CN106282208A - Stigma Croci and Stigma Croci endogenetic fungus GGPPS gene, gene clone method and application - Google Patents

Stigma Croci and Stigma Croci endogenetic fungus GGPPS gene, gene clone method and application Download PDF

Info

Publication number
CN106282208A
CN106282208A CN201610859892.XA CN201610859892A CN106282208A CN 106282208 A CN106282208 A CN 106282208A CN 201610859892 A CN201610859892 A CN 201610859892A CN 106282208 A CN106282208 A CN 106282208A
Authority
CN
China
Prior art keywords
gene
stigma croci
cattle
cattle base
base
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201610859892.XA
Other languages
Chinese (zh)
Other versions
CN106282208B (en
Inventor
赵军
曾子金
焉兆萍
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Normal University
University of Shanghai for Science and Technology
Original Assignee
Shanghai Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Normal University filed Critical Shanghai Normal University
Priority to CN201610859892.XA priority Critical patent/CN106282208B/en
Publication of CN106282208A publication Critical patent/CN106282208A/en
Application granted granted Critical
Publication of CN106282208B publication Critical patent/CN106282208B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P27/00—Preparation of compounds containing a gibbane ring system, e.g. gibberellin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01029—Geranylgeranyl diphosphate synthase (2.5.1.29)

Abstract

The present invention relates to Stigma Croci and Stigma Croci endogenetic fungus GGPPS gene, gene clone method and application, belong to gene engineering technology field.The invention discloses cattle base cattle base pyrophosphate synthetase (Geranylgeranyl pyrophosphate synthase in the metabolic pathway of Stigma Croci and Stigma Croci endogenetic fungus, GGPPS) two genes, it has the nucleotide sequence shown in SEQ ID NO.4 and SEQ ID NO.3；Two genes have open reading frame shown in identical SEQ ID NO.1 sequence, encode the aminoacid sequence shown in SEQ ID NO.2.The albumen being demonstrated this GGPPS gene code by the reaction of color genetic complementation is to have typical GGPPS enzyme function, can be catalyzed FPP and IPP and synthesize GGPP (C20)。

