yeast, 3-hydroxy-3-methylglutaryl-coenzyme A reductase (tHMG) gene is integrated into the solution rouge Asia sieve Yeast genome for knocking out ku70 gene by target spot of snf；The copy number of Crispr-Cas9 technical regulation carRA, carB, GGS1, tHMG are recycled, the recombinant bacterial strain of high yield beta carotene is constructed.The fermented culture of recombinant bacterium of the present invention, and separation is extracted, content beta-carotene can achieve 35mg/g dry cell weight, and strain stability is strong.
Description
Technical field
The invention belongs to metabolic engineerings and combination biology techniques field, and in particular to a kind of to utilize Crispr-Cas9 skill
The recombinant bacterium construction method of art raising beta carotene yield.
Background technique
Beta carotene is the presence of most universal, the best Carotenoids of stability, due to its structure in nature
In there are a large amount of double bonds and have oxidation resistant function.In human body, precursor substance of the beta carotene mainly as vitamin A
(provitamin A) is the A nutritious food hardening agent that the WHO and FAO food additives joint specialist committee is assert.Study table
Bright beta carotene occurs with pre- anti-cancer, antitumor, enhancing immune function of human body effect.In addition, beta carotene can
Using the antioxidant as low-density lipoprotein (Low-density lipoprotein, LDL), and the oxidation of LDL is then and moves
The development of pulse atherosclerosis is closely bound up, therefore can be with the cardiovascular disease such as prevention of arterial atherosis by supplement beta carotene
The generation of disease.Currently, beta carotene has formally been recorded in the list of OTC medicines of American-European pharmacopeia, ministry of Health of China promulgation.
The production method of beta carotene mainly has chemical synthesis, plant extraction method, salt algae extraction and microorganism hair
Ferment method etc., wherein most method are limited vulnerable to geography, weather, time and space, make the large-scale industry system of beta carotene
It is standby more difficult.Microbe fermentation method is not limited by environmental conditions such as the place of production, illumination, weathers, in addition, product has tinting strength, tinting power
By force, the advantages such as safety and economy make the technology of microbial fermentation production natural beta-carotin by extensive concern both domestic and external.
For Crispr-Cas9 as the 3rd generation gene editing technology, people can be by Crispr-Cas9 technology to the certain bits of genome
Point carries out the various genetic manipulations such as gene targeting, gene site-directed insertion, gene repair.Compared with traditional molecular engineering, have
Many advantages, such as construction method is simple and fast, low in cost, applied widely, while it being greatly saved the time, improve work
Efficiency.
CN 105316246A discloses a kind of beta carotene high-yield strains and its application, will by gene package technique
From carB, carRP gene of the beta carotene route of synthesis of volume branch Mucor, and from Yarrowia lipolytica
THMG1, GGS1 gene introduce Yarrowia lipolytica, are configured to produce the engineering bacteria of beta carotene.The solution rouge Ye Shi ferment
Mother can utilize common carbon source and nitrogen source, and after fermented culture, beta carotene yield can reach 4.5g/L.
CN 108342445A discloses a kind of method that Blakeslea trispora fermentation produces beta carotene, mainly includes following
Step: the positive bacterium of Blakeslea trispora and the negative bacterium of Blakeslea trispora are cultivated respectively, while being inoculated with, fermenting, fermentation process is with regulator control
The pH value of fermentation system processed, Semi-continuous cultivation blowing and cooperate feed supplement when fermentation starts 60h to improve the production of beta carotene
Amount reaches 4-5g/L.
CN 108118007A discloses the method and its genetic engineering bacterium of a kind of genetic engineering bacterium production beta carotene,
Mainly comprise the steps that solving rouge yeast to Ye Luowei by gene engineering method introduces from Blakeslea trispora
(Blakeslea trispora) carRA and carB gene further enhances double fragrant youngster's base pyrophosphate synthases (GGS) and 3- hydroxyl
The expression of base -3- methyl vinyl CoA-reductase (HMG-CoAcata reductase) knocks out glycerol-3-phosphate
(gut2) with peroxidase (pox2), the Ye Luowei solution rouge yeast strain of heterogenous expression beta carotene is obtained, to mention
High beta carotene yield.
CN 104805167A discloses a kind of method for producing beta carotene and its genetic engineering bacterium, mainly include with
Lower step: include in Recombinant organism 4 external sources beta carotene synthesis gene (crtE, crtI, crtY and
CrtB) expression vector and 4 MEP pathway gene (dxs, idi, ispD and ispF) expression vectors, 4 be overexpressed in MEP approach
A enzyme constructs the MEP approach of varying strength promoter, to improve beta carotene yield.
CN 106987550A discloses a kind of recombinant bacterium for producing beta carotene and its construction method and application, main to wrap
Include following steps: building derives from phytoene synthetase/phytoene dehydrogenase, the tomato red of Blakeslea trispora
Plain cyclase, from Mang ox base Mang ox base pyrophosphate synthetase, the 3- hydroxy-3-methyl glutaryl of solution rouge Asia sieve yeast
The superpower expression module of CoA-reductase；The expression is module integrated into solution rouge Asia sieve Yeast genome, carry out fermentation training
It supports, content beta-carotene is made to reach 26mg/g DCW.
Although many reports using bacterium and yeast synthesis beta carotene existing at present, Escherichia coli can produce
Raw cytotoxin, there are food safety risks when doing expressive host production carrotene with it；Beta carotene synthesizes key enzyme
(phytoene dehydrogenase, phytoene synthetase/lycopene cyclase) activity itself is lower, in yeast into
Carrotene synthetic quantity is not high after row heterogenous expression and not can be used for industrialized bacterial strain.In addition, utilizing conventional molecular technology
It is complicated for operation that beta carotene is synthesized in yeast, low efficiency, higher cost.
Summary of the invention
The purpose of the present invention is being directed to traditional molecular engineering low efficiency, at high cost, time-consuming and existing production β-
The problem of stability existing for the method for carrotene is lower, low output provides a kind of stable high and high yield beta carotene
Recombinant bacterium, and the method for constructing the recombinant bacterium using Crispr-Cas9 technology.
For above-mentioned purpose, high yield beta carotene recombinant bacterium of the present invention is constructed to obtain by following methods:
It solves and knocks out ku70 gene in sieve yeast of rouge Asia, then will synthesize access key gene from the beta carotene of Blakeslea trispora
CarRA, carB are conciliate rouge Asia sieve yeast entogenous gene GGS1, tHMG and are integrated into the solution rouge for knocking out ku70 gene as target spot using snf
In sub- sieve Yeast genome, the copy number of Crispr-Cas9 technical regulation carRA, carB, GGS1, tHMG are recycled, is built into
Produce the recombinant bacterium of beta carotene.
The above-mentioned method that ku70 gene is knocked out in solution rouge Asia sieve yeast are as follows: to solve the gene of rouge Asia sieve yeast Po1f as mould
Plate utilizes primer with the upstream homology arm of fidelity enzyme pfu PCR amplification ku70 using primer ku70-up-F and ku70-up-R
Ku70-down-F and ku70-down-R, with the downstream homology arm of fidelity enzyme pfu PCR amplification ku70；The upstream of ku70 is homologous
Arm is inserted into ApaI the and XbaI double enzyme site of plasmid pLoxp-ura3-pLoxp, and the downstream homology arm of ku70 is inserted into matter
SpeI the and NdeI double enzyme site of grain pLoxp-ura3-pLoxp, obtains plasmid pLoxp-ura3-pLoxp- △ ku70, by this
Plasmid is transferred in solution rouge Asia sieve yeast Po1f genome with Yeast Transformation Kit, obtains the solution rouge Asia sieve ferment for knocking out ku70 gene
Mother, i.e. bacterial strain Po1f (△ ku70).
It is above-mentioned that beta carotene synthesis access key gene carRA, carB reconciliation rouge from Blakeslea trispora is sub-
Sieve yeast entogenous gene GGS1, tHMG is integrated into the solution rouge Asia sieve Yeast genome for knocking out ku70 gene by target spot of snf
Method are as follows: to solve the gene of rouge Asia sieve yeast Po1f as template, using primer snf-up-F and snf-up-R, with fidelity enzyme pfu
The upstream homology arm of PCR amplification snf, using primer snf-down-F and snf-down-R, with fidelity enzyme pfu PCR amplification snf
Downstream homology arm；The upstream homology arm of snf is inserted into ApaI the and XbaI double digestion position of plasmid pLoxp-ura3-pLoxp
The downstream homology arm of snf is inserted into SpeI the and NdeI double enzyme site of plasmid pLoxp-ura3-pLoxp by point, obtains plasmid
pLoxp-ura3-pLoxp-△snf；By plasmid opt pJN44-carRA/carB/GGS1/tHMG XbaI and SpeI double digestion
The SpeI restriction enzyme site of segment carRA/carB/GGS1/tHMG insertion plasmid pLoxp-ura3-pLoxp- △ snf afterwards, obtains
Plasmid ura3- △ snf-carRA/carB/GGS1/tHMG；With Yeast Transformation Kit by plasmid ura3- △ snf-carRA/
CarB/GGS1/tHMG is integrated into the genome of bacterial strain Po1f (△ ku70), obtains basic bacterial strain Y.L 1.1.
The method of the above-mentioned copy number using Crispr-cas9 technical regulation tHMG, GGS1 are as follows: with plasmid pJN44-tHMG
For template, using primer primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment PTEF1-tHMG-Txpr2, then use
Assembly kit is inserted into the SpeI restriction enzyme site of plasmid pJN44-tHMG, obtains plasmid pJN44-2tHMG；With plasmid
PJN44-GGS1 is template, using primer primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment PTEF1-GGS1-
Txpr2, it is then inserted into the SpeI restriction enzyme site of plasmid pJN44-2tHMG with Assembly kit, obtains plasmid pJN44-
2tHMG-GGS1；Using plasmid pJN44-2tHMG-GGS1 as template, using primer primer For and primer Rew, fidelity is used
Enzyme pfu pcr amplified fragment PTEF1-2tHMG-GGS1-Txpr2；Using the plasmid pCASyl#70007 from addgene as template,
Using primer sgRNA-up and sgRNA-down, with fidelity enzyme pfu pcr amplified fragment gut2-sgRNA, by segment gut2-
SgRNA is inserted into AvrII the and NdeI double enzyme site of the plasmid pCASyl#70007 from addgene, obtains plasmid
gut2-sgRNA-pCASyl；Using the gene for solving rouge Asia sieve yeast Po1f as template, primer gut2-up-F and gut2-up- are utilized
R uses fidelity using primer gut2-down-F and gut2-down-R with the upstream homology arm of fidelity enzyme pfu PCR amplification gut2
The downstream homology arm of enzyme pfu PCR amplification gut2, using primer gut2-up-F2 and primer Rew, with high fidelity enzyme KD-
Plus connects the upstream homology arm and segment P of gut2 by Overlap extension PCRTEF1-2tHMG-GGS1-Txpr2, recycle primer
Primer For and gut2-down-R2, the downstream for connecting gut2 by Overlap extension PCR with high fidelity enzyme KD-Plus are homologous
Arm realizes upstream homology arm-segment P of gut2TEF1-2tHMG-GGS1-Txpr2These three gene pieces of the downstream homology arm of-gut2
The connection of section, obtains segment △ gut2::2tHMG-GGS1；By plasmid gut2-sgRNA-pCASyl and segment △ gut2::
2tHMG-GGS1, into basic bacterial strain Y.L 1.1, obtains bacterial strain Y.L 1.2 with Yeast Transformation Kit corotation.
The method of the above-mentioned copy number using Crispr-Cas9 technical regulation carRA, carB are as follows: with plasmid opt
PJN44-carRA is template, using primer primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment PTEF1-carRA-
Txpr2, by segment PTEF1-carRA-Txpr2The SpeI digestion of plasmid opt pJN44-carRA is inserted into Assembly kit
Site obtains plasmid opt pJN44-2carRA；By segment PTEF1-carRA-Txpr2Plasmid is inserted into Assembly kit
The SpeI restriction enzyme site of opt pJN44-2carRA obtains plasmid opt pJN44-3carRA；With plasmid opt pJN44-carB
For template, using primer primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment PTEF1-carB-Txpr2, by segment
PTEF1-carB-Txpr2It is inserted into the SpeI restriction enzyme site of plasmid opt pJN44-3carRA with Assembly kit, obtains matter
Grain opt pJN44-3carRA-carB；By segment PTEF1-carB-Txpr2Plasmid opt is inserted into Assembly kit
The SpeI restriction enzyme site of pJN44-3carRA-carB obtains plasmid opt pJN44-3carRA-2carB；With plasmid opt
PJN44-3carRA-2carB is template, using primer primer For2 and primer Rew2, with fidelity enzyme pfu PCR amplification
Segment PTEF1-3carRA-2carB-Txpr2；Using the plasmid pCASyl#70007 from addgene as template, primer is utilized
Segment mfe-sgRNA is inserted by sgRNA-up2 and sgRNA-down2 with fidelity enzyme pfu pcr amplified fragment mfe-sgRNA
AvrII the and NdeI double enzyme site of plasmid pCASyl#70007, obtains plasmid mfe-sgRNA-pCASyl；To solve rouge Asia sieve ferment
The gene of female Po1f is template, and using primer mfe-up-F and mfe-up-R, the upstream with fidelity enzyme pfu PCR amplification mfe is same
Source arm, using primer mfe-down-F and mfe-down-R, with the downstream homology arm of fidelity enzyme pfu PCR amplification mfe, using drawing
Object mfe-up-F and primer Rew2, with high fidelity enzyme KD-Plus by Overlap extension PCR connect mfe upstream homology arm and
Segment PTEF1-3carRA-2carB-Txpr2, primer primer For2 and mfe-down-R is recycled, with high fidelity enzyme KD-Plus
The downstream homology arm that mfe is connected by Overlap extension PCR, realizes upstream homology arm-segment P of mfeTEF1-3carRA-2carB-
Txpr2The connection of these three genetic fragments of the downstream homology arm of-mfe, obtains segment △ mfe::3carRA-2carB；By plasmid
Mfe-sgRNA-pCASyl and segment △ mfe::3carRA-2carB with Yeast Transformation Kit corotation into bacterial strain Y.L 1.2,
Obtain producing the recombinant bacterium of beta carotene.
Above-mentioned each primer sequence is as follows:
Ku70-up-F:ACCGTGGGCCCCATAGGCCCATAAAGTACG
Ku70-up-R:CAGCTTCTAGATTTCAAAAAGCGGCGGT
Ku70-down-F:ACTGAACTAGTCTAGGGAGGCACATCTAA
Ku70-down-R:CTGACCATATGTATCATGGCTGAAGTTGAG
Snf-up-F:ACTGCGGGCCCGACGCAAAAGGAAGAAACAGA
Snf-up-R:GTACTTCTAGAGGAGTGGTATGTAGTCGTG
Snf-down-F:CTGACACTAGTAAACACTCCTTGGTGAACT
Snf-down-R:CATGACATATGGGAATTCGTGCAGAAGAAC
SgRNA-up:ACGCACATATGTATGGTGCACTCTCAGTACAATCTGCTC
SgRNA-down:ACGCCCCTAGGAACCATTCGAAAACCCGCGTGTTTTAGAGCTAGA AATA
SgRNA-up2:ACGCACATATGTATGGTGCACTCTCAGTACAATCTGCTC
SgRNA-down2:ACGCCCCTAGGGTTCATTGAGGATACAGAAGGTTTTAGAGCTAG AAATA
Primer1:GCTCAGATCTACTAGCTAGATAGTTTCTTTGTCTGGCCATCCG
Primer2:CCGCGAATTCACTAGTGATGCCTGACTAGTAGATCTGAGCG
Primer For:ACCACCCCAAACAATAGTTTCTTTGTCTGGCCATCCG
Primer Rew:CGCTTTTACTATACAGAGATCTGAGCGTGAATTATACGGTTAAATCT
Gut2-up-F2:CCATTTAAAATTCAAACAAAGCGCACCAC
Gut2-up-R2:CAGACAAAGAAACTATTGTTTGGGGTGGTGGGTAGG
Gut2-down-F2:TTCACGCTCAGATCTCTGTATAGTAAAAGCGTATAGCCAATAA GATAATCACT
Gut2-down-R2:CTTTGCTGCGGGGAAATAGTCC
Mfe-up-F:GGAACTATGATATCCCCTCGGAATCTTC
Mfe-up-R:AGACAAAGAAACTATTTGAGCCGAGGCAGATTTGG
Mfe-down-F:CGCTCAGATCTTGACGAGGTCTGGATGGAAGG
Mfe-down-R:GTGCACTGCTATGCAGCACAG
Above-mentioned plasmid pLoxp-ura3-pLoxp is knockout carrier, main element have AmpR, two sites loxp and
Ura3 selection markers between two sites loxp.
Plasmid opt pJN44-carRA/carB/GGS1/tHMG of the present invention, plasmid pJN44-tHMG, plasmid
PJN44-GGS1, plasmid opt pJN44-carRA, opt pJN44-carB are all in accordance with method disclosed in CN 106987550A
Building.
Compared with prior art, the invention has the benefit that
1. the present invention has knocked out ku70 gene in solution rouge Asia sieve yeast increases homologous recombination in understanding rouge Asia sieve yeast
Efficiency.
2. the present invention is by the key gene carRA/carB/GGS1/tHMG of beta carotene synthesis access using snf as target spot
It is integrated into solution rouge Asia sieve Yeast genome, constructs the basic bacterial strain for producing beta carotene.
3. the present invention makes β-carrot using the copy number of Crispr-Cas9 technical regulation carRA, carB, GGS1, tHMG
The content of element reaches 35mg/g DCW, and strain stability is strong.
Detailed description of the invention
Fig. 1 is beta carotene biosynthesis pathway schematic diagram in solution rouge Asia sieve yeast.
Specific embodiment
The present invention is described in more detail with reference to the accompanying drawings and examples, but protection scope of the present invention is not limited only to
These embodiments.
The high fidelity enzymes such as Pfu, KD-Plus used in PCR are purchased from Beijing Quanshijin Biotechnology Co., Ltd in embodiment；
Restriction enzyme enzyme is purchased from Thermo Fisher Scientific；Primer synthesis, DNA sequencing are by Beijing Nanjing Jin Sirui
Biotechnology Co., Ltd completes.
The sequence of plasmid pLoxp-ura3-pLoxp is as follows in embodiment:
GGGCGAATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCGGCCGCGGGAATTCGATCGCGGTCTA
GAATAACTTCGTATAATGTATGCTATACGAAGTTATGACTGGCCAAACTGATCTCAAGACTTTATTGAAATCAGCAA
CACCGATTCTCAATGAAGGCACATACTTCTTCTGCAACATTCACTTGACGCCTAAAGTTGGTGAGAAATGGACCGAC
AAGACATATTCTGCTATCCACGGACTGTTGCCTGTGTCGGTGGCTACAATACGTGAGTCAGAAGGGCTGACGGTGGT
GGTTCCCAAGGAAAAGGTCGACGAGTATCTGTCTGACTCGTCATTGCCGCCTTTGGAGTACGACTCCAACTATGAGT
GTGCTTGGATCACTTTGACGATACATTCTTCGTTGGAGGCTGTGGGTCTGACAGCTGCGTTTTCGGCGCGGTTGGCC
GACAACAATATCAGCTGCAACGTCATTGCTGGCTTTCATCATGATCACATTTTTGTCGGCAAAGGCGACGCCCAGAG
AGCCATTGACGTTCTTTCTAATTTGGACCGATAGCCGTATAGTCCAGTCTATCTATAAGTTCAACTAACTCGTAACT
ATTACCATAACATATACTTCACTGCCCCAGATAAGGTTCCGATAAAAAGTTCTGCAGACTAAATTTATTTCAGTCTC
CTCTTCACCACCAAAATGCCCTCCTACGAAGCTCGAGCTAACGTCCACAAGTCCGCCTTTGCCGCTCGAGTGCTCAA
GCTCGTGGCAGCCAAGAAAACCAACCTGTGTGCTTCTCTGGATGTTACCACCACCAAGGAGCTCATTGAGCTTGCCG
ATAAGGTCGGACCTTATGTGTGCATGATCAAAACCCATATCGACATCATTGACGACTTCACCTACGCCGGCACTGTG
CTCCCCCTCAAGGAACTTGCTCTTAAGCACGGTTTCTTCCTGTTCGAGGACAGAAAGTTCGCAGATATTGGCAACAC
TGTCAAGCACCAGTACCGGTGTCACCGAATCGCCGAGTGGTCCGATATCACCAACGCCCACGGTGTACCCGGAACCG
GAATCATTGCTGGCCTGCGAGCTGGTGCCGAGGAAACTGTCTCTGAACAGAAGAAGGAGGACGTCTCTGACTACGAG
AACTCCCAGTACAAGGAGTTCCTAGTCCCCTCTCCCAACGAGAAGCTGGCCAGAGGTCTGCTCATGCTGGCCGAGCT
GTCTTGCAAGGGCTCTCTGGCCACTGGCGAGTACTCCAAGCAGACCATTGAGCTTGCCCGATCCGACCCCGAGTTTG
TGGTTGGCTTCATTGCCCAGAACCGACCTAAGGGCGACTCTGAGGACTGGCTTATTCTGACCCCCGGGGTGGGTCTT
GACGACAAGGGAGACGCTCTCGGACAGCAGTACCGAACTGTTGAGGATGTCATGTCTACCGGAACGGATATCATAAT
TGTCGGCCGAGGTCTGTACGGCCAGAACCGAGATCCTATTGAGGAGGCCAAGCGATACCAGAAGGCTGGCTGGGAGG
CTTACCAGAAGATTAACTGTTAGAGGTTAGACTATGGATATGTAATTTAACTGTGTATATAGAGAGCGTGCAAGTAT
GGAGCGCTTGTTCAGCTTGTATGATGGTCAGACGACCTGTCTGATCGAGTATGTATGATACTGCACAACCTGTGTAT
CCGCATGATCTGTCCAATGGGGCATGTTGTTGTGTTTCTCGATACGGAGATGCTGGGTACAGTGCTAATACGTTGAA
CTACTTATACTTATATGAGGCTCGAAGAAAGCTGACTTGTGTATGACTTATTCTCAACTACATCCCCAGTCACAATA
CCACCACTGCACTACCACTACACCAAAACCATGATCAAACCACCCATGGACTTCCTGGAGGCAGAAGAACTTGTTAT
GGAAAAGCTCAAGAGAGAGAAGCCAAGATACTATCAAGACATGTGTCGCAACTTCAAGGAGGACCAAGCTCTGTACA
CCGAGAAACAGGCCTTTGTCGACGAAGCTCTAAAGCTGAAACGGGACATCGAAAAGTTGGAGAAGTCAATCTGGAAA
CTACACGTAGAAAACAGACACCATATAACTTCGTATAATGTATGCTATACGAAGTTATGCGCATCACTAGTGAATTC
GCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCAC
CTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACAT
ACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCAC
TGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTG
CGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGC
TCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGC
AAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA
AATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCT
CGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTT
CTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCC
GTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACT
GGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTA
ACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGT
AGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAA
AAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGA
TTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAA
AGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATT
TCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTG
CTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAG
CGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTC
GCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTT
CATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTC
GGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCT
TACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGC
GGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATC
ATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCG
TGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCG
CAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTAT
CAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATT
TCCCCGAAAAGTGCCACCTGATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTG
TAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATC
GGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACT
ATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCAC
CCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCT
TGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAG
TGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCATTCGCCATT
CAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTG
CTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAA
TACGACTCACTATA
Each primer sequence is as follows in embodiment:
Ku70-up-F:ACCGTGGGCCCCATAGGCCCATAAAGTACG
Ku70-up-R:CAGCTTCTAGATTTCAAAAAGCGGCGGT
Ku70-down-F:ACTGAACTAGTCTAGGGAGGCACATCTAA
Ku70-down-R:CTGACCATATGTATCATGGCTGAAGTTGAG
Snf-up-F:ACTGCGGGCCCGACGCAAAAGGAAGAAACAGA
Snf-up-R:GTACTTCTAGAGGAGTGGTATGTAGTCGTG
Snf-down-F:CTGACACTAGTAAACACTCCTTGGTGAACT
Snf-down-R:CATGACATATGGGAATTCGTGCAGAAGAAC
SgRNA-up:ACGCACATATGTATGGTGCACTCTCAGTACAATCTGCTC
SgRNA-down:ACGCCCCTAGGAACCATTCGAAAACCCGCGTGTTTTAGAGCTAGA AATA
SgRNA-up2:ACGCACATATGTATGGTGCACTCTCAGTACAATCTGCTC
SgRNA-down2:ACGCCCCTAGGGTTCATTGAGGATACAGAAGGTTTTAGAGCTAG AAATA
Primer1:GCTCAGATCTACTAGCTAGATAGTTTCTTTGTCTGGCCATCCG
Primer2:CCGCGAATTCACTAGTGATGCCTGACTAGTAGATCTGAGCG
Primer For:ACCACCCCAAACAATAGTTTCTTTGTCTGGCCATCCG
Primer Rew:CGCTTTTACTATACAGAGATCTGAGCGTGAATTATACGGTTAAATCT
Gut2-up-F2:CCATTTAAAATTCAAACAAAGCGCACCAC
Gut2-up-R2:CAGACAAAGAAACTATTGTTTGGGGTGGTGGGTAGG
Gut2-down-F2:TTCACGCTCAGATCTCTGTATAGTAAAAGCGTATAGCCAATAA GATAATCACT
Gut2-down-R2:CTTTGCTGCGGGGAAATAGTCC
Mfe-up-F:GGAACTATGATATCCCCTCGGAATCTTC
Mfe-up-R:AGACAAAGAAACTATTTGAGCCGAGGCAGATTTGG
Mfe-down-F:CGCTCAGATCTTGACGAGGTCTGGATGGAAGG
Mfe-down-R:GTGCACTGCTATGCAGCACAG
Embodiment 1
Beta carotene biosynthesis pathway in sieve yeast of solution rouge Asia according to figure 1, building produce beta carotene
Recombinant bacterium, specific construction method are as follows:
1. knocking out ku70 gene in solution rouge Asia sieve yeast
To solve the gene of rouge Asia sieve yeast Po1f as template, according to Overlap extension PCR design of primers principle design primer, benefit
With primer ku70-up-F and ku70-up-R, with the upstream homology arm (800bp) of fidelity enzyme pfu PCR amplification ku70, PCR amplification
System are as follows: 5 × FastPfu Buffer, 10 μ L, ku70-up-F (10 μM) 1 μ L, ku70-up-R (10 μM) 1 μ L, 2.5mM
4 μ L of dNTPs, 1 μ L of Po1f gene, 1 μ L of FastPfu DNA Polymerase, ddH2O 32μL；Utilize primer ku70-
Down-F and ku70-down-R, with the downstream homology arm (800bp) of fidelity enzyme pfu PCR amplification ku70, PCR amplification system are as follows:
5×FastPfu Buffer 10μL、ku70-down-F(10μM)1μL、ku70-down-R(10μM)1μL、2.5mM dNTPs
4 μ L, 1 μ L of Po1f gene, 1 μ L of FastPfu DNA Polymerase, ddH2O 32μL；Pcr amplification reaction program are as follows: 94 DEG C
Be denaturalized 3min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 1min totally 35 recycle after, 72 DEG C of extension 10min.
Plain agar sugar gel DNA QIAquick Gel Extraction Kit will be used to return after the upstream ku70 homology arm ApaI and XbaI double digestion
It receives, ApaI the and XbaI double enzyme site of plasmid pLoxp-ura3-pLoxp, double enzyme digestion reaction body is then connected to ligase
System are as follows: 10 × Green buffer, 5 μ L, 2 ApaI μ L, 2 XbaI μ L, the upstream ku70 homology arm/plasmid pLoxp-ura3-
pLoxp10μL、ddH231 μ L of O, reaction condition are as follows: 37 DEG C of digestion 2h；By the downstream the ku70 homology arm enzyme bis- enzymes of SpeI and NdeI
It is recycled after cutting with plain agar sugar gel DNA QIAquick Gel Extraction Kit, is then connected to plasmid pLoxp-ura3-pLoxp with ligase
SpeI and NdeI double enzyme site, double enzyme digestion reaction system are as follows: 10 × Green buffer, 5 μ L, 2 SpeI μ L, 2 NdeI μ
L, the downstream ku70 homology arm/10 μ L of plasmid pLoxp-ura3-pLoxp, ddH231 μ L of O, reaction condition are as follows: 37 DEG C of digestion 2h.
It is final to obtain plasmid pLoxp-ura3-pLoxp- △ ku70, which is integrated into solution rouge Asia sieve ferment with Yeast Transformation Kit
In female Po1f genome, the solution rouge Asia sieve yeast for knocking out ku70 gene, i.e. bacterial strain Po1f (△ ku70) are obtained.
2. producing the building of beta carotene basis bacterial strain
To solve the gene of rouge Asia sieve yeast Po1f as template, according to Overlap extension PCR design of primers principle design primer, benefit
With primer snf-up-F and snf-up-R, with the upstream homology arm (800bp) of fidelity enzyme pfu PCR amplification snf, PCR amplification body
System are as follows: 5 × FastPfu Buffer, 10 μ L, snf-up-F (10 μM) 1 μ L, snf-up-R (10 μM) 1 μ L, 2.5mM dNTPs 4
μ L, 1 μ L of Po1f gene, 1 μ L of FastPfu DNA Polymerase, ddH2O 32μL；Utilize primer snf-down-F and snf-
Down-R, with the downstream homology arm (800bp) of fidelity enzyme pfu PCR amplification snf, PCR amplification system are as follows: 5 × FastPfu
10 μ L of Buffer, snf-down-F (10 μM) 1 μ L, snf-down-R (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, Po1f gene 1
μL、FastPfu DNA Polymerase 1μL、ddH2O 32μL；Pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, 94 DEG C
Be denaturalized 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 50s totally 35 recycle after, 72 DEG C of extension 10min.The upstream snf homology arm is used
It is recycled after ApaI and XbaI double digestion with plain agar sugar gel DNA QIAquick Gel Extraction Kit, is then connected to plasmid with ligase
ApaI the and XbaI double enzyme site of pLoxp-ura3-pLoxp, double enzyme digestion reaction system are as follows: 10 × Green buffer, 5 μ L,
2 μ L of ApaI, 2 XbaI μ L, the upstream snf homology arm/10 μ L of plasmid pLoxp-ura3-pLoxp, ddH231 μ L of O, reaction condition
Are as follows: 37 DEG C of digestion 2h；Plain agar sugar gel DNA recycling examination will be used after the downstream snf homology arm enzyme SpeI and NdeI double digestion
The recycling of agent box, is then connected to SpeI the and NdeI double enzyme site of plasmid pLoxp-ura3-pLoxp, double digestion with ligase
Reaction system are as follows: 10 × Green buffer, 5 μ L, 2 SpeI μ L, 2 NdeI μ L, the downstream snf homology arm/plasmid pLoxp-
ura3-pLoxp 10μL、ddH231 μ L of O, reaction condition are as follows: 37 DEG C of digestion 2h.Finally obtain plasmid pLoxp-ura3-
pLoxp-△snf。
By plasmid opt pJN44-carRA/carB/GGS1/tHMG (according to method structure disclosed in CN 106987550A
Build) with after XbaI and SpeI double digestion, segment carRA/carB/GGS1/ is recycled with plain agar sugar gel DNA QIAquick Gel Extraction Kit
Then the segment is connected to the SpeI single endonuclease digestion site of plasmid pLoxp-ura3-pLoxp- △ snf by tHMG with ligase, double
Endonuclease reaction system are as follows: 10 × Green buffer, 5 μ L, 2 SpeI μ L, 2 XbaI μ L, plasmid opt pJN44-carRA/
carB/GGS1/tHMG10μL、ddH231 μ L of O, reaction condition are as follows: 37 DEG C of digestion 2h；Single endonuclease digestion reaction system are as follows: 10 ×
5 μ L of Green buffer, 2 SpeI μ L, 5 FastAP μ L, 10 μ L of plasmid pLoxp-ura3-pLoxp- △ snf, ddH2O 28
μ L, reaction condition are as follows: 37 DEG C of digestion 2h.It is final to obtain plasmid ura3- △ snf-carRA/carB/GGS1/tHMG.Turned with yeast
Change the genome that plasmid ura3- △ snf-carRA/carB/GGS1/tHMG is integrated into bacterial strain Po1f (△ ku70) by kit
In, obtain basic bacterial strain Y.L 1.1.
3. increasing the content of beta carotene using Crispr-cas9 technical regulation tHMG, GGS1 copy number
With plasmid pJN44-tHMG (building of the method according to disclosed in CN106987550A) for template, according to overlap-extension PCR
PCR primer design principle design primer, using primer primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment PTEF1-
tHMG-Txpr2(2489bp), PCR amplification system are as follows: 5 × FastPfu Buffer, 10 μ L, primer1 (10 μM) 1 μ L,
Primer2 (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, plasmid pJN44-tHMG1 μ L, 1 μ of FastPfu DNA Polymerase
L、ddH232 μ L of O, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extensions
2min totally 35 circulation after, 72 DEG C of extension 10min.The segment P that will be obtainedTEF1-tHMG-Txpr2It is returned with plain agar sugar gel DNA
The SpeI restriction enzyme site for being inserted into plasmid pJN44-tHMG after kit recycles with Assembly kit is received, plasmid is obtained
pJN44-2tHMG。
With plasmid pJN44-GGS1 (building of the method according to disclosed in CN106987550A) for template, primer is utilized
Primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment PTEF1-GGS1-Txpr2(1916bp), PCR amplification system are as follows: 5
10 μ L of × FastPfu Buffer, primer1 (10 μM) 1 μ L, primer2 (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, plasmid
pJN44-GGS1 1μL、FastPfu DNA Polymerase 1μL、ddH232 μ L of O, pcr amplification reaction program are as follows: 94 DEG C of changes
Property 3min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 1min totally 35 circulation after, 72 DEG C of extension 10min.It will obtain
Segment PTEF1-GGS1-Txpr2It is inserted into after the recycling of plain agar sugar gel DNA QIAquick Gel Extraction Kit with Assembly kit
The SpeI restriction enzyme site of plasmid pJN44-2tHMG, obtains plasmid pJN44-2tHMG-GGS1.
Using plasmid pJN44-2tHMG-GGS1 as template, using primer primer For and primer Rew, with fidelity enzyme
Pfu pcr amplified fragment PTEF1-2tHMG-GGS1-Txpr2(6914bp), PCR amplification system are as follows: 5 × FastPfu Buffer 10
μ L, primer For (10 μM) 1 μ L, primer Rew (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, plasmid pJN44-2tHMG-
GGS1 1μL、FastPfu DNA Polymerase 1μL、ddH2O32 μ L, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min,
94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 3min totally 35 circulation after, 72 DEG C of extension 10min.
Using the plasmid pCASyl#70007 from addgene as template, set according to Overlap extension PCR design of primers principle
Primer is counted, using primer sgRNA-up and sgRNA-down, with fidelity enzyme pfu pcr amplified fragment gut2-sgRNA
(3280bp), PCR amplification system are as follows: 5 × FastPfu Buffer, 10 μ L, sgRNA-up (10 μM) 1 μ L, sgRNA-down (10
μM) 1 μ L, 4 μ L of 2.5mM dNTPs, 1 μ L of plasmid pCASyl#70007,1 μ L of FastPfu DNA Polymerase, ddH2O
32 μ L, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 2min totally 35
After a circulation, 72 DEG C of extension 10min.Plain agar sugar gel will be used after segment gut2-sgRNA AvrII and NdeI double digestion
The recycling of DNA QIAquick Gel Extraction Kit, is then connected to AvrII the and NdeI double enzyme site of plasmid pCASyl#70007 with ligase,
Plasmid gut2-sgRNA-pCASyl is obtained, wherein double enzyme digestion reaction system are as follows: 10 × Green buffer, 5 μ L, 2 AvrII μ
L, 2 μ L of NdeI, segment gut2-sgRNA/ plasmid pCASyl#7000710 μ L, ddH231 μ L of O, reaction condition are as follows: 37 DEG C of digestions
2h。
Using the gene for solving rouge Asia sieve yeast Po1f as template, using primer gut2-up-F2 and gut2-up-R2, fidelity is used
The upstream homology arm (100bp) of enzyme pfu PCR amplification gut2, PCR amplification system are as follows: 5 × FastPfu Buffer, 10 μ L,
Gut2-up-F2 (10 μM) 1 μ L, gut2-up-R2 (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, 1 μ L of Po1f gene, FastPfu
DNA Polymerase 1μL、ddH2O 32μL.Using primer gut2-down-F2 and gut2-down-R2, with fidelity enzyme pfu
The downstream homology arm (100bp) of PCR amplification gut2, PCR amplification system are as follows: 5 × FastPfu Buffer, 10 μ L, gut2-
Down-F2 (10 μM) 1 μ L, gut2-down-R2 (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, 1 μ L of Po1f gene, FastPfu
DNA Polymerase 1μL、ddH232 μ L of O, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, 94 DEG C of denaturation 30s, 63 DEG C
Anneal 30s, 72 DEG C of extensions 30s totally 35 recycle after, 72 DEG C of extension 10min.Using primer gut2-up-F2 and primer Rew,
The upstream homology arm and segment P of gut2 are connected by Overlap extension PCR with high fidelity enzyme KD-PlusTEF1-2tHMG-GGS1-Txpr2
(7014bp), PCR amplification system are as follows: 5 × KD Plus Buffer, 10 μ L, gut2-up-F2 (10 μM) 1 μ L, primer Rew
1 μ L of upstream homology arm, the segment P of (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, gut2TEF1-2tHMG-GGS1-Txpr2 1μL、KD
Plus DNA Polymerase 1μL、ddH2O 31μL.Then primer primer For and gut2-down-R2 is utilized, with height
Fidelity enzyme KD-Plus connects the downstream homology arm of gut2 by Overlap extension PCR, realizes upstream homology arm-segment of gut2
PTEF1-2tHMG-GGS1-Txpr2The connection of downstream homology arm (7114bp) of-gut2 these three genetic fragments, obtains segment △
Gut2::2tHMG-GGS1, PCR amplification system are as follows: 5 × KD Plus Buffer, 10 μ L, primer For (10 μM) 1 μ L,
Upstream homology arm-segment P of gut2-down-R2 (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, gut2TEF1-2tHMG-GGS1 1μ
L, the 1 μ L of downstream homology arm of gut2,1 μ L of KD Plus DNA Polymerase, ddH231 μ L of O, pcr amplification reaction program
Are as follows: after totally 35 circulations, 68 DEG C extend by 94 DEG C of denaturation 3min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 68 DEG C of extension 3min
10min.By plasmid gut2-sgRNA-pCASyl and segment △ gut2::2tHMG-GGS1 with Yeast Transformation Kit corotation into base
In plinth bacterial strain Y.L 1.1, bacterial strain Y.L 1.2 is obtained.
4. increasing the content of beta carotene using Crispr-Cas9 technical regulation carRA, carB copy number
With plasmid opt pJN44-carRA (building of the method according to disclosed in CN106987550A) for template, using drawing
Object primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment PTEF1-carRA-Txpr2(2792bp), PCR amplification system
Are as follows: 5 × FastPfu Buffer, 10 μ L, primer1 (10 μM) 1 μ L, primer2 (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs,
1 μ L of plasmid opt pJN44-carRA, 1 μ L of FastPfu DNA Polymerase, ddH232 μ L of O, pcr amplification reaction program
Are as follows: after totally 35 circulations, 72 DEG C extend by 94 DEG C of denaturation 3min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 2min
10min.The segment P that will be obtainedTEF1-carRA-Txpr2Assembly is used after being recycled with plain agar sugar gel DNA QIAquick Gel Extraction Kit
Kit is inserted into the SpeI restriction enzyme site of plasmid opt pJN44-carRA, obtains plasmid opt pJN44-2carRA；Continuing will
Segment PTEF1-carRA-Txpr2It is inserted into the SpeI restriction enzyme site of plasmid opt pJN44-2carRA with Assembly kit, obtains
To plasmid opt pJN44-3carRA.With plasmid opt pJN44-carB (building of the method according to disclosed in CN106987550A)
For template, using primer primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment PTEF1-carB-Txpr2(2687bp),
PCR amplification system are as follows: 5 × FastPfu Buffer, 10 μ L, primer1 (10 μM) 1 μ L, primer2 (10 μM) 1 μ L, 2.5mM
4 μ L of dNTPs, 1 μ L of plasmid opt pJN44-carB, 1 μ L of FastPfu DNA Polymerase, ddH232 μ L, PCR expansion of O
Increase response procedures are as follows: 94 DEG C of denaturation 3min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 2min totally 35 recycle after, 72
DEG C extend 10min.Then by segment PTEF1-carB-Txpr2It is used after being recycled with plain agar sugar gel DNA QIAquick Gel Extraction Kit
Assembly kit is inserted into the SpeI restriction enzyme site of plasmid opt pJN44-3carRA, obtains plasmid opt pJN44-
3carRA-carB；Continue segment PTEF1-carB-Txpr2Plasmid opt pJN44- is inserted into Assembly kit
The SpeI restriction enzyme site of 3carRA-carB obtains plasmid opt pJN44-3carRA-2carB.Continue with plasmid opt pJN44-
3carRA-2carB is template, using primer primer For2 and primer Rew2, with fidelity enzyme pfu pcr amplified fragment
PTEF1-3carRA-2carB-Txpr2(13735bp), PCR amplification system are as follows: 5 × FastPfu Buffer, 10 μ L, primer
For2 (10 μM) 1 μ L, primer Rew2 (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, 1 μ of plasmid pJN44-3carRA-2carB
L、FastPfu DNA Polymerase 1μL、ddH232 μ L of O, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, 94 DEG C of changes
Property 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 3min totally 35 circulation after, 72 DEG C of extension 10min.
Using the plasmid pCASyl#70007 from addgene as template, set according to Overlap extension PCR design of primers principle
Primer is counted, using primer sgRNA-up2 and sgRNA-down2, with fidelity enzyme pfu pcr amplified fragment mfe-sgRNA
(3280bp), PCR amplification system are as follows: 5 × FastPfu Buffer, 10 μ L, sgRNA-up2 (10 μM) 1 μ L, sgRNA-down2
(10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, 1 μ L of plasmid pCASyl#70007,1 μ L of FastPfu DNAPolymerase,
ddH232 μ L of O, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extensions
2min totally 35 circulation after, 72 DEG C of extension 10min.Plain agar will be used after segment mfe-sgRNA AvrII and NdeI double digestion
Sugared gel DNA QIAquick Gel Extraction Kit recycling, is then connected to AvrII the and NdeI double digestion of plasmid pCASyl#70007 with ligase
Site obtains plasmid mfe-sgRNA-pCASyl, wherein double enzyme digestion reaction system are as follows: 10 × Green buffer, 5 μ L, AvrII
2 μ L, 2 NdeI μ L, 10 μ L of segment mfe-sgRNA/ plasmid pCASyl#70007, ddH231 μ L of O, reaction condition are as follows: 37 DEG C of enzymes
Cut 2h.
To solve the gene of rouge Asia sieve yeast Po1f as template, using primer mfe-up-F and mfe-up-R, with fidelity enzyme pfu
The upstream homology arm (100bp) of PCR amplification mfe, PCR amplification system are as follows: 5 × FastPfu Buffer, 10 μ L, mfe-up-F
(10 μM) 1 μ L, mfe-up-R (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, 1 μ L of Po1f gene, FastPfu DNAPolymerase
1μL、ddH2O 32μL；Using primer mfe-down-F and mfe-down-R, the downstream with fidelity enzyme pfu PCR amplification mfe is same
Source arm (100bp), PCR amplification system are as follows: 5 × FastPfu Buffer, 10 μ L, mfe-down-F (10 μM) 1 μ L, mfe-
Down-R (10 μM) 1 μ L, 4 μ L of 2.5mM dNTPs, 1 μ L of Po1f gene, 1 μ L of FastPfu DNA Polymerase, ddH2O
32μL；Pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, 94 DEG C of denaturation 30s, 63 DEG C of annealing 30s, 72 DEG C of extension 30s totally 35
After circulation, 72 DEG C of extension 10min.Using primer mfe-up-F and primer Rew2, pass through overlapping with high fidelity enzyme KD-Plus
Extension PCR connects the upstream homology arm and segment P of mfeTEF1-3carRA-2carB-Txpr2(13835bp), PCR amplification system are as follows:
5×KD Plus Buffer 10μL、mfe-up-F(10μM)1μL、primer Rew2(10μM)1μL、2.5mM dNTPs 4μ
L, 1 μ L of upstream homology arm, the segment P of mfeTEF1-3carRA-2carB-Txpr2 1μL、KD Plus DNA Polymerase 1μ
L、ddH2O 31μL；Then primer primer For2 and mfe-down-R is utilized, is prolonged with high fidelity enzyme KD-Plus by overlapping
The downstream homology arm for stretching PCR connection mfe realizes upstream homology arm-segment P of mfeTEF1-3carRA-2carB-Txpr2- mfe's
The connection of downstream homology arm (13935bp) these three genetic fragments, obtains △ mfe::3carRA-2carB segment, PCR amplification body
System are as follows: 5 × KD Plus Buffer, 10 μ L, primer For2 (10 μM) 1 μ L, mfe-down-R (10 μM) 1 μ L, 2.5mM
Upstream homology arm-the P of 4 μ L of dNTPs, 1 μ L of downstream homology arm of mfe gene, segment mfeTEF1-3carRA-2carB-Txpr2 1μ
L、KD Plus DNA Polymerase 1μL、ddH231 μ L of O, pcr amplification reaction program are as follows: 94 DEG C of denaturation 3min, 94 DEG C of changes
Property 30s, 63 DEG C of annealing 30s, 68 DEG C of extension 4min totally 35 circulation after, 68 DEG C of extension 10min.By plasmid mfe-sgRNA-
PCASyl and segment △ mfe::3carRA-2carB is with Yeast Transformation Kit corotation into bacterial strain Y.L 1.2, obtaining producing β-Hu
The recombinant bacterium of radish element.
In order to prove beneficial effects of the present invention, inventor prepares beta carotene, specific method using above-mentioned recombinant bacterium
It is as follows:
1, first order seed culture: recombination bacteria strain monoclonal is inoculated in the test tube of the seed culture fluid containing 5mL, 30
DEG C, cultivate for 24 hours under 180rpm/min, obtain primary seed solution；Wherein seed culture fluid is added by every 100mL deionized water
2g glucose, 2g peptone, yeast powder 1g, obtain after sterilizing.
2, primary seed solution fermented and cultured: is forwarded to the 250mL shaking flask of the fermentation medium containing 50mL by 1% inoculum concentration
In, 144h is cultivated at 30 DEG C, 185rpm/min, collects bacterium solution；Wherein fermentation medium is identical as seed culture fluid.Through HPLC
Quantitative analysis, content beta-carotene are 35mg/g DCW.
Claims (6)
1. a kind of construct the method for producing the recombinant bacterium of beta carotene using Crispr-Cas9 technology, it is characterised in that: in solution rouge
Ku70 gene is knocked out in sub- sieve yeast, then will synthesize access key gene from the beta carotene of Blakeslea trispora
CarRA, carB are conciliate rouge Asia sieve yeast entogenous gene GGS1, tHMG and are integrated into the solution rouge for knocking out ku70 gene as target spot using snf
In sub- sieve Yeast genome, the copy number of Crispr-Cas9 technical regulation carRA, carB, GGS1, tHMG are recycled, is built into
Produce the recombinant bacterium of beta carotene.
2. the method that building according to claim 1 produces the recombinant bacterium of beta carotene, it is characterised in that: described in solution rouge
The method of ku70 gene is knocked out in sub- sieve yeast are as follows:
To solve the gene of rouge Asia sieve yeast Po1f as template, using primer ku70-up-F and ku70-up-R, with fidelity enzyme pfu
The upstream homology arm of PCR amplification ku70, using primer ku70-down-F and ku70-down-R, with fidelity enzyme pfu PCR amplification
The downstream homology arm of ku70；The upstream homology arm of ku70 is inserted into the bis- enzymes of ApaI and XbaI of plasmid pLoxp-ura3-pLoxp
The downstream homology arm of ku70 is inserted into SpeI the and NdeI double enzyme site of plasmid pLoxp-ura3-pLoxp, obtained by enzyme site
Plasmid pLoxp-ura3-pLoxp- △ ku70 is obtained, which is transferred to solution rouge Asia sieve yeast Po1f base with Yeast Transformation Kit
Because in group, obtaining knocking out solution rouge Asia sieve yeast of ku70 gene, i.e. bacterial strain Po1f (△ ku70)；
Above-mentioned each primer sequence is as follows:
Ku70-up-F:ACCGTGGGCCCCATAGGCCCATAAAGTACG
Ku70-up-R:CAGCTTCTAGATTTCAAAAAGCGGCGGT
Ku70-down-F:ACTGAACTAGTCTAGGGAGGCACATCTAA
Ku70-down-R:CTGACCATATGTATCATGGCTGAAGTTGAG
Above-mentioned plasmid pLoxp-ura3-pLoxp is knockout carrier, and main element has AmpR, two sites loxp and is located at
Ura3 selection markers between two sites loxp.
3. the method that building according to claim 2 produces the recombinant bacterium of beta carotene, it is characterised in that: described by source
In Blakeslea trispora beta carotene synthesis access key gene carRA, carB reconciliation rouge Asia sieve yeast entogenous gene GGS1,
THMG is integrated into the method in the solution rouge Asia sieve Yeast genome for knocking out ku70 gene using snf as target spot are as follows:
To solve the gene of rouge Asia sieve yeast Po1f as template, using primer snf-up-F and snf-up-R, with fidelity enzyme pfu PCR
The upstream homology arm for expanding snf, using primer snf-down-F and snf-down-R, under fidelity enzyme pfu PCR amplification snf
Swim homology arm；The upstream homology arm of snf is inserted into ApaI the and XbaI double enzyme site of plasmid pLoxp-ura3-pLoxp, it will
The downstream homology arm of snf is inserted into SpeI the and NdeI double enzyme site of plasmid pLoxp-ura3-pLoxp, obtains plasmid
pLoxp-ura3-pLoxp-△snf；By plasmid opt pJN44-carRA/carB/GGS1/tHMG XbaI and SpeI double digestion
The SpeI restriction enzyme site of segment carRA/carB/GGS1/tHMG insertion plasmid pLoxp-ura3-pLoxp- △ snf afterwards, obtains
Plasmid ura3- △ snf-carRA/carB/GGS1/tHMG；With Yeast Transformation Kit by plasmid ura3- △ snf-carRA/
CarB/GGS1/tHMG is integrated into the genome of bacterial strain Po1f (△ ku70), obtains basic bacterial strain Y.L 1.1；
Above-mentioned each primer sequence is as follows:
Snf-up-F:ACTGCGGGCCCGACGCAAAAGGAAGAAACAGA
Snf-up-R:GTACTTCTAGAGGAGTGGTATGTAGTCGTG
Snf-down-F:CTGACACTAGTAAACACTCCTTGGTGAACT
Snf-down-R:CATGACATATGGGAATTCGTGCAGAAGAAC.
4. the method that building according to claim 3 produces the recombinant bacterium of beta carotene, it is characterised in that utilize Crispr-
The method of the copy number of cas9 technical regulation tHMG, GGS1 are as follows:
Using plasmid pJN44-tHMG as template, using primer primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment
PTEF1-tHMG-Txpr2, it is then inserted into the SpeI restriction enzyme site of plasmid pJN44-tHMG with Assembly kit, obtains plasmid
pJN44-2tHMG；Using plasmid pJN44-GGS1 as template, using primer primer1 and primer2, expanded with fidelity enzyme pfu PCR
Increase segment PTEF1-GGS1-Txpr2, the SpeI restriction enzyme site of plasmid pJN44-2tHMG is then inserted into Assembly kit,
Obtain plasmid pJN44-2tHMG-GGS1；Using plasmid pJN44-2tHMG-GGS1 as template, using primer primer For and
Primer Rew, with fidelity enzyme pfu pcr amplified fragment PTEF1-2tHMG-GGS1-Txpr2；To derive from the plasmid of addgene
PCASyl#70007 is template, using primer sgRNA-up and sgRNA-down, with fidelity enzyme pfu pcr amplified fragment gut2-
Segment gut2-sgRNA is inserted into the bis- enzymes of AvrII and NdeI of the plasmid pCASyl#70007 from addgene by sgRNA
Enzyme site obtains plasmid gut2-sgRNA-pCASyl；Using the gene for solving rouge Asia sieve yeast Po1f as template, primer gut2- is utilized
Up-F and gut2-up-R, with the upstream homology arm of fidelity enzyme pfu PCR amplification gut2, using primer gut2-down-F and
Gut2-down-R utilizes primer gut2-up-F2 and primer with the downstream homology arm of fidelity enzyme pfu PCR amplification gut2
Rew connects the upstream homology arm and segment P of gut2 with high fidelity enzyme KD-Plus by Overlap extension PCRTEF1-2tHMG-
GGS1-Txpr2, primer primer For and gut2-down-R2 is recycled, passes through Overlap extension PCR with high fidelity enzyme KD-Plus
The downstream homology arm for connecting gut2, realizes upstream homology arm-segment P of gut2TEF1-2tHMG-GGS1-Txpr2The downstream of-gut2
The connection of these three genetic fragments of homology arm obtains segment △ gut2::2tHMG-GGS1；By plasmid gut2-sgRNA-pCASyl
Bacterial strain Y.L is obtained into basic bacterial strain Y.L 1.1 with Yeast Transformation Kit corotation with segment △ gut2::2tHMG-GGS1
1.2；
Above-mentioned each primer sequence is as follows:
SgRNA-up:ACGCACATATGTATGGTGCACTCTCAGTACAATCTGCTC
SgRNA-down:ACGCCCCTAGGAACCATTCGAAAACCCGCGTGTTTTAGAGCTAGA AATA
Primer1:GCTCAGATCTACTAGCTAGATAGTTTCTTTGTCTGGCCATCCG
Primer2:CCGCGAATTCACTAGTGATGCCTGACTAGTAGATCTGAGCG
Primer For:ACCACCCCAAACAATAGTTTCTTTGTCTGGCCATCCG
Primer Rew:CGCTTTTACTATACAGAGATCTGAGCGTGAATTATACGGTTAAATCT
Gut2-up-F2:CCATTTAAAATTCAAACAAAGCGCACCAC
Gut2-up-R2:CAGACAAAGAAACTATTGTTTGGGGTGGTGGGTAGG
Gut2-down-F2:TTCACGCTCAGATCTCTGTATAGTAAAAGCGTATAGCCAATAA GATAATCACT
Gut2-down-R2:CTTTGCTGCGGGGAAATAGTCC.
5. the method that building according to claim 4 produces the recombinant bacterium of beta carotene, it is characterised in that utilize Crispr-
The method of the copy number of cas9 technical regulation carRA, carB are as follows:
Using plasmid opt pJN44-carRA as template, using primer primer1 and primer2, with fidelity enzyme pfu PCR amplification
Segment PTEF1-carRA-Txpr2, by segment PTEF1-carRA-Txpr2Plasmid opt pJN44- is inserted into Assembly kit
The SpeI restriction enzyme site of carRA obtains plasmid opt pJN44-2carRA；By segment PTEF1-carRA-Txpr2It is tried with Assembly
Agent box is inserted into the SpeI restriction enzyme site of plasmid opt pJN44-2carRA, obtains plasmid opt pJN44-3carRA；With plasmid
Opt pJN44-carB is template, using primer primer1 and primer2, with fidelity enzyme pfu pcr amplified fragment PTEF1-
carB-Txpr2, by segment PTEF1-carB-Txpr2The SpeI of plasmid opt pJN44-3carRA is inserted into Assembly kit
Restriction enzyme site obtains plasmid opt pJN44-3carRA-carB；By segment PTEF1-carB-Txpr2It is inserted with Assembly kit
Enter the SpeI restriction enzyme site to plasmid opt pJN44-3carRA-carB, obtains plasmid opt pJN44-3carRA-2carB；With
Plasmid opt pJN44-3carRA-2carB is template, using primer primer For2 and primer Rew2, with fidelity enzyme pfu
Pcr amplified fragment PTEF1-3carRA-2carB-Txpr2；Using the plasmid pCASyl#70007 from addgene as template, utilize
Primer sgRNA-up2 and sgRNA-down2 are inserted segment mfe-sgRNA with fidelity enzyme pfu pcr amplified fragment mfe-sgRNA
Enter AvrII the and NdeI double enzyme site to plasmid pCASyl#70007, obtains plasmid mfe-sgRNA-pCASyl；To solve rouge Asia
The gene of sieve yeast Po1f is template, upper with fidelity enzyme pfu PCR amplification mfe using primer mfe-up-F and mfe-up-R
Homology arm is swum, using primer mfe-down-F and mfe-down-R, with the downstream homology arm of fidelity enzyme pfu PCR amplification mfe, benefit
With primer mfe-up-F and primer Rew2, the upstream for connecting mfe by Overlap extension PCR with high fidelity enzyme KD-Plus is homologous
Arm and segment PTEF1-3carRA-2carB-Txpr2, primer primer For2 and mfe-down-R is recycled, with high fidelity enzyme KD-
Plus connects the downstream homology arm of mfe by Overlap extension PCR, realizes upstream homology arm-segment P of mfeTEF1-3carRA-
2carB-Txpr2The connection of these three genetic fragments of the downstream homology arm of-mfe, obtains segment △ mfe::3carRA-2carB；It will
Plasmid mfe-sgRNA-pCASyl and segment △ mfe::3carRA-2carB is with Yeast Transformation Kit corotation into bacterial strain Y.L
In 1.2, the recombinant bacterium for producing beta carotene is obtained；
Above-mentioned each primer sequence is as follows:
SgRNA-up2:ACGCACATATGTATGGTGCACTCTCAGTACAATCTGCTC
SgRNA-down2:ACGCCCCTAGGGTTCATTGAGGATACAGAAGGTTTTAGAGCTAG AAATA
Primer For2:GCCTCGGCTCAAATAGTTTCTTTGTCTGGCCATCCG
Primer Rew2:CAGACCTCGTCAAGATCTGAGCGTGAATTATACGGTTAAATCT
Mfe-up-F:GGAACTATGATATCCCCTCGGAATCTTC
Mfe-up-R:AGACAAAGAAACTATTTGAGCCGAGGCAGATTTGG
Mfe-down-F:CGCTCAGATCTTGACGAGGTCTGGATGGAAGG
Mfe-down-R:GTGCACTGCTATGCAGCACAG.
6. the recombinant bacterium for the production beta carotene that the construction method of claim 1 obtains.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811543192.5A CN109666596A (en) | 2018-12-17 | 2018-12-17 | A method of it producing the recombinant bacterium of beta carotene and is constructed using Crispr-Cas9 technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811543192.5A CN109666596A (en) | 2018-12-17 | 2018-12-17 | A method of it producing the recombinant bacterium of beta carotene and is constructed using Crispr-Cas9 technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN109666596A true CN109666596A (en) | 2019-04-23 |
Family
ID=66145182
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811543192.5A Pending CN109666596A (en) | 2018-12-17 | 2018-12-17 | A method of it producing the recombinant bacterium of beta carotene and is constructed using Crispr-Cas9 technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109666596A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106987550A (en) * | 2017-05-18 | 2017-07-28 | 陕西师范大学 | A kind of recombinant bacterium for producing bata-carotene and its construction method and application |
| CN111321087A (en) * | 2020-02-21 | 2020-06-23 | 华东理工大学 | Yarrowia lipolytica gene engineering bacterium for producing β -carotene and application thereof |
| CN113652444A (en) * | 2021-07-06 | 2021-11-16 | 集美大学 | Method for constructing phaffia rhodozyma by using gene editing |
| CN117264793A (en) * | 2023-09-27 | 2023-12-22 | 陕西海斯夫生物工程有限公司 | Method for improving beta-carotene production of yarrowia lipolytica through molecular docking, engineering bacteria obtained by method, construction method and application of engineering bacteria |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2933902A1 (en) * | 2013-12-19 | 2015-06-25 | Amyris, Inc. | Methods for genomic integration |
| CN106987550A (en) * | 2017-05-18 | 2017-07-28 | 陕西师范大学 | A kind of recombinant bacterium for producing bata-carotene and its construction method and application |
-
2018
- 2018-12-17 CN CN201811543192.5A patent/CN109666596A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2933902A1 (en) * | 2013-12-19 | 2015-06-25 | Amyris, Inc. | Methods for genomic integration |
| CN106987550A (en) * | 2017-05-18 | 2017-07-28 | 陕西师范大学 | A kind of recombinant bacterium for producing bata-carotene and its construction method and application |
Non-Patent Citations (3)
| Title |
|---|
| GAO S等: "Iterative integration of multiple-copy pathway genes in Yarrowia lipolytica for heterologous β-carotene production", 《METAB ENG》 * |
| XIE D: "Integrating Cellular and Bioprocess Engineering in the Non-Conventional Yeast Yarrowia lipolytica for Biodiesel Production: A Review", 《FRONT BIOENG BIOTECHNOL》 * |
| 尹升明等: "来源于三孢布拉霉的β-胡萝卜素合成基因在耶罗维解脂酵母中的表达", 《中国医药工业杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106987550A (en) * | 2017-05-18 | 2017-07-28 | 陕西师范大学 | A kind of recombinant bacterium for producing bata-carotene and its construction method and application |
| CN111321087A (en) * | 2020-02-21 | 2020-06-23 | 华东理工大学 | Yarrowia lipolytica gene engineering bacterium for producing β -carotene and application thereof |
| CN113652444A (en) * | 2021-07-06 | 2021-11-16 | 集美大学 | Method for constructing phaffia rhodozyma by using gene editing |
| CN117264793A (en) * | 2023-09-27 | 2023-12-22 | 陕西海斯夫生物工程有限公司 | Method for improving beta-carotene production of yarrowia lipolytica through molecular docking, engineering bacteria obtained by method, construction method and application of engineering bacteria |
| CN117264793B (en) * | 2023-09-27 | 2024-03-01 | 陕西海斯夫生物工程有限公司 | Method for improving beta-carotene production of yarrowia lipolytica through molecular docking, engineering bacteria obtained by method, construction method and application of engineering bacteria |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109666596A (en) | A method of it producing the recombinant bacterium of beta carotene and is constructed using Crispr-Cas9 technology | |
| CN103981203B (en) | 5 amino-laevulic acid superior strains and its preparation method and application | |
| CN102643770B (en) | Escherichia coli for producing succinic acid by utilizing pure anaerobic growth of synthetic culture medium and application thereof | |
| CN108795789A (en) | A kind of high-yield itaconic acid Yarrowia lipolytica engineered strain and its construction method, zymotechnique and application | |
| CN104419701A (en) | Rapid assembling method of multi-fragment DNA yeast | |
| US10633658B2 (en) | Method for producing N-acetylglucosamine by co-utilizing glucose and xylose based on CRISPRi | |
| CN104651287A (en) | Engineering bacterium for synthesizing glycosylglycerol and application thereof | |
| CN111548979A (en) | Recombinant escherichia coli for synthesizing lactoyl N-neotetraose and construction method and application thereof | |
| CN107815424A (en) | A kind of Yarrowia lipolytica gene engineering bacteria for producing limonene and its application | |
| CN109486734A (en) | A kind of genetic engineering bacterium producing chondroitin and its construction method and application | |
| CN109097385B (en) | Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof | |
| CN107384847A (en) | A kind of recombinant bacterium of Efficient Conversion xylose production ethylene glycol and its application | |
| CN104894043A (en) | Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof | |
| CN100392075C (en) | Glutamine synthetase and its dedicated expression engineered bacteria and uses | |
| CN102517303B (en) | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof | |
| CN107384806A (en) | A kind of structure of schizochytrium limacinum gene expression system based on homologous recombination and application | |
| CN104789516A (en) | Synechocystis-6803 genetically engineered bacterium capable of producing 3-hydroxypropionic acid, and construction method and application thereof | |
| WO2021160827A3 (en) | Production of glycosylated product in host cells | |
| CN108611360B (en) | Lycopene-producing rhodobacter sphaeroides engineering strain and construction method thereof | |
| CN101250539B (en) | Method for preparing recombinant heat-proof beta-glucuronic acid enzyme | |
| CN104017767A (en) | Method for improving yield of 5-aminolevulinic acid by utilizing combined control strategy | |
| CN102559622A (en) | Method for high-efficiency production of recombinant lipoxygenase by using Bacillus subtilis | |
| CN105624213B (en) | A method of 2,3- butanediol is produced using microalgae for raw material | |
| CN105624212B (en) | A method of 2,3- butanediol is produced by raw material of microalgae | |
| CN106754448A (en) | A kind of restructuring yeast strains and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |