CN109097385B - Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof - Google Patents

Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof Download PDF

Info

Publication number
CN109097385B
CN109097385B CN201810835248.8A CN201810835248A CN109097385B CN 109097385 B CN109097385 B CN 109097385B CN 201810835248 A CN201810835248 A CN 201810835248A CN 109097385 B CN109097385 B CN 109097385B
Authority
CN
China
Prior art keywords
crti
gene
zwf
opt
crtc
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810835248.8A
Other languages
Chinese (zh)
Other versions
CN109097385A (en
Inventor
孟永宏
强珊
苏安平
陈芝
李颖
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shaanxi Healthful Biological Engineering Co ltd
Original Assignee
Xi'an Healthful Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Xi'an Healthful Biotechnology Co ltd filed Critical Xi'an Healthful Biotechnology Co ltd
Priority to CN201810835248.8A priority Critical patent/CN109097385B/en
Publication of CN109097385A publication Critical patent/CN109097385A/en
Application granted granted Critical
Publication of CN109097385B publication Critical patent/CN109097385B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/001—Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1022—Transferases (2.) transferring aldehyde or ketonic groups (2.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y103/00—Oxidoreductases acting on the CH-CH group of donors (1.3)
    • C12Y103/99—Oxidoreductases acting on the CH-CH group of donors (1.3) with other acceptors (1.3.99)
    • C12Y103/99031—Phytoene desaturase (lycopene-forming) (1.3.99.31)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y202/00—Transferases transferring aldehyde or ketonic groups (2.2)
    • C12Y202/01—Transketolases and transaldolases (2.2.1)
    • C12Y202/01007—1-Deoxy-D-xylulose-5-phosphate synthase (2.2.1.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y505/00—Intramolecular lyases (5.5)
    • C12Y505/01—Intramolecular lyases (5.5.1)
    • C12Y505/01018—Lycopene epsilon-cyclase (5.5.1.18)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a beta-carotene rhodobacter sphaeroides engineering strain and a construction method thereof, wherein the method comprises the steps of optimizing a lycopene cyclase gene crtY from pantoea agglomeransPaTo obtain opt crtYPaThe gene is then cloned using opt crtY containing the promoter prrnBPaGene and Pantoea agglomerans derived phytoene four-step dehydrogenase gene crtIPaGene traceless replacement of phytoene three-step dehydrogenase gene crtI endogenous to rhodobacter sphaeroides3Then knocking out the endogenous streptosporins hydroxylation enzyme gene crtC and the endogenous glucose-6-phosphate dehydrogenase gene zwf of the rhodobacter sphaeroides, and finally integrating and expressing the endogenous 1-deoxyxylulose-5-phosphate synthase gene dxs of the rhodobacter sphaeroides at the position where the zwf is knocked out to obtain the beta-carotene rhodobacter sphaeroides engineering bacteria, wherein the content of the beta-carotene can reach 30mg/g DCW after the bacterial strain is subjected to fermentation culture.

Description

Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof
Technical Field
The invention belongs to the technical field of metabolic engineering, and particularly relates to a method for constructing a beta-carotene-producing strain by utilizing metabolic engineering to transform rhodobacter sphaeroides.
Background
Beta-carotene widely exists in green vegetables such as carrots, medlar and the like and yellow and orange fruits, has stronger antioxidant activity and the capability of removing free radicals due to the unsaturated structure, can effectively improve the immunologic function of organisms, is widely applied to the fields of functional foods, medical health care, cosmetics and the like at present, and increasingly expands the international market demand.
The natural beta-carotene is mainly derived from plant extraction and microbial fermentation, but the production cost of the beta-carotene derived from plants is high due to the limitation of raw materials, and the chemically synthesized beta-carotene mostly has an all-trans structure, low biological activity and questionable safety. The microbial fermentation method is easy for large-scale sustainable production, is environment-friendly, has low cost and the like, and the production of the beta-carotene by microbial fermentation is a necessary trend along with the rapid development of modern metabolic engineering technology.
At present, the only strain for industrially producing beta-carotene is Blakeslea trispora (Blakeslea trispora), but Blakeslea trispora lacks an effective molecular operation technology, and thalli of the Blakeslea trispora are divided into positive and negative bacteria, the metabolic regulation is complex, and the fermentation of the Blakeslea trispora also has many problems, such as complex fermentation process, instability, long period and the like. Rhodobacter sphaeroides (Rhodobacter sphaeroides) as a new platform cell for the production of beta-carotene has many natural advantages: (1) rhodobacter sphaeroides belongs to photosynthetic bacteria, has a photosynthetic gene cluster, is provided with 7 carotenoid synthesis genes, and sequentially comprises crtF, crtE, crtD, crtC, crtB, crtI and crtA according to the coding sequence, so that the biosynthesis of beta-carotene is almost met; (2) the rhodobacter sphaeroides has a rich endomembrane system, is very favorable for the accumulation of a fat-soluble compound beta-carotene on a cell membrane, and meanwhile, the cell membrane is easy to fold and sink in a dark condition, so that the accumulation of the beta-carotene on the cell membrane is greatly increased; (3) the genetic manipulation method of rhodobacter sphaeroides is mature and aims atHas been previously successfully used for coenzyme Q10The large-scale fermentation production of natural compounds with high additional value, such as fatty acid, 5-aminolevulinic acid and the like lays a good foundation for further exploring the beta-carotene production by utilizing rhodobacter sphaeroides; (4) the rhodobacter sphaeroides can synthesize the carotenoid under the anaerobic illumination condition, and the production of the beta-carotene by utilizing the anaerobic photosynthetic fermentation can greatly save the fermentation cost!
Disclosure of Invention
The technical problem to be solved by the invention is to provide a rhodobacter sphaeroides engineering strain for producing beta-carotene and a construction method of the strain.
The rhodobacter sphaeroides engineering strain for solving the technical problems is constructed by the following method: firstly, lycopene cyclase gene crtY from pantoea agglomerans is optimizedPaTo obtain opt crtYPaThe gene is then cloned using opt crtY containing the promoter prrnBPaPhytoene four-step dehydrogenase gene crtI derived from gene and Pantoea agglomeransPaGene traceless replacement of endogenous phytoene three-step dehydrogenase gene crtI of rhodobacter sphaeroides3Then knocking out the endogenous streptosporins hydroxylation enzyme gene crtC and the 6-glucose phosphate dehydrogenase gene zwf of the rhodobacter sphaeroides, and finally integrating and expressing the endogenous 1-deoxyxylulose-5-phosphate synthase gene dxs of the rhodobacter sphaeroides at the position where the zwf is knocked out to obtain the beta-carotene rhodobacter sphaeroides-producing engineering bacteria.
The opt crtYPaThe nucleotide sequence of the gene is shown in SEQ ID NO. 1.
The above-mentioned use of opt crtY containing promoter prrnBPaGene and crtIPaGene traceless replacement crtI3The gene method comprises the following steps: using the primer opt-crtYPa-F and opt-crtYPa-R, PCR amplification of opt crtY containing promoter prrnB with the fidelity enzyme PfuPaA gene; using gene of Pantoea agglomerans CGMCC 1.2244 as template and primer opt-crtIPa-F and opt-crtIPa-R, the phytoene four-step dehydrogenase gene crtI of Pantoea agglomerans CGMCC 1.2244 amplified by fidelity enzyme Pfu PCRPa(ii) a Using the primer opt-crtIPaYPa-F and opt-crtIPaYPa-R, amplified opt crtY containing promoter prrnB ligated by overlap extension PCR with the high fidelity enzyme KOD-PlusPaGene and crtIPaGene to get opt crtIPaYPaA gene; using gene of rhodobacter sphaeroides ATH2.4.1 as template and primer opt-crtIPaYPa-up-F and opt-crtIPaYPa-up-R, amplification of crtI with the Fidelity enzyme PfuPCR3Upstream homology arm of gene, using primer opt-crtIPaYPadown-F and opt-crtIPaYPadown-R, amplification of crtI with the Fidelity enzyme PfuPCR3A downstream homology arm of a gene; using the primer opt-crtIPaYPa-up-F and opt-crtIPaYPa-R, ligation of amplified crtI by overlap extension PCR with the high fidelity enzyme KOD-Plus3Upstream homology arms of genes with opt crtIPaYPaGene, reuse primer opt-crtIPaYPa-up-F and opt-crtIPaYPadown-R, ligation of amplified crtI by overlap extension PCR with the high fidelity enzyme KOD-Plus3Downstream homology arms of the Gene to achieve crtI3Upstream homology arm of Gene-optctrtiPaYPaGene-crtI3The three gene segments of the downstream homologous arms of the genes are connected to obtain the delta crtI3::opt crtIPaYPaA fragment; will Δ crtI3::opt crtIPaYPaThe fragment is inserted into the EcoRI and XbaI double restriction sites of pK18mobsacB plasmid to obtain plasmid pK 18-delta crtI3::opt crtIPaYPaThe plasmid is transformed into S17-1 competence by heat shock to obtain donor strain S17-1Com delta crtI3::opt crtIPaYPaAnd carrying out parental conjugation by using rhodobacter sphaeroides as a receptor strain to obtain a strain RC 1.
The method for knocking out the endogenous streptosporine hydroxylase gene crtC of rhodobacter sphaeroides comprises the following steps: taking the gene of rhodobacter sphaeroides ATH2.4.1 as a template, amplifying the upstream homologous arm of the crtC gene by using primers crtC-up-F and crtC-up-R and Pfu PCR (polymerase chain reaction) by using a fidelity enzyme, and amplifying the downstream homologous arm of the crtC gene by using primers crtC-down-F and crtC-down-R and Pfu PCR by using a fidelity enzyme; connecting an upstream homologous arm and a downstream homologous arm of the amplified crtC gene by overlapping extension PCR by using primers crtC-up-F and crtC-down-R and using a high fidelity enzyme KOD-Plus to obtain a delta crtC fragment; inserting the delta crtC fragment into EcoRI and HindIII double restriction sites of pK18mobsacB plasmid to obtain plasmid pK 18-delta crtC, carrying out heat shock transformation on the plasmid to enter S17-1 competence to obtain donor strain S17-1Com delta crtC, and carrying out parental conjugation by taking RC1 as an acceptor strain to obtain a basic strain RC 2.
The method for knocking out the endogenous 6-phosphoglucose dehydrogenase gene zwf of rhodobacter sphaeroides comprises the following steps: taking the gene of rhodobacter sphaeroides ATH2.4.1 as a template, amplifying the upstream homologous arm of zwf gene by using primers zwf-up-F1 and zwf-up-R1 and the downstream homologous arm of zwf gene by using euzyme Pfu PCR and amplifying the upstream homologous arm of zwf gene by using primers zwf-down-F1 and zwf-down-R1 and euzyme Pfu PCR; connecting an upstream homology arm and a downstream homology arm of the amplified zwf gene by overlap extension PCR by using primers zwf-up-F1 and zwf-down-R1 and a high fidelity enzyme KOD-Plus to obtain a delta zwf fragment; inserting the delta zwf fragment into Xba I and Hind III double enzyme cutting sites of pK18mobsacB plasmid to obtain plasmid pK 18-delta zwf, carrying out heat shock transformation on the plasmid to enter S17-1 competence to obtain a donor strain S17-1Com delta zwf, and carrying out parental conjugation by taking RC2 as an acceptor strain to obtain a basic strain RC 3.
The method for integrating and expressing the endogenous 1-deoxyxylulose-5-phosphate synthase gene dxs of rhodobacter sphaeroides at the position where zwf is knocked out comprises the following steps: the gene of rhodobacter sphaeroides ATH2.4.1 is used as a template, primers dxs-F and dxs-R are used, fidelity enzyme Pfu PCR is used for amplifying the dxs gene, primers zwf-up-F2 and zwf-up-R2 are used, fidelity enzyme pfuPCR is used for amplifying the upstream homologous arm of the zwf gene, and primers zwf-down-F2 and zwf-down-R2 are used for amplifying the downstream homologous arm of the zwf gene by fidelity enzyme Pfu PCR; connecting an upstream homologous arm of the amplified zwf gene and the dxs gene by overlapping extension PCR by using primers zwf-up-F2 and dxs-R and high fidelity enzyme KOD-Plus, and connecting a downstream homologous arm of the amplified zwf gene by overlapping extension PCR by using primers zwf-up-F2 and zwf-down-R2 and high fidelity enzyme KOD-Plus to realize the connection of three gene segments of the upstream homologous arm of the zwf gene, the dxs gene and the downstream homologous arm of the zwf gene, so as to obtain a delta zwf:: dxs fragment; inserting dxs fragment into Xba I and HindIII double restriction sites of pK18mobsacB plasmid to obtain plasmid pK18- Δ zwf, carrying out heat shock transformation on the plasmid to enter S17-1 competence to obtain donor strain S17-1Com Δ zwf, carrying out parental conjugation on dxs, and using RC3 as an acceptor strain to obtain the beta-carotene rhodobacter sphaeroides engineering bacterium.
The sequences of the primers are as follows:
opt-crtYPa-F：CAACGAAAAACGCCAAGATTTCTTGGC
opt-crtYPa-R：TGTAGTTCTATTCATTCACTGCATCGCCTGCTG
opt-crtIPa-F：AGGCGATGCAGTGAATGAATAGAACT
opt-crtIPa-R：TCAAGCCAGATCCTCCAGCA
opt-crtIPaYPa-F：AGTTCGCGCCCAACGAAAAACGCCAAGATTTCTTGG
opt-crtIPaYPa-R：CAGAGGCAATCATTCAAGCCAGATCCTCCAGCAT
opt-crtIPaYPa-up-F：CCGGAATTCCTCTCGTCGGCCATCTTG
opt-crtIPaYPa-up-R：GTTTTTCGTTGGGCGCGAACTCCTGCA
opt-crtIPaYPa-down-F：GGATCTGGCTTGAATGATTGCCTCTGCCGATCT
opt-crtIPaYPa-down-R：CTAGTCTAGACGCCCGAGAAACTGTCGTAG
crtC-up-F：CCGGAATTCTCATCATGAACGGACCGCC
crtC-up-R：GGGATGTCAGGAAAAGGACACGCCGTCGATATACCA
crtC-down-F：ATCGACGGCGTGTCCTTTTCCTGACATCCCGGCC
crtC-down-R：CCCCAAGCTTGCCTTCAACACGCTCTGGAC
zwf-up-F1：CTAGTCTAGATGATCGAGATGGCGGGAGG
zwf-up-R1：GGCCTCTCAGCGGATAACCATGGGCTCTCCCGC
zwf-down-F1：GGAGAGCCCATGGTTATCCGCTGAGAGGCCGCCG
zwf-down-R1：CCCCAAGCTTGGTGATGAGGACATGGATGGC
zwf-up-F2：CTAGTCTAGATGATCGAGATGGCGGGAGGC
zwf-up-R2：GTCGGTCATGGGCTCTCCCGCTGCCT
dxs-F：GAGAGCCCATGACCGACAGACCCTGCAC
dxs-R：GGCGGCCTCTTCCGATCGCCCTCCTC
zwf-down-F2：CGATCGGAAGAGGCCGCCGGGC
zwf-down-R2：CCCCAAGCTTGGTGATGAGGACATGGATGGC
the invention has the following beneficial effects:
1. the invention optimizes the lycopene cyclase gene crtY from pantoea agglomeransPaTo obtain opt crtYPaThe gene was then transfected with optcrtY containing the promoter prrnBPaGene and Pantoea agglomerans derived phytoene four-step dehydrogenase gene crtIPaGene traceless replacement of phytoene three-step dehydrogenase gene crtI endogenous to rhodobacter sphaeroides3In rhodobacter sphaeroides, a beta-carotene synthesis pathway is constructed.
2. According to the invention, the content of beta-carotene produced by rhodobacter sphaeroides reaches 30mg/gDCW by knocking out the glucose-6-phosphate dehydrogenase gene zwf of rhodobacter sphaeroides and simultaneously integrating and expressing the 1-deoxyxylulose-5-phosphate synthase gene dxs of the MEP way of the rhodobacter sphaeroides.
3. The genetic operation of the beta-carotene producing engineering strain constructed by the invention is carried out on the chromosome of rhodobacter sphaeroides, the maintenance of resistance or nutritional deficiency is not needed, and the strain stability is strong.
Drawings
FIG. 1 is a schematic diagram of the construction of an engineering strain for biosynthesis of beta-carotene from rhodobacter sphaeroides.
Detailed Description
The invention will be further described in detail with reference to the following figures and examples, but the scope of the invention is not limited to these examples.
DNA marker (marker III, marker IV), bacterial genome DNA extraction kit, rapid plasmid small extraction kit (centrifugal column type) and common agarose gel DNA recovery kit used in the examples are all purchased from Tiangen Biochemical technology (Beijing) Co., Ltd; the enzymes of Tap and Pfu used in PCR were purchased from scientific and technological Co., Ltd, Kyoto-Takara, Beijing, and KOD-Plus, a high fidelity enzyme, was purchased from TOYOBO, Japan; restriction enzymes and pK18mobsacB plasmid were purchased from Takara; primer synthesis was done by Shanghai Invitrogen | Thermo Fisher Scientific; DNA sequencing was performed by Biotechnology Ltd, New science, Beijing Ongji.
In the examples, the sequences of the primers are as follows:
opt-crtYPa-F：CAACGAAAAACGCCAAGATTTCTTGGC
opt-crtYPa-R：TGTAGTTCTATTCATTCACTGCATCGCCTGCTG
opt-crtIPa-F：AGGCGATGCAGTGAATGAATAGAACT
opt-crtIPa-R：TCAAGCCAGATCCTCCAGCA
opt-crtIPaYPa-F：AGTTCGCGCCCAACGAAAAACGCCAAGATTTCTTGG
opt-crtIPaYPa-R：CAGAGGCAATCATTCAAGCCAGATCCTCCAGCAT
opt-crtIPaYPa-up-F：CCGGAATTCCTCTCGTCGGCCATCTTG
opt-crtIPaYPa-up-R：GTTTTTCGTTGGGCGCGAACTCCTGCA
opt-crtIPaYPa-down-F：GGATCTGGCTTGAATGATTGCCTCTGCCGATCT
opt-crtIPaYPa-down-R：CTAGTCTAGACGCCCGAGAAACTGTCGTAG
crtC-up-F：CCGGAATTCTCATCATGAACGGACCGCC
crtC-up-R：GGGATGTCAGGAAAAGGACACGCCGTCGATATACCA
crtC-down-F：ATCGACGGCGTGTCCTTTTCCTGACATCCCGGCC
crtC-down-R：CCCCAAGCTTGCCTTCAACACGCTCTGGAC
zwf-up-F1：CTAGTCTAGATGATCGAGATGGCGGGAGG
zwf-up-R1：GGCCTCTCAGCGGATAACCATGGGCTCTCCCGC
zwf-down-F1：GGAGAGCCCATGGTTATCCGCTGAGAGGCCGCCG
zwf-down-R1：CCCCAAGCTTGGTGATGAGGACATGGATGGC
zwf-up-F2：CTAGTCTAGATGATCGAGATGGCGGGAGGC
zwf-up-R2：GTCGGTCATGGGCTCTCCCGCTGCCT
dxs-F：GAGAGCCCATGACCGACAGACCCTGCAC
dxs-R：GGCGGCCTCTTCCGATCGCCCTCCTC
zwf-down-F2：CGATCGGAAGAGGCCGCCGGGC
zwf-down-R2：CCCCAAGCTTGGTGATGAGGACATGGATGGC
crtIPaYPa-S-F：CGATCATGTGCGAGATGG
crtIPaYPa-S-R：TGTTGGTGAGCTGCATGG
in the examples, the respective promoter sequences are as follows:
BBa_J95025：AAATTGTTACGGAGCCCAAAAAATCCGCTTGCGCCCGGGGCCGTCTGCTCCTAGAAACCGCTTCACCGAGACGAAGACCGGCAGCGCCGGACGGAGACGAGGGAGCGGATGACAGAAACGTCGGCCGCGACAATTGAAGATGAGGCGGACGGGATCGCTGGTTGTCTG
BBa_J95027：AGCCCAAAAAATCCGCTTGCGCCCGGGGCCGTCTGCTCCTAGAAACCGCTTCATGTGGAATTGTGAGCGCTCACAATTCCACA
BBa_J95026：AGCCCAAAAAATCCGCTTGCGCCCGGGGCCGTCTGCTCCTAGAAACCGCTTCAAATTGTGAGCGGATAACAATT
tac：TTGACAATTAATCATCGGCTCGTATAATG
prrnB：CAACGAAAAACGCCAAGATTTCTTGGCTGCGACATGAAATTGTTACGGAGCCCAAAAAATCCGC
example 1
According to the biosynthesis pathway of beta-carotene in rhodobacter sphaeroides shown in figure 1, a rhodobacter sphaeroides engineering strain for producing beta-carotene is constructed, and the specific construction method is as follows:
1. lycopene cyclase gene crtY from optimized pantoea agglomeransPaCodon and promoter of (A)
Lycopene cyclase gene crtY from Pantoea agglomeransPaObtaining opt crtY with the nucleotide sequence shown as SEQ ID NO. 1 through codon optimizationPaGenes (synthesized by Nanjing Kingsrei Biotechnology, Inc.). Will contain 5 different promoters BBa _ J95025, BBa _ J95027, BBa _ J95026. Free plasmid pInD of tac and prrnB4-opt crtYPa(synthesized by Nanjing Kingsrei Biotechnology Co., Ltd.) were respectively heat-shock transformed into S17-1 competence by the following transformation procedure: mixing 1 μ L plasmid with S17-1 competent cell gently with pipette gun, standing in ice bath for 30min, performing heat shock in metal bath at 42 deg.C for 90S, and performing ice bath for 2 min; then adding 1mL of non-antibiotic liquid LB into a super clean bench, rejuvenating at 37 ℃ and 200rpm for 45 min; taking 50 mu L of rejuvenation liquid, uniformly spreading the rejuvenation liquid on an LB solid plate containing 50 mu g/mL Km resistance, and carrying out inversion culture at 37 ℃ overnight to obtain 5 donor strains S17-1 pIND4-opt crtYPaTaking RL1 strain (Su A, Chi S, Li Y, et al. journal of agricultural and food chemistry,2018) of the subject group as a receptor strain, carrying out amphiphilic conjugation to obtain five different strains, and respectively carrying out fermentation culture on the five different strains, wherein the composition of a fermentation culture medium is as follows: 30g/L glucose, 3g/L corn steep liquor dry powder, 3g/L, NaCl 2.8.8 g/L sodium glutamate, (NH)4)2SO4 3g/L、KH2PO4 3g/L、MgSO4 6.3g/L、CaCO32g/L, 1mg/L nicotinic acid, 1mg/L thiamine nicotinate and 15 mu g/L biotin. Inoculating the strain into 50% liquid containing fermentation medium at 2%, and culturing at 34 deg.C in the dark at 150rpm for 4 days. Quantitative analysis of beta-carotene content by HPLC when opt crtYPaWhen the promoter of the gene is prrnB, the content of beta-carotene is the highest.
2. With opt crtY containing promoter prrnBPaGene and crtIPaGene traceless replacement of rhodobacter sphaeroides' own crtI3Gene
With synthetic opt crtY containing promoter prrnBPaGene (synthesized by Nanjing King-Shirui Biotechnology Co., Ltd.) as template, and primer opt-crtYPa-F and opt-crtYPa-R, PCR amplification of opt crtY containing promoter prrnB using the fidelity enzyme PfuPaThe gene and PCR amplification system is as follows: 2 Xpfu PCR mix 10. mu. L, opt-crtYPa-F(10μM)1μL、opt-crtYPa1. mu.L of-R (10. mu.M), 1. mu. L, ddH of synthetic gene (20. mu.g/. mu.L)2O7. mu.L, the reaction program is: denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 62 deg.C for 30s, and extension at 72 deg.C for 3min for 35 cycles, and extension at 72 deg.CStretching for 10 min. Recovery of amplified opt crtY containing promoter prrnB by ordinary agarose gel DNA recovery kitPaGene fragment (1259 bp); the gene of Pantoea agglomerans CGMCC 1.2244 is used as a template to design a primer opt-crtIPa-F and opt-crtIPa-R, amplification of opt crtI by means of the fidelity enzyme Pfu PCRPaThe gene and PCR amplification system is as follows: 2 Xpfu PCR mix 10. mu. L, opt-crtIPa-F(10μM)1μL、opt-crtIPa1. mu.L of-R (10. mu.M), 1. mu. L, ddH of synthetic gene (20. mu.g/. mu.L)2O7. mu.L, the reaction program is: denaturation at 94 ℃ for 3min, then denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 2min for 35 cycles, and extension at 72 ℃ for 10 min. Recovering the amplified opt crtIPaGene fragment (1480 bp); design of primer opt-crtIPaYPa-F and opt-crtIPaYPa-R, ligation of amplified opt crtY by overlap extension PCR with the high fidelity enzyme KOD-PlusPaGene and crtIPaThe gene and overlap extension PCR amplification reaction system is as follows: 10 XPCR buffer for KOD-Plus 5. mu. L, dNTPs (2mM) 5. mu. L, MgSO4(25mM)2μL、opt-crtIPaYPa-F(10μM)1.5μL、opt-crtIPaYPa-R(10μM)1.5μL、opt crtYPaGene fragment (20. mu.g/. mu.L) 2. mu.L, opt crtIPaGene fragment (20. mu.g/. mu.L) 2. mu. L, KOD-Plus (1U/. mu.L) 1. mu. L, ddH2O30 μ L, reaction program: denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 15s, annealing at 65 ℃ for 30s, and extension at 68 ℃ for 3min for 35 cycles, and extension at 68 ℃ for 10 min. Recovery of opt crtIPaYPaGene fragment (2746 bp).
Uses gene of rhodobacter sphaeroides ATH2.4.1 as template, designs primer opt-crtIPaYPa-up-F and opt-crtIPaYPa-up-R, PCR amplification of crtI Using the Fidelity enzyme Pfu3The upstream homology arm of the gene, the PCR amplification system is: 2 Xpfu PCR mix 10. mu. L, opt-crtIPaYPa-up-F(10μM)1μL、opt-crtIPaYPa1. mu.L of up-R (10. mu.M), 1. mu. L, ddH of rhodobacter sphaeroides gene (20. mu.g/. mu.L)2O7. mu.L, the reaction program is: denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 62 ℃ for 30s, and extension at 72 ℃ for 1min for 35 cycles, and extension at 72 ℃ for 10 min. Recovery of crtI3The upstream homology arm gene fragment (453 bp).
Uses gene of rhodobacter sphaeroides ATH2.4.1 as template, designs primer opt-crtIPaYPadown-F and opt-crtIPaYPadown-R, PCR amplification of crtI with the Fidelity enzyme Pfu3The PCR amplification system is as follows: 2 Xpfu PCR mix 10. mu. L, opt-crtIPaYPa-down-F(10μM)1μL、opt-crtIPaYPadown-R (10. mu.M) 1. mu.L, rhodobacter sphaeroides gene (20. mu.g/. mu.L) 1. mu. L, ddH2O7. mu.L, the reaction program is: denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 64 ℃ for 30s, and extension at 72 ℃ for 1min for 35 cycles, and extension at 72 ℃ for 10 min. Recovery of crtI by ordinary agarose gel DNA recovery kit3The downstream homology arm gene fragment (411 bp).
Using the primer opt-crtIPaYPa-up-F and opt-crtIPaYPa-R, ligation of amplified crtI by overlap extension PCR with the high fidelity enzyme KOD-Plus3Upstream homology arms of genes with opt crtIPaYPaThe gene and overlap extension PCR amplification reaction system is as follows: 10 XPCR buffer for KOD-Plus 5. mu. L, dNTPs (2mM) 5. mu. L, MgSO4(25mM)2μL、opt-crtIPaYPa-up-F(10μM)1.5μL、opt-crtIPaYPa-R(10μM)1.5μL、opt crtIPaYPaGene fragment (20. mu.g/. mu.L) 2. mu. L, crtI32. mu. L, KOD-Plus (1U/. mu.L) 1. mu. L, ddH of (20. mu.g/. mu.L)2O30 μ L, reaction program: denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 15s, annealing at 64 ℃ for 30s, and extension at 68 ℃ for 2min for 35 cycles, and extension at 68 ℃ for 10 min. Recovery of crtI3Upstream homology arm of Gene-optctrtiPaYPaThe gene is linked to the fragment. Then, the primer opt-crtI is utilizedPaYPa-up-F and crtIPaYPadown-R, amplification of crtI with the high fidelity enzyme KOD-Plus ligation3The downstream homology arm of the gene and the overlap extension PCR amplification reaction system are as follows: 10 XPCR buffer for KOD-Plus 5. mu. L, dNTPs (2mM) 5. mu. L, MgSO4(25mM)2μL、opt-crtIPaYPa-up-F(10μM)1.5μL、crtIPaYPa-down-R(10μM)1.5μL、crtI3Upstream homology arm of Gene-optctrtiPaYPaGene junction fragment (20. mu.g/. mu.L) 2. mu. L, crtI32. mu. L, KOD-Plus (1U/. mu.L) 1. mu. L, ddH2O30 μ L, reaction program: denaturation at 94 ℃ for 2min, denaturation at 94 ℃ for 15s, annealing at 64 ℃ for 30s, and extension at 68 ℃ for 150s for 30 cycles, and extension at 68 ℃ for 10 min. After the overlap extension PCR is finished, 10 mu L Taq Mix enzyme is added, after the mixture is uniformly mixed, PCR extension is continuously carried out at 72 ℃ for 30min, and crtI is recovered3Upstream homology arm of Gene-opt crtIPaYPaGene-crtI3Connecting fragments of three genes of the downstream homologous arms of the genes to obtain delta crtI3::opt crtIPaYPaAnd (3) fragment.
Will Δ crtI3::opt crtIPaYPaThe fragment was digested simultaneously with EcoRI and XbaI and then subjected to T4The ligase was ligated to EcoRI and XbaI sites of pK18mobsacB plasmid in the following system: 10 XM buffer 5 u L, EcoR I2.5 u L, XbaI 2.5.5 uL,. DELTA.crtI3::crtIPaYPa40 mu L of/pK 18mobsacB, and the reaction conditions are as follows: the enzyme is cut for 2h at 37 ℃ to obtain the plasmid pK 18-delta crtI3::opt crtIPaYPaThe plasmid is transformed into S17-1 competence by heat shock to obtain donor strain S17-1Com delta crtI3::opt crtIPaYPaPerforming parental conjugation by using rhodobacter sphaeroides as a receptor strain to obtain a strain RC1, and preserving the strain.
3. Knockout of crtC gene to block metabolic consumption pathway of beta-carotene
According to the method for constructing the strain RC in the step 1, the gene of the rhodobacter sphaeroides ATH2.4.1 is used as a template, primers crtC-up-F and crtC-up-R are used, the upstream homologous arm (427bp) of the streptosporine hydroxylase gene crtC of the rhodobacter sphaeroides is amplified by using a fidelity Pfu PCR, primers crtC-down-F and crtC-down-R are used, the downstream homologous arm (428bp) of the crtC gene is amplified by using a fidelity Pfu PCR, and the PCR amplification reaction program is as follows: denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 1min for 35 cycles, and extension at 72 ℃ for 10 min. The upstream homology arm and the downstream homology arm of the amplified crtC gene are connected by overlap extension PCR by using primers crtC-up-F and crtC-down-R and using a high fidelity enzyme KOD-Plus, and the program of the overlap extension PCR amplification reaction is as follows: denaturation at 94 ℃ for 2min, then denaturation at 94 ℃ for 15s, annealing at 60 ℃ for 30s, and extension at 68 ℃ for 60s for 35 cycles, and extension at 68 ℃ for 10min to obtain a delta crtC fragment; inserting the delta crtC fragment into EcoRI and HindIII double restriction sites of pK18mobsacB plasmid to obtain plasmid pK 18-delta crtC, carrying out heat shock transformation on the plasmid to enter S17-1 competence to obtain donor strain S17-1Com delta crtC, and carrying out parental conjugation by taking RC1 as an acceptor strain to obtain a basic strain RC 2.
4. Knockout of central metabolic pathway key gene zwf to block competition of pentose phosphate pathway for carbon source
According to the method for constructing the strain RC in the step 1, the gene of rhodobacter sphaeroides ATH2.4.1 is used as a template, an upstream homologous arm (582bp) of zwf of a glucose-6-phosphate dehydrogenase gene zwf of rhodobacter sphaeroides is PCR-amplified by using primers zwf-up-F1 and zwf-up-R1, a downstream homologous arm (639bp) of zwf gene is PCR-amplified by using primers zwf-down-F1 and zwf-down-R1 and a euzyme Pfu, and the PCR amplification reaction program is as follows: denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 66 ℃ for 30s, and extension at 72 ℃ for 1min for 35 cycles, and extension at 72 ℃ for 10 min. The upstream homology arm and the downstream homology arm of the amplified zwf gene were connected by overlap extension PCR using the primers zwf-up-F1 and zwf-down-R1 with the high fidelity enzyme KOD-Plus, and the program of the overlap extension PCR amplification reaction was: denaturation at 94 ℃ for 2min, then denaturation at 94 ℃ for 15s, annealing at 67 ℃ for 30s, and extension at 68 ℃ for 40s for 35 cycles, and extension at 68 ℃ for 10min to obtain a delta zwf fragment; inserting the delta zwf fragment into Xba I and Hind III double enzyme cutting sites of pK18mobsacB plasmid to obtain plasmid pK 18-delta zwf, carrying out heat shock transformation on the plasmid to enter S17-1 competence to obtain a donor strain S17-1Com delta zwf, and carrying out parental conjugation by taking RC2 as an acceptor strain to obtain a basic strain RC 3.
5. Integration and expression of MEP pathway rate-limiting gene dxs to improve supply of beta-carotene direct precursor
According to the method for constructing the strain RC in the step 1, the gene of the rhodobacter sphaeroides ATH2.4.1 is used as a template, primers dxs-F and dxs-R are utilized, the euzyme Pfu is used for PCR amplification of the endogenous 1-deoxyxylulose-5-phosphate synthase gene dxs (1953 bp) of the rhodobacter sphaeroides, and the PCR amplification reaction program is as follows: denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 68 deg.C for 30s, and extension at 72 deg.C for 4min for 30 cycles, and extension at 72 deg.C for 10 min. The upstream homology arm (560bp) of zwf gene is amplified by fidelity enzyme Pfu PCR by using primers zwf-up-F2 and zwf-up-R2, and the downstream homology arm (614bp) of zwf gene is amplified by fidelity enzyme pfuPCR by using primers zwf-down-F2 and zwf-down-R2, wherein the PCR amplification reaction program is as follows: denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 68 ℃ for 30s, and extension at 72 ℃ for 1min for 35 cycles, and extension at 72 ℃ for 10 min. Connecting an upstream homologous arm of an amplified zwf gene and a dxs gene by overlap extension PCR by using primers zwf-up-F2 and dxs-R and high fidelity enzyme KOD-Plus, connecting a downstream homologous arm of the amplified zwf gene by overlap extension PCR by using primers zwf-up-F2 and zwf-down-R2 and high fidelity enzyme KOD-Plus, and connecting three gene segments of the upstream homologous arm of the zwf gene, the downstream homologous arm of the dxs gene and the zwf gene by overlap extension PCR, wherein the overlap extension PCR amplification reaction program comprises the following steps: denaturation at 94 ℃ for 2min, then denaturation at 94 ℃ for 15s, annealing at 68 ℃ for 30s, and extension at 68 ℃ for 100s for 35 cycles, and extension at 68 ℃ for 10min to obtain a dxs fragment; inserting dxs fragment into Xba I and HindIII double restriction sites of pK18mobsacB plasmid to obtain plasmid pK18- Δ zwf, carrying out heat shock transformation on the plasmid to enter S17-1 competence to obtain donor strain S17-1Com Δ zwf, carrying out parental conjugation on dxs, and using RC3 as a receptor strain to obtain the beta-carotene rhodobacter sphaeroides engineering bacterium.
The inventor adopts the rhodobacter sphaeroides engineering bacteria obtained in the example 1 to carry out fermentation culture, and the fermentation medium comprises the following components: 30g/L glucose, 3g/L corn steep liquor dry powder, 3g/L, NaCl 2.8.8 g/L sodium glutamate, (NH)4)2SO4 3g/L、KH2PO43g/L、MgSO4 6.3g/L、CaCO32g/L, 1mg/L nicotinic acid, 1mg/L thiamine nicotinate and 15 mug/L biotin. The cells were inoculated at 6% inoculum size into 60% volume of fermentation medium and cultured at 34 ℃ in the dark at 150 rpm. In the early fermentation stage (0-48h) of the beta-carotene rhodobacter sphaeroides engineering bacteria, the fermentation liquid is light yellow, and then slowly turns yellow (48-96h) until the fermentation liquid is orange (96-168 h). Rhodobacter sphaeroides engineering bacteria fermentation 16When the biomass reaches 6.5g/L after 8 hours, the content of the beta-carotene is 30mg/gDCW by HPLC quantitative analysis.
Sequence listing
<110> Seawa biosciences, Inc
<120> an engineering strain for producing beta-carotene rhodobacter sphaeroides and a construction method thereof
<141> 2018-07-26
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1161
<212> DNA
<213> Erwinia herbicola
<400> 1
atgccccgct atgacctcat cctggtgggc gcgggcctcg ccaacggcct gatcgccctc 60
cgcctgcgcc agcagcgccc ctcgctgcgc atcctgctga tcgacgccga gcgcgagccc 120
ggcgccaacc acacctggtc gttccatgcg gaggacctca cggagaccca gcaccgctgg 180
atcgccccgc tcgtggtgca ccattggccg ggctatgagg tgcgcttccc ccagcgctcg 240
cgctcgctca actcgggcta tttctgcgtg acctcggagc gcttcgtgca ggtgatccgc 300
gaccgcttcg cccccgacct gctcctgaac acccgcgtgg ccggcatcgc ctcgcgcacg 360
gtgaccctgg acgacggccg cgtgctggag tcggacgcgg tgatcgacgg ccgcggctac 420
cagccggacg ccgcgctgtg catgggcttc cagtcgttcg tgggccagga gtggcagctg 480
tcggagcccc atggcctgac ggcccccatc atcatggacg ccaccgtgga ccagcaggcc 540
ggctaccgct tcgtgtattc gctcccgttc tcggccgaca ccctcctgat cgaggacacg 600
cattacatcg acaacgccac cctggagggc gaccgcgccc gccagaacat ccgcgcctat 660
gcggcccagc agggctggcg cctcgaccgc ctcctgcgcg aggagcaggg cgccctcccc 720
atcacgctca ccggcgacgt ggcggccttc tggcagaagc atgacctgcc ctgctcgggc 780
ctccgcgccg gcctgttcca tccgacgacc ggctattcgc tgcccctggc ggtggccctg 840
gcggaccgcc tggcccagat gcagaccttc acgtcggaga ccctgcacgc gacgatccag 900
cagttcgcct cgcaggcctg gcagcagcag cgcttcttcc gcatgctcaa ccgcatgctc 960
ttcctggccg gcccggcgga ccagcgctgg caggtgatgc agcgcttcta tggcctcccc 1020
gagggcctga tcgcccgctt ctatgcgggc aagctgaccc tgccggaccg cctccgcatc 1080
ctgtcgggca agccgcccgt gccggtgctg gcggccctgc aggccatcat gacgccgcat 1140
cgccagcagg cgatgcagtg a 1161

Claims (2)

1. A method for constructing beta-carotene rhodobacter sphaeroides engineering bacteria is characterized by comprising the following steps of: firstly, lycopene cyclase gene from pantoea agglomerans is optimizedcrtY Pa To obtain optcrtY Pa Gene, then using opt containing promoter prrnBcrtY Pa Gene and phytoene four-step dehydrogenase gene from Pantoea agglomeranscrtI Pa Gene traceless replacement of phytoene three-step dehydrogenase gene endogenous to rhodobacter sphaeroidescrtI 3 Then knocking out the endogenous streptosporine hydroxylase gene of rhodobacter sphaeroidescrtCAnd glucose-6-phosphate dehydrogenase genezwfFinally in knockoutzwfThe position of (a) integrates and expresses a 1-deoxyxylulose-5-phosphate synthase gene endogenous to rhodobacter sphaeroidesdxsTo obtain beta-carotene rhodobacter sphaeroides engineering bacteria;
opt abovecrtY Pa The nucleotide sequence of the gene is shown as SEQ ID NO. 1;
the use of opt containing promoter prrnB as described abovecrtY Pa Genes andcrtI Pa traceless replacement of genecrtI 3 The gene method comprises the following steps: use of the primer opt-crtY Pa -F and opt-crtY Pa -R, with a fidelity enzymePfuPCR amplification of prrn-containing promoterOpt of BcrtY Pa A gene; takes the gene of the Pantoea agglomerans CGMCC 1.2244 as a template and utilizes a primer opt-crtI Pa -F and opt-crtI Pa -R, with a fidelity enzymePfuPhytoene four-step dehydrogenase gene of PCR amplified Pantoea agglomerans CGMCC 1.2244crtI Pa (ii) a Use of the primer opt-crtI Pa Y Pa -F and opt-crtI Pa Y Pa -R, using high fidelity enzymeKOD-PlusAmplified opt containing promoter prrnB by overlap extension PCR ligationcrtY Pa Genes andcrtI Pa gene, to obtain optcrtI Pa Y Pa A gene; using the gene of rhodobacter sphaeroides ATH2.4.1 as a template and using a primer opt-crtI Pa Y Pa -up-F and opt-crtI Pa Y Pa -up-R with a fidelity enzymePfuPCR amplificationcrtI 3 Upstream homology arm of gene, using primer opt-crtI Pa Y Pa down-F and opt-crtI Pa Y Pa down-R, with a fidelity enzymePfu PCR amplificationcrtI 3 A downstream homology arm of the gene; use of the primer opt-crtI Pa Y Pa -up-F and opt-crtI Pa Y Pa -R, with high fidelity enzymesKOD-PlusAmplified by overlap extension PCR ligationcrtI 3 Upstream homology arms and opt of genescrtI Pa Y Pa Gene, reuse of primer opt-crtI Pa Y Pa up-F and opt-crtI Pa Y Pa down-R, with high fidelity enzymeKOD-PlusAmplified by overlap extension PCR ligationcrtI 3 Downstream homology arms of genes, realizationcrtI 3 Upstream homology arm-opt of GenecrtI Pa Y Pa Gene-crtI 3 Ligation of three gene fragments, the downstream homology arms of the genes, gave DeltacrtI 3 ::opt crtI Pa Y Pa A fragment; delta willcrtI 3 ::opt crtI Pa Y Pa The fragment was inserted into the EcoRI and XbaI sites of pK18mobsacB plasmid to obtain plasmid pK18- ΔcrtI 3 ::opt crtI Pa Y Pa The plasmid is transformed into S17-1 competence by heat shock to obtain a donor strain S17-1 Com△crtI 3 ::opt crtI Pa Y Pa Carrying out parental conjugation by using rhodobacter sphaeroides as a receptor strain to obtain a strain RC 1;
the endogenous streptosporine hydroxylase gene of rhodobacter sphaeroides is knocked outcrtCThe method comprises the following steps: using gene of rhodobacter sphaeroides ATH2.4.1 as template and primercrtC-up-F andcrtC-up-R, with a fidelity enzymePfuPCR amplificationcrtCUpstream homology arms of genes, using primerscrtCdown-F andcrtCdown-R, with a fidelity enzymePfuPCR amplificationcrtCA downstream homology arm of a gene; using primerscrtC-up-F withcrtCdown-R, with Hi-Fi enzymesKOD-PlusAmplified by overlap extension PCR ligationcrtCThe upstream homology arm and the downstream homology arm of the gene are used to obtain deltacrtCA fragment; will deltacrtCThe fragment was inserted into the EcoRI and HindIII sites of pK18mobsacB plasmid to obtain plasmid pK18- ΔcrtCThe plasmid is transformed into S17-1 competence by heat shock to obtain a donor strain S17-1Com△crtCCarrying out parental conjugation by taking RC1 as a receptor strain to obtain a basic strain RC 2;
up-knock out endogenous 6-phosphoglucose dehydrogenase gene of rhodobacter sphaeroideszwfThe method comprises the following steps: using gene of rhodobacter sphaeroides ATH2.4.1 as template and primerzwf-up-F1 andzwf-up-R1 using a fidelity enzymePfuPCR amplificationzwfUpstream homology arms of genes, using primerszwf-down-F1 andzwfdown-R1 using a fidelity enzymePfuPCR amplificationzwfA downstream homology arm of a gene; using primerszwf-up-F1 andzwfdown-R1 using high fidelity enzymesKOD-PlusAmplified by overlap extension PCR ligationzwfThe upstream homology arm and the downstream homology arm of the gene are used to obtain deltazwfA fragment; delta willzwfThe fragment was inserted into Xba I and HindIII sites of pK18mobsacB plasmid to obtain plasmid pK18- ΔzwfThe plasmid is transformed into S17-1 competence by heat shock to obtain a donor strain S17-1Com△zwfCarrying out parental conjugation by taking RC2 as a receptor strain to obtain a basic strain RC 3;
the above-mentioned in-situ knock-outzwfThe position of (a) integrates and expresses a 1-deoxyxylulose-5-phosphate synthase gene endogenous to rhodobacter sphaeroidesdxsThe method comprises the following steps: using gene of rhodobacter sphaeroides ATH2.4.1 as template and primerdxs-F anddxs-R, with a fidelity enzymePfuPCR amplificationdxsGene using a primerzwf-up-F2 andzwf-up-R2 using a fidelity enzymePfuPCR amplificationzwfUpstream homology arms of genes, using primerszwfdown-F2 andzwfdown-R2 using a fidelity enzymePfuClass of PCR amplificationzwfA downstream homology arm of the gene; using primerszwf-up-F2 anddxs-R, with high fidelity enzymesKOD-PlusAmplified by overlap extension PCR ligationzwfUpstream homology arms of genes anddxsgene, reuse primerzwf-up-F2 andzwfdown-R2 using high fidelity enzymesKOD-PlusAmplified by overlap extension PCR ligationzwfDownstream homology arms of genes, realizationzwfUpstream homology arm of genes-dxsGene-zwfLigation of three gene fragments, the downstream homology arms of the genes, gave Deltazwf::dxsA fragment; delta willzwf::dxsThe fragment was inserted into Xba I and HindIII sites of pK18mobsacB plasmid to obtain plasmid pK18- Δzwf::dxsThe plasmid is heat shock transformed into S17-1 competence to obtain a donor strain S17-1Com△zwf::dxsCarrying out amphiphilic conjugation by using RC3 as a receptor strain to obtain beta-carotene rhodobacter sphaeroides engineering bacteria;
the sequences of the primers are as follows:
opt-crtY Pa -F：CAACGAAAAACGCCAAGATTTCTTGGC
opt-crtY Pa -R：TGTAGTTCTATTCATTCACTGCATCGCCTGCTG
opt-crtI Pa -F：AGGCGATGCAGTGAATGAATAGAACT
opt-crtI Pa -R：TCAAGCCAGATCCTCCAGCA
opt-crtI Pa Y Pa -F：AGTTCGCGCCCAACGAAAAACGCCAAGATTTCTTGG
opt-crtI Pa Y Pa -R：CAGAGGCAATCATTCAAGCCAGATCCTCCAGCAT
opt-crtI Pa Y Pa -up-F：CCGGAATTCCTCTCGTCGGCCATCTTG
opt-crtI Pa Y Pa -up-R：GTTTTTCGTTGGGCGCGAACTCCTGCA
opt-crtI Pa Y Pa -down-F：GGATCTGGCTTGAATGATTGCCTCTGCCGATCT
opt-crtI Pa Y Pa -down-R：CTAGTCTAGACGCCCGAGAAACTGTCGTAG
crtC-up-F：CCGGAATTCTCATCATGAACGGACCGCC
crtC-up-R：GGGATGTCAGGAAAAGGACACGCCGTCGATATACCA
crtC-down-F：ATCGACGGCGTGTCCTTTTCCTGACATCCCGGCC
crtC-down-R：CCCCAAGCTTGCCTTCAACACGCTCTGGAC
zwf-up-F1：CTAGTCTAGATGATCGAGATGGCGGGAGG
zwf-up-R1：GGCCTCTCAGCGGATAACCATGGGCTCTCCCGC
zwf-down-F1：GGAGAGCCCATGGTTATCCGCTGAGAGGCCGCCG
zwf-down-R1：CCCCAAGCTTGGTGATGAGGACATGGATGGC
zwf-up-F2：CTAGTCTAGATGATCGAGATGGCGGGAGGC
zwf-up-R2：GTCGGTCATGGGCTCTCCCGCTGCCT
dxs-F：GAGAGCCCATGACCGACAGACCCTGCAC
dxs-R：GGCGGCCTCTTCCGATCGCCCTCCTC
zwf-down-F2：CGATCGGAAGAGGCCGCCGGGC
zwf-down-R2：CCCCAAGCTTGGTGATGAGGACATGGATGGC。
2. the engineered beta-carotene rhodobacter sphaeroides strain obtained by the construction method according to claim 1.
CN201810835248.8A 2018-07-26 2018-07-26 Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof Active CN109097385B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810835248.8A CN109097385B (en) 2018-07-26 2018-07-26 Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810835248.8A CN109097385B (en) 2018-07-26 2018-07-26 Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof

Publications (2)

Publication Number Publication Date
CN109097385A CN109097385A (en) 2018-12-28
CN109097385B true CN109097385B (en) 2022-05-20

Family

ID=64847748

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810835248.8A Active CN109097385B (en) 2018-07-26 2018-07-26 Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof

Country Status (1)

Country Link
CN (1) CN109097385B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109609519A (en) * 2018-10-31 2019-04-12 昆明理工大学 A kind of gene RKcrtYB and its application
CN111304138B (en) * 2020-02-03 2021-12-24 天津大学 Recombinant escherichia coli for producing beta-carotene and construction method and application thereof
CN114686385B (en) * 2022-04-11 2022-10-11 陕西海斯夫生物工程有限公司 Recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103509729A (en) * 2012-06-15 2014-01-15 浙江新和成股份有限公司 Construction method of engineering bacterium for producing coenzyme Q10, engineering bacterium and application of engineering bacterium
CN103740744A (en) * 2014-01-17 2014-04-23 河北大学 Zeaxanthin synthetic gene recombinant plasmid and preparation method and use thereof
CN104962488A (en) * 2015-07-22 2015-10-07 天津大学 Recombinant yeast strain, and construction method and application thereof
CN105087406A (en) * 2015-07-22 2015-11-25 天津大学 Recombinant yeast strain as well as construction method and application thereof
CN105420134A (en) * 2015-12-25 2016-03-23 天津大学 Recombinant yeast strain, and construction method and application thereof
CN105779319A (en) * 2016-03-23 2016-07-20 天津大学 Recombinant yeast strain, and building method and application thereof
CN106801028A (en) * 2017-01-17 2017-06-06 中山大学 Produce high-content zeaxanthin or astaxanthin engineering bacteria and its application
CN106987550A (en) * 2017-05-18 2017-07-28 陕西师范大学 A kind of recombinant bacterium for producing bata-carotene and its construction method and application

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103509729A (en) * 2012-06-15 2014-01-15 浙江新和成股份有限公司 Construction method of engineering bacterium for producing coenzyme Q10, engineering bacterium and application of engineering bacterium
CN103740744A (en) * 2014-01-17 2014-04-23 河北大学 Zeaxanthin synthetic gene recombinant plasmid and preparation method and use thereof
CN104962488A (en) * 2015-07-22 2015-10-07 天津大学 Recombinant yeast strain, and construction method and application thereof
CN105087406A (en) * 2015-07-22 2015-11-25 天津大学 Recombinant yeast strain as well as construction method and application thereof
CN105420134A (en) * 2015-12-25 2016-03-23 天津大学 Recombinant yeast strain, and construction method and application thereof
CN105779319A (en) * 2016-03-23 2016-07-20 天津大学 Recombinant yeast strain, and building method and application thereof
CN106801028A (en) * 2017-01-17 2017-06-06 中山大学 Produce high-content zeaxanthin or astaxanthin engineering bacteria and its application
CN106987550A (en) * 2017-05-18 2017-07-28 陕西师范大学 A kind of recombinant bacterium for producing bata-carotene and its construction method and application

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
1-deoxy-d-xylulose 5-phosphate synthase (DXS), a crucial enzyme for isoprenoids biosynthesis;Song X等;《Springer: New York》;20121231;全文 *
Assembly of functional photosystem complexes in Rhodobacter sphaeroides incorporating carotenoids from the spirilloxanthin pathway;Shuang C.Chi等;《Biochimica et Biophysica Acta》;20141027;第1847卷;全文 *
Engineeringcentralmetabolicmodulesof Escherichiacoli for improving b-carotene production;Jing Zhao等;《MetabolicEngineering》;20130307;第17卷;全文 *
Lycopene production in recombinant strains of Escherichia coli is improved by knockout of the central carbon metabolism gene coding for glucose-6-phosphate dehydrogenase;Yan Zhou等;《Biotechnol Lett》;20130927;第35卷;全文 *
Metabolic Redesign of Rhodobacter sphaeroides for Lycopene Production;Anping Su等;《Journal of Agricultural and Food Chemistry》;20180528;第66卷;摘要 *

Also Published As

Publication number Publication date
CN109097385A (en) 2018-12-28

Similar Documents

Publication Publication Date Title
CN109097385B (en) Beta-carotene rhodobacter sphaeroides engineering strain and construction method thereof
Tian et al. Metabolic engineering coupled with adaptive evolution strategies for the efficient production of high-quality L-lactic acid by Lactobacillus paracasei
Singh et al. Recent advances and challenges of the use of cyanobacteria towards the production of biofuels
KR102015829B1 (en) Coenzyme Q10 Fermentation Production Process Based on Integrated Control of Online Oxygen Consumption and Conductivity
US20240002892A1 (en) Compound enzyme and application thereof in preparation of l-ergothioneine
CN109943493B (en) Mutant strain for realizing diversity of general enzyme catalytic functions and construction method thereof
CN104651287A (en) Engineering bacterium for synthesizing glycosylglycerol and application thereof
Du et al. Advances in microbial heterologous production of flavonoids
CN106801028B (en) Engineering bacterium for producing high-content zeaxanthin or astaxanthin and application thereof
CN108611360B (en) Lycopene-producing rhodobacter sphaeroides engineering strain and construction method thereof
CN108456652A (en) A kind of Sphingol single-cell genetic engineering bacterium and its construction method and application
CN115786140A (en) High-yield gibberellin GA 3 The gene engineering bacterium, the construction method and the application
CN113073074B (en) Genetically engineered bacterium for efficiently synthesizing riboflavin and application thereof
CN112608936B (en) Promoter for regulating and controlling expression of exogenous gene of yeast, regulating and controlling method and application thereof
CN107227286B (en) Genetically engineered bacterium capable of producing succinic acid at high yield, and construction method and application thereof
WO2019136618A1 (en) Gene engineering bacterium for producing uridine at high yield, construction method therefor and application thereof
JP5647758B2 (en) New carotenoid ketolase
KR102473375B1 (en) Recombinant microorganisms, their preparation methods and their use in the production of coenzyme Q10
CN114561434B (en) Method for producing EPA and DHA by schizochytrium limacinum fermentation
CN114806995B (en) Construction and application of genetically engineered bacterium for efficiently synthesizing tetrahydropyrimidine based on acetyl-CoA metabolic modification
Leite et al. Engineered cyanobacteria: research and application in bioenergy
CN111304138B (en) Recombinant escherichia coli for producing beta-carotene and construction method and application thereof
CN111394396B (en) Method for producing 1, 3-propylene glycol by using glycerol fermentation by microorganisms
CN113174397B (en) Method for efficiently synthesizing lycopene by using cell-free system
CN105821091A (en) Method for preparing levodopa

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20220621

Address after: 712100 C1, torch Park, free trade street, Yangling Demonstration Zone, Xi'an City, Shaanxi Province

Patentee after: SHAANXI HEALTHFUL BIOLOGICAL ENGINEERING Co.,Ltd.

Address before: Room 804, block a, Huihang Plaza, Hangtuo Road, Xi'an space base, Shaanxi 710100

Patentee before: XI'AN HEALTHFUL BIOTECHNOLOGY Co.,Ltd.

TR01 Transfer of patent right