Description

Stigma Croci and Stigma Croci endogenetic fungus GGPPS gene, gene clone method and application
Technical field
The invention belongs to gene engineering technology field, especially relate to a kind of Stigma Croci and Stigma Croci endogenetic fungus GGPPS Gene, gene clone method and application.
Background technology
Cattle base cattle base pyrophosphate synthetase (Geranylgeranyl pyrophosphate synthase, GGPPS) it is the key enzyme of the compou nd synthesis such as terpenoid, gibberellins, vitamin E.Cattle base cattle base pyrophosphate synthetase Isopentenyl pyrophosphate (IPP) condensation of the farnesyl pyrophosphate (FPP) and 5 carbon that can be catalyzed 15 carbon generates the cattle base of 20 carbon Geranylpyrophosphate (GGPP), GGPP is the critical precursors of terpenoid and herxheimer-liked reaction thereof, sees Fig. 1.Mesh Before, from antibacterial, fungus, algae and higher plant, all find the existence of this gene, participate in the biosynthesis of different compound.
Chinese patent CN 101475946A disclose a kind of Radix Salviae Miltiorrhizae cattle base cattle base pyrophosphate synthetase gene and The protein of its coding and application, filled up and cloned and isolated cattle base cattle base Jiao from China's Chinese medicine material Radix Salviae Miltiorrhizae The blank of phosphate synthase gene.The cattle base cattle base pyrophosphate synthetase gene of this invention can pass through genetic engineering skill Art improves the content of terpenoid active component TANSHINONES in Radix Salviae Miltiorrhizae, contributes to the quality-improving of red rooted salvia, has well application Prospect.
Chinese patent CN 102174563 A discloses a kind of method improving TANSHINONES content, uses salvia 1-deoxy-D-xylulose Sugar-5-phosphate synthase (SmDXS) gene constructed with Radix Salviae Miltiorrhizae cattle base cattle base pyrophosphate synthetase (SmGGPPS) become The plant bivalent efficient expression vector of SmDXS and SmGGPPS gene, genetic transformation Radix Salviae Miltiorrhizae blade obtains and turns SmDXS and SmGGPPS The Hairy Root Cultures of Salvia miltiorrhiza of gene.
Above-mentioned two patent research are all cattle base cattle base pyrophosphate synthetase genes in Radix Salviae Miltiorrhizae, and confirm It can participate in the biosynthesis of different compound.And for whether Stigma Croci has cattle base cattle base pyrophosphoric acid close In one-tenth enzyme and Stigma Croci in the current patent documentation of functional verification of cattle base cattle base pyrophosphate synthetase gene not It is found.
Summary of the invention
Defect that the purpose of the present invention is contemplated to overcome above-mentioned prior art to exist and in Stigma Croci and Stigma Croci are provided Raw fungus G GPPS gene, gene clone method and application.
The purpose of the present invention can be achieved through the following technical solutions:
Technical scheme one: Stigma Croci endogenetic fungus GGPPS gene, Stigma Croci endogenetic fungus GGPPS gene code are provided Protein and application thereof.
Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene order, it is following gene (a) Or gene (b):
Gene (a): there is the gene of the nucleotide sequence shown in SEQ ID No.3；
Gene (b): by the nucleotide sequence shown in SEQ ID No.3 through replacing, lacking or add one or more alkali Base and the gene with cattle base cattle base pyrophosphoric acid complex functionality that obtains.
For gene (a), 795bp to the 874bp position from ATG comprises a 80bp intron, this gene DNA Sequence has the nucleotide sequence shown in SEQ ID No.3.The cDNA full length sequence of this gene has shown in SEQ ID No.1 Nucleotide sequence.
A kind of Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene promoter, described promoter is selected From following any one group and there is the nucleotide sequence of promoter function: a, there is the nucleotide sequence shown in SEQ ID No.5； The nucleotide sequence that b and SEQ ID No.5 is complementary.
Wherein Stigma Croci endogenetic fungus biolvgical name is referred to as Cadophora luteo-olivacea., and its appointment is entitled 3P1CQ1, is saved in China Committee for Culture Collection of Microorganisms's common micro-organisms center at present, and deposit number is: CGMCC NO.11606, preservation date is: on November 24th, 2015；Preservation address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.
The cultivation of this Stigma Croci endogenetic fungus and preservation condition are that flat board preserves, and culture medium condition is: Rhizoma Solani tuber osi 200g, Fructus Vitis viniferae Sugar 20g, potassium dihydrogen phosphate 5g, anhydrous magnesium sulfate 1.46g, VB1:10mg, agar 18g, add single water that steams to 1L.
The protein of Stigma Croci endogenetic fungus GGPPS gene code, it is following protein (a) or protein (b):
Protein (a): there is the protein of the aminoacid sequence shown in SEQ ID NO.2；
Protein (b): by the aminoacid sequence shown in SEQ ID NO.2 through replacing, lacking or add one or more Aminoacid and the protein with cattle base cattle base pyrophosphoric acid complex functionality that obtains.
Stigma Croci endogenetic fungus GGPPS gene clone method is as follows:
First Stigma Croci endophytic fungal hypha genomic DNA is extracted according to CTAB method, then in NCBI GenBank GGPPS (the Geranylgeranyl pyrophosphate synthase) gene order that search homology has been reported in belonging to, according to Homology design primers F g1:5'-AAATCAGTTCTGCGACCTGTTCC-3' and Rg1:5'- CGGTCTTGTTTCCAACCATTTC-3', obtains the GGPPS gene conservative fragments of 584bp through PCR amplification.According to this 584bp base Because of sequential design 3 ' end and 5 ' end RACE special primer GSP 1:5'ATCGCCTTGGGGTTCTTCAGC 3', GSP2:5' CGACCTGTTC CAGAGGGCGATTG 3', GSP3:5'GCCAGTCTGAATAACCCTCCTGTCTT 3'.Use RACE skill The homology cloning approach of art, clones GGPPS gene 3 ' end and 5 ' end cDNA gene orders, has obtained cDNA through sequence assembly Full length sequence, as shown in SEQ ID No.1.Design ORF enzyme action primer fGGPPS:5'- GAAGATCTATGTTCCACAGCAACCGCTCAGCAC-3' and rGGPPS:5'-ATAAGAATGCGGC CGCTCA AACAGCCATCTTATCC-3', the cDNA of clone GGPPS and DNA sequence, as shown in SEQ ID No.1 and SEQ ID No.3. Bioinformatic analysis GGPPS gene order and the aminoacid sequence of coding thereof, as shown in SEQ ID No.2, Preliminary Identification should Gene.
Technical scheme two: Stigma Croci GGPPS gene is provided.
Stigma Croci cattle base cattle base pyrophosphate synthetase gene, this gene DNA sequence does not has intron, with SEQ Described in ID No.1 and SEQ ID No.3, gene ORF sequence is identical.Its cDNA open reading frame sequence has SEQ ID No.4 institute The nucleotide sequence shown.
The cloning process of Stigma Croci GGPPS gene is as follows:
Extract Stigma Croci stigma genomic DNA and RNA, with the ORF primer of Stigma Croci endogenetic fungus GGPPS gene FGGPPS:5'-GAAGATCTATGTTCCACAGCAACCGCTCAGCAC-3' and rGGPPS:5'-ATAAGAATGCGGCCGCTCA AACAGCCATCTTATCC-3', clones Stigma Croci GGPPS gene.PCR is carried out for template with the genomic DNA of Stigma Croci stigma, Clone obtains Stigma Croci GGPPS DNA sequence, as shown in SEQ ID No.4.Reverse transcription synthesis west is carried out with Stigma Croci stigma RNA The RACE-ready cDNA of Flos Carthami stigma, carries out PCR with the cDNA of Stigma Croci stigma for template, and clone obtains the cDNA of GGPPS Sequence, as shown in SEQ ID No.4, i.e. Stigma Croci coding region cDNA sequence is identical with Stigma Croci GGPPS genomic dna sequence.
Stigma Croci compares with the GGPPS nucleotide sequence of Stigma Croci endogenetic fungus, and sequence height is similar between the two, wherein opens It is identical that reading frame sequence reaches 100%.
Technical scheme three: the functional verification of Stigma Croci endogenetic fungus GGPPS gene is provided.
By construction of expression vector pTRC-CSEFggpps, import the host XL1-carrying pACCAR25 △ crtE plasmid Blue cell, reacts through color genetic complementation, it was demonstrated that this gene expression albumen has enzymatic activity, can be catalyzed GPP and IPP Synthesis GGPP (C20)。
Structure and the GGPPS function verification method of GGPPS prokaryotic expression system are as follows:
First with plasmid extraction test kit, pTRC-IPI and pMD18T-CSEFggpps is carried out plasmid extraction, with Bgl II, I two restriction endonucleases of Not complete double digestion to pMD18T-CSEFggpps plasmid and pTRC-IPI plasmid simultaneously.It is empty that glue reclaims pTRC Carrier (about 3.7kb) and ggpps gene (about 1239bp), carry out the unloaded connection with ggpps gene of pTRC with T4 ligase, turn Change XL1-Blue competent cell, thus obtain the XL1-Blue engineering bacteria carrying pTRC-CSEFggpps plasmid.Then use Plasmid extraction test kit carries out plasmid extraction to the XL1-Blue bacterial strain carrying pTRC-CSEFggpps plasmid, obtains plasmid pTRC-CSEFggpps.Utilize complementary colors (color complementation) principle, Stigma Croci endogenetic fungus will be carried The expression vector pTRC-CSEFggpps of ggpps gene is transformed into by hot activation and carries on Erwinia herbicola The expression vector pACCAR25 △ of a series of carotenoids approach related gene (including crtB, crtI, crtX, crtY, crtZ) In the XL1-Blue competent cell of crtE, it is applied to dual anti-LB flat board, then the positive colony by screening product yellow substance, i.e. Obtain and carry double-mass model: carrier pTRC-CSEFggpps and the XL1-Blue recombination engineering of pACCAR25 △ crtE.Large intestine Bacillus engineering bacteria completes the enzymes metabolism from crtE to crtX, forms zeaxanthin (yellow substance), demonstrates the egg of GGPPS coding There is the enzyme catalysis function of typical GGPPS in vain.
Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene or Stigma Croci cattle base cattle Base pyrophosphate synthetase gene participates in synthesis terpenoid by engineered means in antibacterial, fungus, algae and higher plant Compound, gibberellins or vitamin E, described terpenoid includes carotenoid.Or, Stigma Croci endogenetic fungus cattle Base cattle base pyrophosphate synthetase gene or the nucleotides sequence of Stigma Croci cattle base cattle base pyrophosphate synthetase gene The application of row sudden change.
The invention provides Stigma Croci endogenetic fungus and the gene order of Stigma Croci GGPPS and the albumen of its coding Matter, additionally provides the functional verification of Stigma Croci endogenetic fungus GGPPS gene simultaneously.By construction of expression vector pTRC- CSEFggpps, imports the host's XL1-Blue cell carrying pACCAR25 △ crtE plasmid, reacts through color genetic complementation, card This gene expression albumen bright has enzymatic activity, can be catalyzed GPP and IPP and synthesize GGPP (C20)。
Accompanying drawing explanation
Fig. 1 is the synthesis of cattle base geranylpyrophosphate and application technology route map；
Fig. 2 is that GGPPS expression vector pTRC-CSEFggpps builds schematic diagram；
Fig. 3 is to verify GGPPS function result figure by complementary colors in escherichia coli XL1-Blue cell.
Detailed description of the invention
The present invention is described in detail with specific embodiment below in conjunction with the accompanying drawings.
The extraction of embodiment 1 Stigma Croci endogenetic fungus total serum IgE
Stigma Croci endogenetic fungus biolvgical name is referred to as Cadophora luteo-olivacea., and its appointment is entitled 3P1CQ1, is saved in China Committee for Culture Collection of Microorganisms's common micro-organisms center at present, and deposit number is: CGMCC NO.11606, preservation date is: on November 24th, 2015；Preservation address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3.This west The cultivation of Flos Carthami endogenetic fungus and preservation condition are that flat board preserves, and culture medium condition is: Rhizoma Solani tuber osi 200g, glucose 20g, di(2-ethylhexyl)phosphate Hydrogen potassium 5g, anhydrous magnesium sulfate 1.46g, VB1:10mg, agar 18g, add single water that steams to 1L.
Take in the mortar that appropriate Stigma Croci endophytic fungal hypha puts into pre-cooling, pour liquid nitrogen into, be ground to rapidly powder, Adding 1ml RNAiso Plus, it is total to carry out cracking extraction by Total RNA extraction the provided method of test kit of the raw work in Shanghai RNA.Then RNA mass is identified with agarose gel electrophoresis.
The clone of embodiment 2 Stigma Croci endogenetic fungus GGPPS conservative fragments
With CTAB method extraction Stigma Croci endophytic fungal hypha genomic DNA as template, design primer with conservative region Fg1:5'-AAATCAGTTCTGCGACCTGTTCC-3' and Rg1:5'-CGGTCTTGTTTCCAACCATTTC-3' carries out PCR expansion Increasing, the reaction system of amplification is as follows: Template 1 μ L, primers F g1 (20 μMs) and each 0.5 μ L of Rg1 (20 μMs), Takara Premix Taq 25 μ L, ddH2O 22 μ L, PCR amplified band send survey after glue reclaims, connects and convert DH5 α competent cell Sequence, obtains GGPPS conservative fragments sequence.
Embodiment 3 Stigma Croci endogenetic fungus GGPPS gene 3 ' end clone
According to GGPPS conservative fragments sequential design 3 ' RACE (rapid-amplification of cDNA ends, RACE) special primer GSP2:5'CGACCTGTTC CAGAGGGCG ATTG 3'.Then with SMART RACE cDNA The experimental program that Amplification Kit (CLONTECH, USA) provides through reverse transcription synthesize 3 '-RACE cDNA and 5 '- RACE cDNA.The PCR reaction system of 3 '-RACE: Template (3 '-RACE cDNA) 4 μ L, primer Long UP (4 μMs) 1 μ L, Primer Short UP (20 μMs) 1 μ L, primer GSP2 (20 μMs) 1 μ L, 10 × Buffer 5 μ L, dNTP (2.5mM each) 4 μ L, Taq archaeal dna polymerase 25 μ L, ddH2O 9 μ L, PCR amplification condition: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 72 DEG C of extensions 3min, 5 circulations；94 DEG C of degeneration 30s, 70 DEG C of annealing 30s, 72 DEG C extend 2min, 5 circulations；94 DEG C of degeneration 30s, 68 DEG C are moved back Fire 30s, 72 DEG C extend 2min, 25 circulations；Last 72 DEG C extend 5min, 4 DEG C of insulations.PCR primer is through being connected to pMD 18-T On Vector, convert DH5 α competent cell, select positive colony, after bacterium solution PCR detects, send the 3 ' gene sequences held that check order to obtain Row.
Embodiment 4 Stigma Croci endogenetic fungus GGPPS gene 5 ' end clone
Special primer GSP1:5' according to GGPPS conservative fragments sequential design 5 ' RACE ATCGCCTTGGGGTTCTTCAGC 3', GSP3:5'GCCAGTCTGAATAACCCTCCTGTCTT 3'.The first of 5 '-RACE Wheel PCR reaction system: Template (5 '-RACE cDNA) 0.5 μ L, primer Long UP (4 μMs) 0.5 μ L, primer Short UP (20 μMs) 0.5 μ L, primer GSP3 (20 μMs) 0.5 μ L, 10 × Buffer 2.5 μ L, dNTP (2.5mM each) 2 μ L, Takara Premix Taq25 μ L, ddH2O 18.5 μ L, PCR amplification condition: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 72 DEG C of extensions 2min, 5 circulations；94 DEG C of degeneration 30s, 70 DEG C of annealing 30s, 72 DEG C extend 90s, 5 circulations；94 DEG C of degeneration 30s, 68 DEG C of annealing 30s, 72 DEG C extend 90s, 25 circulations；Last 72 DEG C extend 5min, 4 DEG C of insulations.Second takes turns PCR amplification: Template (first Wheel PCR primer dilutes 20 times) 1 μ L, primer LongUP (4 μMs) 1 μ L, primer Short UP (20 μMs) 1 μ L, primer GSP1 (20 μMs) 1 μ L, Takara Premix Taq 20 μ L, ddH20 26 μ L, PCR amplification condition is: 94 DEG C of denaturations 5min；94 DEG C of degeneration 30s, 68 DEG C of annealing 30s, 72 DEG C extend 70s, 5 circulations；94 DEG C of degeneration 30s, 66 DEG C of annealing 30s, 72 DEG C extend 70s, and 5 are followed Ring；94 DEG C of degeneration 30s, 64 DEG C of annealing 30s, 72 DEG C extend 70s, 30 circulations；Last 72 DEG C extend 5min, 4 DEG C of insulations.PCR Product, through being connected on pMD 18-T Vector, converts DH5 α competent cell, selects positive colony, after bacterium solution PCR detects Send the 5 ' gene orders held that check order to obtain.
The cDNA clone of embodiment 5 Stigma Croci endogenetic fungus GGPPS
3 ' end the RACE obtained according to clone and the cDNA gene order of 5 ' end RACE, carrying out sequence assembly, to obtain cDNA complete Long sequence information, according to two primer fGGPPS:5'-of this sequential design band restriction enzyme site GAAGATCTATGTTCCACAGCAACCGCTCAGCAC-3' and rGGPPS:5'-ATAAGAATGCGGCCGCTCA AACAGCCATCTTATCC-3', by high-fidelity enzymatic amplification ORF sequence.PCR reactant liquor forms: Template (cDNA) 0.5 μ L, Primer fGGPPS (10 μMs) 0.75 μ L, primer rGGPPS (10 μMs) 0.75 μ L, 10 × PCR Buffer 2.5 μ L, 2mM dNTPs 2.5 μ L, 25mM MgSO41.5 μ L, KOD-Plus-Neo enzyme 0.5 μ L, ddH2O 16 μ L, PCR amplification program two-step method PCR is followed Ring: 94 DEG C of denaturations 5min；94 DEG C of degeneration 15s, 68 DEG C of annealing extend 90s, 35 circulations；Last 72 DEG C extend 5min.Amplification After having reacted, electrophoresis reclaims purification, carries out end and adds A reaction.DNA after recovery purified pcr product is as template, at micro-pipe The following reactant liquor of middle preparation: Template (reclaiming DNA after purification) 10 μ L, 10 × PCR buffer 2 μ L, dATP 3 μ L, Taq archaeal dna polymerase 0.25 μ L, ddH20 4.75 μ L, are placed in 30 minutes (in PCR instrument) of 72 DEG C of reactions by the reactant liquor prepared. After reaction terminates, product reclaims, connects, it is thus achieved that carry the pMD-18T plasmid of Stigma Croci endogenetic fungus GGPPS gene, this plasmid Named pMD-18T-CSEFggpps, after converting escherichia coli, it is thus achieved that carry the pMD-18T-CSEF ggpps matter of ggpps Grain recon.After order-checking, be combined with the splicing result of 3 ' RACE and 5 ' RACE, obtain Stigma Croci endogenetic fungus GGPPS cDNA Full length sequence.The cDNA total length of this gene is 1888bp, and the opening with 1215bp (from 423bp position to 1638bp position) is read Frame, as shown in SEQ ID No.1；Encode 404 amino acid residue albumen, as shown in SEQ ID No.2.At ncbi database On carry out the BLAST of nucleotide sequence and protein sequence, find this gene on amino acid levels with in other species GGPPS has higher homology, has simultaneously and belongs to isoprene biosynthetic enzyme superfamily (Isoprenoid Biosynthesis Superfamily) domains characteristic.
The gene clone of embodiment 6 Stigma Croci endogenetic fungus GGPPS
With the genomic DNA of Stigma Croci endogenetic fungus as template, reactant liquor is formulated as follows: Template 0.5 μ L, primer FGGPPS (10 μMs) 0.75 μ L, primer rGGPPS (10 μMs) 0.75 μ L, 10 × PCR Buffer 2.5 μ L, 2mM dNTPs 2.5 μ L, 25mM MgSO41.5 μ L, KOD-Plus-Neo enzyme 0.5 μ L, ddH2O16 μ L, amplification program is two-step method: 94 DEG C of pre-changes Property 5min；94 DEG C of degeneration 15s, 68 DEG C of annealing extend 90s, 35 circulations；Last 72 DEG C extend 5min.After amplified reaction completes, Carry out electrophoresis, recovery, carry out adding A reaction.After electrophoresis is complete, carry out reclaiming, connect, convert, check order, obtain Stigma Croci endogenetic fungus The gene order of GGPPS.The a length of 1295bp of this gene DNA sequence, compared with its cDNA sequence, starts to count from ATG 795bp position is many 80bp introns to 874bp position, as shown in SEQ ID No.3.
The cDNA of embodiment 7 Stigma Croci GGPPS and genomic dna cloning
Extract Stigma Croci stigma genomic DNA and RNA, with the primer fGGPPS of Stigma Croci endogenetic fungus GGPPS gene, RGGPPS clone's Stigma Croci genomic DNA carries out GGPPS full length gene.With the genomic DNA of Stigma Croci stigma as template, PCR Reactant liquor is as follows:
Template 2 μ L, primer fGGPPS (10 μMs) 0.5 μ L, primer rGGPPS (10 μMs) 0.5 μ L, 10 × PCR Buffer 2.5 μ L, dNTPs 4 μ L, LA Taq polymerase 0.25 μ L, ddH2O 15.25 μ L, amplification program is two-step method: 94 DEG C of denaturations 5min；94 DEG C of degeneration 15s, 68 DEG C of annealing extend 90s, 35 circulations；Last 72 DEG C extend 5min.Amplified reaction After completing, carry out electrophoresis, reclaim and add A reaction.After electrophoresis is complete, carry out reclaiming, connect, convert, check order.Anti-with Stigma Croci RNA Transcribing the RACE-ready cDNA of synthesis Stigma Croci stigma, with the cDNA of Stigma Croci stigma as template, PCR reactant liquor is as follows: Template0.5 μ L, primer fGGPPS (20 μMs) 0.5 μ L, primer rGGPPS (20 μMs) 0.5 μ L, 2 × PCR Buffer for KOD FX 12.5 μ L, 2mM dNTPs 5 μ L, KOD-FX polymerase 0.5 μ L, ddH2O 5.5 μ L, PCR amplification program two-step method Circulation: 94 DEG C of denaturations 5min；94 DEG C of degeneration 15s, 68 DEG C of annealing extend 2min, 45 circulations；Last 72 DEG C extend 5min.Expand After increasing reaction completes, carry out electrophoresis, reclaim and add A reaction.After electrophoresis is complete, carry out reclaiming, connect, convert, check order.Obtain The Stigma Croci coding region cDNA sequence of 1215bp and the genomic dna sequence of same sequence, illustrate that Stigma Croci GGPPS gene does not has Intron structure, as shown in SEQ ID No.4, this gene has open reading frame shown in SEQ ID NO.1 sequence, encodes SEQ Aminoacid sequence shown in ID NO.2.By the sequence alignment of DNAMAN software, Stigma Croci enters with the GGPPS of its endogenetic fungus The comparison of row nucleotide sequence, finds that GGPPS nucleotide sequence similarity is the highest between the two, wherein the cDNA sequence phase of open reading frame 100% is reached, as it is shown in figure 1, the GGPPS of explanation endogenetic fungus GGPPS and its host plant Stigma Croci is probably homology like degree 's.
Embodiment 8 Stigma Croci endogenetic fungus GGPPS gene function is verified
The structure of 1.GGPPS prokaryotic expression system:
First with plasmid extraction test kit, pTRC-IPI and pMD18T-CSEFggpps is carried out plasmid extraction, with Bgl II, Not I the two restriction endonuclease completes double digestion to pMD18T-CSEFggpps plasmid and pTRC-IPI plasmid simultaneously.Double digestion reacts System is: Bgl II (10U/ μ L) 0.5 μ L, Not I (10U/ μ L) 0.5 μ L, plasmid 20 μ L, 10 × H Buffer 5 μ L, 0.1% BSA 5 μ L, ddH2O 19 μ L, 37 DEG C of water-bath 3h.Appropriate 10 × loading Buffer stopped reaction is added after having reacted. After electrophoresis detection, glue reclaims pTRC empty carrier (about 3.7kb) and ggpps gene (about 1239bp).PTRC is carried out with T4 ligase The unloaded coupled reaction with ggpps gene, reaction system: 10 × T4DNA ligase buffer 2.5 μ L, CSEFggpps DNA10 μ L, pTRC empty carrier DNA11.5 μ L, T4DNA ligase 1 μ L, place reaction liquid into 16 DEG C and overnight connect.Take connection After liquid converts XL1-Blue competent cell spread plate, choose monoclonal, i.e. obtain after checking and carry pTRC-CSEFggpps The XL1-Blue engineering bacteria of plasmid, as shown in Figure 2.
The structure of the XL1-Blue recombination engineering of 2.pTRC-CSEFggpps and pACCAR25 △ crtE double-mass model
First CaCl is used2The XL1-Blue competent cell of pACCAR25 △ crtE plasmid is carried in the preparation of resuspended method, then With plasmid extraction test kit, the XL1-Blue bacterial strain carrying pTRC-CSEFggpps plasmid is carried out plasmid extraction, obtain plasmid pTRC-CSEFggpps.Take the pTRC-CSEFggpps plasmid DNA of 10 μ L and carry pACCAR25 by what hot activation converted 200 μ L The XL1-Blue competent cell of △ crtE, coating is containing Amp (50 μ g/mL) and the dual anti-LB flat board of Cm (25 μ g/mL).37℃ Overnight being inverted and cultivate 12h, screening positive clone carries out complementary colors checking, i.e. obtains and carry double-mass model: carrier pTRC- The XL1-Blue recombination engineering of CSEFggpps and pACCAR25 △ crtE.
3. the preparation of color reaction genetic complementation flat board
Preparing a dual anti-flat board of LB (Amp 50 μ g/mL+Cm 25 μ g/mL) being divided into five pieces of regions, picking does not carries The XLI-Blue antibacterial of plasmid (cultivating the LB flat board at non-added with antibiotic), carry the XLI-Blue of pTRC-CSEFggpps plasmid Antibacterial (cultivate at the LB flat board containing 50mg/L Amp), the XLI-Blue antibacterial carrying pACCAR25 △ crtE plasmid (are cultivated and exist LB flat board containing 25mg/L Cm), carry pTRC+pACCAR25 △ crtE plasmid XLI-Blue antibacterial (cultivate containing 50mg/L The LB flat board of Amp and 25mg/L Cm), carry pTRC-CSEFggpps+pACCAR25 △ crtE double-mass model single bacterium colony (cultivate LB flat board containing 50mg/L Amp and 25mg/L Cm), respective zoning is put triangular in shape 10 point, 28 DEG C are fallen Put light culture about 2 days, it is thus achieved that color reaction genetic complementation flat board.On the dual anti-flat board of LB (as shown in Figure 3): XLI-Blue is thin Bacterium, due to without resistant gene, so can not grow；Carry the XLI-Blue antibacterial of pTRC-CSEFggpps plasmid, contain Cm resistant gene, but there is no Amp resistant gene, so can not grow；Only carry the XLI-of pACCAR25 △ crtE plasmid Blue antibacterial, containing Amp resistant gene, but does not has Cm resistant gene, so can not grow；Carry pTRC and pACCAR25 △ The XLI-Blue antibacterial of crtE plasmid, containing Cm and Amp resistant gene, so can grow, but does not has GGPPS gene, it is impossible to close Become zeaxanthin, show white colony；And carry the recombined engineering of pTRC-CSEFggpps and pACCAR25 △ crtE double-mass model Bacterium, can synthesize again zeaxanthin, demonstrate saffron bacterium colony at the dual anti-plated growth of LB, indicate escherichia coli work Journey bacterium can complete the enzymes metabolism from crtE to crtX, formed zeaxanthin (yellow substance, Delta Region, the right in Fig. 3, due to Tab is artwork master, demonstrates yellow in the drawings, but its actual color is yellow), demonstrate this Stigma Croci endogenetic fungus The albumen of GGPPS coding has the enzyme catalysis function of typical GGPPS.
The above-mentioned description to embodiment is to be understood that for ease of those skilled in the art and use invention. These embodiments obviously easily can be made various amendment by person skilled in the art, and described herein typically Principle is applied in other embodiments without through performing creative labour.Therefore, the invention is not restricted to above-described embodiment, ability Field technique personnel should be the present invention's according to the announcement of the present invention, the improvement made without departing from scope and amendment Within protection domain.

Claims (10)

1. a Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene, it is characterised in that it is as follows Gene (a) or gene (b):
Gene (a): there is the gene of the nucleotide sequence shown in SEQ ID No.3；
Gene (b): by the nucleotide sequence shown in SEQ ID No.3 through replacing, lack or add one or more base and The gene with cattle base cattle base pyrophosphoric acid complex functionality obtained.
A kind of Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene the most according to claim 1, It is characterized in that, the cDNA full length sequence of this gene has the nucleotide sequence shown in SEQ ID No.1.
3. a Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene promoter, it is characterised in that institute State promoter selected from following any one group and there is the nucleotide sequence of promoter function:
A, there is the nucleotide sequence shown in SEQ ID No.5；
The nucleotide sequence that b and SEQ ID No.5 is complementary.
4. a Stigma Croci endogenetic fungus, it is characterised in that biolvgical name is referred to as Cadophora luteo-olivacea., its Specifying entitled 3P1CQ1, be saved in China Committee for Culture Collection of Microorganisms's common micro-organisms center at present, preservation is compiled Number it is: CGMCC NO.11606, preservation date is: on November 24th, 2015.
5. a protein for Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene code, its feature exists In, it is following protein (a) or protein (b):
Protein (a): there is the protein of the aminoacid sequence shown in SEQ ID NO.2；
Protein (b): by the aminoacid sequence shown in SEQ ID NO.2 through replacing, lacking or add one or more amino Acid and the protein with cattle base cattle base pyrophosphoric acid complex functionality that obtains.
6. a Stigma Croci cattle base cattle base pyrophosphate synthetase gene, it is characterised in that its cDNA open reading frame Sequence has the nucleotide sequence shown in SEQ ID No.4.
7. a Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene clone method, it is characterised in that Comprise the following steps:
1) extracting Stigma Croci endophytic fungal hypha genomic DNA according to CTAB method, then in NCBI GenBank, search is same The cattle base cattle base pyrophosphate synthetase gene order that source has been reported in belonging to, designs primers F g1:5'-according to homology AAATCAGTTCTGCGACCTGTTCC-3' and Rg1:5'-CGGTCTTGTTTCCAACCATTTC-3', obtains through PCR amplification The GGPPS gene conservative fragments of 584bp；
2) according to this 584bp gene order design 3 ' end and 5 ' end RACE special primer GSP 1:5' ATCGCCTTGGGGTTCTTCAGC 3', GSP2:5'CGACCTGTTC CAGAGGGCGATTG 3', GSP3:5' GCCAGTCTGAATAACCCTCCTGTCTT–3'；
3) use the homology cloning approach of RACE technology, clone GGPPS gene 3 ' end and 5 ' end cDNA gene orders, through sequence Row splicing obtains the full length sequence of cDNA, as shown in SEQ ID No.1；
4) design ORF enzyme action primer fGGPPS:5'-GAAGATCTATGTTCCACAGCAACCGCTCAGCAC-3' and rGGPPS: 5'-ATAAGAATGCGGC CGCTCA AACAGCCATCTTATCC-3', clened cows base cattle base pyrophosphate synthetase CDNA and DNA sequence, as shown in SEQ ID No.1 and SEQ ID No.3；
5) bioinformatic analysis GGPPS gene order and the aminoacid sequence of coding thereof, as shown in SEQ ID No.2, tentatively Identify this gene.
8. a Stigma Croci cattle base cattle base pyrophosphate synthetase gene clone method, it is characterised in that include following Step:
1) extract Stigma Croci stigma genomic DNA and RNA, synthesize with Stigma Croci endogenetic fungus cattle base cattle base pyrophosphoric acid ORF primer fGGPPS:5'-GAAGATCTATGTTCCACAGCAACCGCTCAGCAC-3' and rGGPPS:5'-of enzyme gene ATAAGAATGCGGCCGCTCA AACAGCCATCTTATCC-3', clone's Stigma Croci cattle base cattle base pyrophosphoric acid synthesis Enzyme gene；
2) carrying out PCR with the genomic DNA of Stigma Croci stigma for template, clone obtains Stigma Croci cattle base cattle base Jiao's phosphorus Acid enzyme DNA sequence, as shown in SEQ ID No.4；
3) the RACE-ready cDNA of reverse transcription synthesis Stigma Croci stigma is carried out with Stigma Croci stigma RNA, with Stigma Croci stigma CDNA is that template carries out PCR, and clone obtains the cDNA sequence of GGPPS, as shown in SEQ ID No.4.
9. the application of a Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene, it is characterised in that west Flos Carthami endogenetic fungus cattle base cattle base pyrophosphate synthetase gene passes through in antibacterial, fungus, algae and higher plant Engineered means participate in synthesis terpenoid, gibberellins or vitamin E, and described terpenoid includes carotenoids Element, or the application of the nucleotide sequence mutation of Stigma Croci endogenetic fungus cattle base cattle base pyrophosphate synthetase gene.
10. the application of a Stigma Croci cattle base cattle base pyrophosphate synthetase gene, it is characterised in that Stigma Croci cattle Youngster's base cattle base pyrophosphate synthetase gene is joined by engineered means in antibacterial, fungus, algae and higher plant With synthesis terpenoid, gibberellins or vitamin E, described terpenoid includes carotenoid, or Stigma Croci cattle The application of the nucleotide sequence mutation of base cattle base pyrophosphate synthetase gene.
CN201610859892.XA 2016-09-28 2016-09-28 Crocus sativus and crocus sativus endophytic fungus GGPPS gene, gene cloning method and application Active CN106282208B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610859892.XA CN106282208B (en) 2016-09-28 2016-09-28 Crocus sativus and crocus sativus endophytic fungus GGPPS gene, gene cloning method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610859892.XA CN106282208B (en) 2016-09-28 2016-09-28 Crocus sativus and crocus sativus endophytic fungus GGPPS gene, gene cloning method and application

Publications (2)

Publication Number Publication Date
CN106282208A true CN106282208A (en) 2017-01-04
CN106282208B CN106282208B (en) 2019-12-10

Family

ID=57715863

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610859892.XA Active CN106282208B (en) 2016-09-28 2016-09-28 Crocus sativus and crocus sativus endophytic fungus GGPPS gene, gene cloning method and application

Country Status (1)

Country Link
CN (1) CN106282208B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107502614A (en) * 2017-03-22 2017-12-22 中国医学科学院药用植物研究所 A kind of screening and functional verification of the carotenoid cleavage dioxygenases encoding gene for participating in the synthesis of cape jasmine crocin
CN111534499A (en) * 2020-05-28 2020-08-14 河南大学 GGPPS directed single point mutant protein GGPPS-233
CN112358973A (en) * 2020-11-11 2021-02-12 中华人民共和国京唐港海关 Baccharomycosis strain and application thereof
CN115261233A (en) * 2021-12-14 2022-11-01 浙江中医药大学 Saffron stem rot biocontrol fungus and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101475946A (en) * 2009-01-16 2009-07-08 上海师范大学 Geranylgeranyl diphosphate synthase gene in salvia root, and encoding protein and use thereof
CN103571858A (en) * 2012-07-27 2014-02-12 中国中医科学院中药研究所 Paeonia lactiflora geranylgeranyl diphosphate synthase (PLGGPS) gene, and coded product and application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101475946A (en) * 2009-01-16 2009-07-08 上海师范大学 Geranylgeranyl diphosphate synthase gene in salvia root, and encoding protein and use thereof
CN103571858A (en) * 2012-07-27 2014-02-12 中国中医科学院中药研究所 Paeonia lactiflora geranylgeranyl diphosphate synthase (PLGGPS) gene, and coded product and application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
RYOJI NAKAUNE: "First report of a new postharvest disease of grape caused by Cadophora luteo-olivacea", 《J GEN PLANT PATHOL》 *
张蕾: "丹参牻牛儿基牻牛儿基焦磷酸合酶基因的克隆与功能研究", 《中国博士学位论文全文数据库》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107502614A (en) * 2017-03-22 2017-12-22 中国医学科学院药用植物研究所 A kind of screening and functional verification of the carotenoid cleavage dioxygenases encoding gene for participating in the synthesis of cape jasmine crocin
CN111534499A (en) * 2020-05-28 2020-08-14 河南大学 GGPPS directed single point mutant protein GGPPS-233
CN112358973A (en) * 2020-11-11 2021-02-12 中华人民共和国京唐港海关 Baccharomycosis strain and application thereof
CN112358973B (en) * 2020-11-11 2021-05-18 中华人民共和国京唐港海关 Baccharomycosis strain and application thereof
CN115261233A (en) * 2021-12-14 2022-11-01 浙江中医药大学 Saffron stem rot biocontrol fungus and application thereof
CN115261233B (en) * 2021-12-14 2023-07-18 浙江中医药大学 Biocontrol fungus for stem rot of saffron crocus and application thereof

Also Published As

Publication number Publication date
CN106282208B (en) 2019-12-10

Similar Documents

Publication Publication Date Title
CN106282208A (en) Stigma Croci and Stigma Croci endogenetic fungus GGPPS gene, gene clone method and application
CN105039381B (en) A kind of maltose induction type trehalose synthase synthesis engineering bacteria and preparation method and application
CN113621631A (en) Mevalonate kinase gene RKMK and application thereof
Lem et al. Biotechnological uses of cyanobacteria
CN104789556A (en) Method of carrying out rapid and efficient DNA combination and evolution based on synthesis of single-chain DNA library
CN110229804A (en) A kind of limonene synzyme SynLS1 and its application
CN105039374B (en) A kind of starch induction type recombined bacillus subtilis and preparation method and application
CN109706148A (en) A kind of gRNA, gRNA composition and electric shifting method for knocking out BCL11A gene or BCL11A genetic enhancer
CN109852597A (en) A kind of beta galactosidase galRBM20_1 and its preparation method and application
CN114107146B (en) Construction method and application of resistance-marker-free auxotroph bacillus subtilis
CN106520715A (en) Short-chain dehydrogenase and gene thereof, recombinant expression vector, genetically engineered bacterium and application thereof in astaxanthin chiral intermediate synthesis
CN101429517A (en) High temperature resistant xylosidase XynB1, gene encoding the enzyme and uses thereof
CN104480127B (en) Hyperthermophilic glucosides enzyme mutant and its application in prepared by Ginsenoside compound K
CN105420265A (en) Genetic engineering acetic bacteria for over-expressing ATP (Adenosine Triphosphate) enzyme as well as construction method and application thereof
CN104419709B (en) A potassium transporter gene and its encoding proteins and application in tobacco
CN102732456B (en) Organic solvent-tolerant glycosidase Fru6, its mutant and its applications
CN110106154A (en) A kind of limonene synzyme SynLS2 and its application
CN104974945B (en) A kind of saccharomyces cerevisiae of overexpression MIG1 genes and preparation method and application
CN106399218A (en) Bacillus subtilis engineering bacteria and application thereof
CN101870961A (en) Method for extracting xylitol and D-galactitol from xylose mother solution
CN101445807A (en) New and effective method for building complex carrier
CN113174397A (en) Method for efficiently synthesizing lycopene by using cell-free system
CN102952790B (en) Multifunctional cellulose as well as expression gene and application thereof
CN105802954A (en) Method for rapidly and seamlessly assembling DNA in vitro on basis of heat-proof DNA polymerase and ligase
Kwei et al. Molecular classification of commercial Spirulina strains and identification of their sulfolipid biosynthesis genes

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant