CN114686385B

CN114686385B - Recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof

Info

Publication number: CN114686385B
Application number: CN202210373502.3A
Authority: CN
Inventors: 郭建琦; 金钰; 杨璐; 牛永洁; 孟永宏
Original assignee: Shaanxi Healthful Biological Engineering Co ltd
Current assignee: Shaanxi Healthful Biological Engineering Co ltd
Priority date: 2022-04-11
Filing date: 2022-04-11
Publication date: 2022-10-11
Anticipated expiration: 2042-04-11
Also published as: CN114686385A

Abstract

The invention relates to recombinant yarrowia lipolytica for high yield of beta-carotene, which improves the yield of the beta-carotene by establishing an oxidative stress defense system in the yarrowia lipolytica, wherein the oxidative stress defense system expresses one or more of superoxide dismutase gene (SOD 1), catalase gene (CAT), glutathione peroxidase Gene (GPO), glutathione disulfide reductase Gene (GSR), thioredoxin reductase gene (TRXR) and glucose hexaphosphate dehydrogenase gene (ZWF) in the yarrowia lipolytica strain. The recombinant yarrowia lipolytica strain reaches 105g/L DCW in a 50L fermentation tank, the yield of beta-carotene reaches 3201mg/L (30.49 mg/g DCW), and the yield is improved by 37.2 percent on the basis of a control strain.

Description

Recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof

[ technical field ] A

The present invention belongs to the field of gene engineering technology. In particular to yarrowia lipolytica for high yield of beta-carotene, a method for constructing an oxidative stress defense system in yarrowia lipolytica and application of the obtained recombinant yeast in producing the beta-carotene.

[ background ] A method for producing a semiconductor device

The beta-carotene is a fat-soluble natural carotenoid which exists in green vegetables such as carrots, pawpaw and the like in the nature in an all-trans structure, has good functions of inhibiting singlet oxygen, resisting oxidation, quenching free radicals and the like due to the fact that the beta-carotene contains 11 conjugated carbon-carbon double bonds, has the functions of delaying senescence, preventing cancer, resisting cancer and the like, and can be applied to industries such as food, cosmetics, animal husbandry and the like.

Lipolytica is a safe oleaginous microorganism with a clear genetic background that provides sufficient precursor compounds and energy supply substances acetyl COA, NADPH and ATP in vivo. Acetyl COA is a precursor substance for producing beta-carotene, and liposomes independently existing in lipolytic yarrowia cells are beneficial to storing the beta-carotene. YL has therefore been used to produce beta-carotene by genetic engineering. CN109666596A incorporated genes for beta-carotene synthesis pathway derived from Mucor circinelloides, such as carRP, carB, GGS1, and tHMG, into yarrowia lipolytica, and allowed to have beta-carotene synthesis ability. Shan Qiang et al over-express the copy number of Hxk and Erg13 to promote the utilization of glucose, increase downstream HMG-CoA, increase beta-Carotene content, and knock out gut2 to push glycerol to the beta-Carotene biosynthetic pathway, increase intracellular liposome content, provide more storage space for beta-Carotene, express the carRP, carB, GGS1, tHMG genes in Yarrowia lipolytica, ferment in a 50L bioreactor, the beta-Carotene yield can reach 2.4g/L [ Qiang Shann, wang jin, xiong ao Chao, qu YuLing, liu Liang, hung Yin, meng Yong hong, promoting the Synthesis of Current Subsequence enzyme by fermentation enzyme, hxk ] hydrolysis and Synthesis of beta-Carotene by beta-Carotene, product J13, product J11: ].

Oxygen supply plays an important role in fermentation in aerobic fermentation. Oxygen-mediated cell damage is an important problem in aerobic fermentation. It has been reported that reactive oxygen ROS accumulation is stimulated in cellular metabolism, and the generated ROS cause lipid peroxidation on cellular biofilms, disrupting membrane structure and function, and thus leading to interruption of DNA replication, loss of protein function and even cell death [ Lamonte Gregory, tang Xiaohu, chen Julia Ling-Yu, wu Juanli, ding Chien-Kuang Cornella, keean Melissa M, sangoya Carolyn, kung Hsiu-Ni, ilkayeva Olga, boros L-type szl G, newga Chotopher B, chi Jen-Tsan. Acidopsis industries reproducing of cell metallic to output oxidative strain [ J ]. Cancer & metric, 2013,1 (2011) ]. Some antioxidant enzymes are overexpressed to counter the damage caused by blocking oxygen radicals to cells and to repair cells in time, and some people express several antioxidant enzymes to build an oxidative stress defense system to scavenge free radicals and their products to increase DHA production [ Han Xiao, li Zhuhui, wen Ying, chen Zhi. The main antioxidant enzymes include Glutathione Peroxidase (GPO), glutathione disulfide reductase (GSR), superoxide dismutase (SOD 1), thioredoxin reductase (TRXR), aldehyde dehydrogenase (ALDH), catalase (CAT), peroxidase (POD) and the like, wherein the GSR and the TRXR need NADHP as reducing agents to resist oxidative stress. NADPH required for biosynthesis is mainly provided by the pentose phosphate pathway, wherein the main controlling enzyme for NADPH production is glucose hexaphosphate dehydrogenase (ZWF). At present, no one can increase the content of beta-carotene by establishing an oxidation defense system in yarrowia lipolytica.

[ summary of the invention ]

The invention aims to provide recombinant yarrowia lipolytica capable of producing beta-carotene in high yield.

Based on this, the idea of the present invention is to select and verify an appropriate antioxidant enzyme to further increase the yield of β -carotene by establishing an oxidative stress defense system in yarrowia lipolytica.

In view of the above objects, the present invention provides a recombinant yarrowia lipolytica for highly producing β -carotene, characterized in that the recombinant yarrowia lipolytica is obtained by expressing one or more genes selected from the group consisting of superoxide dismutase gene (SOD 1), catalase gene (CAT), glutathione peroxidase Gene (GPO), glutathione disulfide reductase Gene (GSR), thioredoxin reductase gene (TRXR), and/or glucose hexaphosphate dehydrogenase gene (ZWF) in yarrowia lipolytica strain YL-C6.

Preferably, the recombinant yarrowia lipolytica is obtained by expressing superoxide dismutase gene (SOD 1), catalase gene (CAT), glutathione peroxidase Gene (GPO), glutathione disulfide reductase Gene (GSR), thioredoxin reductase gene (TRXR), glucose hexaphosphate dehydrogenase gene (ZWF), simultaneously expressing thioredoxin reductase gene (TRXR) and glutathione peroxidase Gene (GPO), or simultaneously expressing thioredoxin reductase gene (TRXR), glutathione peroxidase Gene (GPO) and superoxide dismutase gene (SOD 1) in yarrowia lipolytica strain YL-C6.

In the present invention, yarrowia lipolytica strain YL-C6 is an Engineered strain obtained by integrating the Hxk gene into the genome of Yarrowia lipolytica yeast Y.L-6 according to the method provided in Qiang Shann et al, promoting the Synthesis of the preceding steps by Overexpressing Hexokinase (Hxk) and hydroxymethy gluteranyl-CoA synthetase (Erg 13) to extract beta-Carotene Production in Engineered Yarrowia lipolytica [ J ]. Frontiers in microbiology, JN 2020,11, and carrying plasmid p44-tHMG-GGS 1-carRA-carB. When the culture is carried out in a 50L fermentation tank, the final biomass of YL-C6 reaches 82.1g/L, the maximum yield of beta-carotene is 2.4g/L, and the content of beta-carotene reaches 29.23mg/g DCW.

Wherein, the yarrowia lipolytica Y.L-6 combines Hxk and two erg13 copies into Y.L-1. These two genes were inserted into the gut2 locus chromosome of y.l-1 using a linearized integration cassette (erg 13-erg13-gut 2-up-loxp-down) to obtain a genetically stable strain. The yield of beta-carotene of Y.L-6 was 9.56mg/g DCW.

In the invention, the nucleotide sequence of superoxide dismutase gene (SOD 1) is shown as SEQ ID NO.1, the nucleotide sequence of catalase gene (CAT) is shown as SEQ ID NO.2, the nucleotide sequence of glutathione peroxidase Gene (GPO) is shown as SEQ ID NO.3, the nucleotide sequence of glutathione disulfide reductase Gene (GSR) is shown as SEQ ID NO.4, the nucleotide sequence of thioredoxin reductase gene (TRXR) is shown as SEQ ID NO.5, and the nucleotide sequence of glucose hexaphosphate dehydrogenase gene (ZWF) is shown as SEQ ID NO. 6.

The invention also provides a construction method of the recombinant yarrowia lipolytica, which comprises the following steps:

(1) Construction of plasmid vectors

To containHaving a promoter P _TEF Expression plasmid vectors pJN44 of selective markers of terminators Txpr2 and Leu2 are used as vectors, yarrowia lipolytica genomes are extracted, target genes SOD1, GPO, GSR and TRXR are obtained through PCR amplification respectively, target genes CAT and ZWF are artificially synthesized respectively, and the obtained target genes are connected with the plasmid vectors pJN44 respectively to obtain plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR and pJN44-ZWF;

cutting the GPO gene from the plasmid pJN44-GPO and connecting the GPO gene to the plasmid pJN44-TRXR to construct a plasmid pJN44-TRXR-GPO;

cutting SOD1 gene from the plasmid pJN44-SOD1 and connecting to the plasmid pJN44-TRXR-GPO to construct plasmid pJN44-TRXR-GPO-SOD1;

(2) Construction of recombinant yarrowia lipolytica Strain

According to the use method of the yeast transformation kit, the plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR, pJN44-ZWF, pJN44-TRXR-GPO and pJN44-TRXR-GPO-SOD1 obtained in the step (1) are respectively transformed into yarrowia lipolytica YL-C6, and cultured by using SD-leu solid medium to obtain the recombinant yarrowia lipolytica YL-C6 (pJN 44-SOD 1), YL-C6 (pJN 44-CAT), YL-C6 (pJN 44-GPO), YL-C6 (pJN 44-GSR), YL-C6 (pJN 44-TRXR), YL-C6 (pJN 44-ZWF), YL-C6 (pJN 44-XR-GPO) and pJN 44-TRXR-GPO-SOD.

Furthermore, the invention also provides application of the recombinant yarrowia lipolytica strain in beta-carotene production.

According to a preferred embodiment, the obtained recombinant yarrowia lipolytica is cultured in SD-leu liquid medium for 24-48h in a constant temperature shaking table at 180-220rpm and 28-30 ℃ to obtain seed culture solution; then inoculating the seed culture solution into SD-leu liquid culture medium with 1-5% of inoculation amount, fermenting and culturing for 4-6 days in a constant temperature shaking table at 180-220rpm and 28-30 ℃; finally inoculating the seed culture solution into a 50L bioreactor containing a fermentation culture medium by the optimal strain with the inoculation amount of 1-5%, and fermenting and culturing for 4-6d under the conditions of 28-30 ℃, ventilation of 30-50L/min, rotation speed of 100-650rpm, oxygen of 10-20% and pH of 5.5-6.0.

More preferably, the SD-leu liquid medium is: 20g/L glucose, 1.7 g-L YNB (containing no amino acid and ammonium sulfate) and 5g/L (NH) ₄ ) ₂ SO ₄ 、2g/L SD-leu；

The fermentation medium is as follows: 25g/L glucose, 10g/L yeast powder, 15g/L peptone and 5g/L (NH) ₄ ) ₂ SO ₄ 、2.5g/L KH ₂ PO ₄ 、2.5g/L K ₂ HPO ₄ 、0.5g/L MgSO ₄ 6g/L leucine and 1g/L biotin.

After the fermentation is finished, collecting cells, and detecting the content of beta-carotene by an HPLC method, wherein the method comprises the following steps:

extracting beta-carotene: taking 1mL of bacterial liquid, centrifuging, and collecting thalli; adding 500 mu L of dimethyl sulfoxide, and incubating for 15 minutes at 55 ℃; adding 500 mu L of acetone, incubating for 15 minutes at 45 ℃, and taking out and shaking every two minutes; centrifuging, taking the supernatant, and filtering the supernatant by using a 0.45-micron filter membrane in a liquid phase sampling bottle to be tested.

HPLC detection method: the chromatographic column is a C18 column (Diamonsil SB-C18 column,4.6 mm. Times.250 mm); the wavelength is as follows: 450nm; the mobile phase is (v/v): methanol: acetonitrile: isopropanol =30:50:20; the flow rate is: 1mL/min; the column temperature was 35 ℃ and elution was carried out by isocratic elution.

In a 50L fermentation tank, the cell biomass of the recombinant yarrowia lipolytica of the invention reaches 105g/L DCW at most, and the yield of beta-carotene reaches 3201mg/L (30.49 mg/g DCW).

According to the invention, several antioxidant enzyme genes are overexpressed in a yarrowia lipolytica chassis strain YL-C6, and a combination of several enzyme genes with the best effect is screened out through fermentation, so that an oxidative stress defense system is established, the content of beta-carotene is improved, the cell biomass of a recombinant strain in shake flask fermentation reaches 12.3g/L DCW, and the yield of beta-carotene reaches 394.83mg/L (32.1 mg/g DCW); the cell biomass reached 105g/L DCW in a 50L fermenter, and the beta-carotene yield reached 3201mg/L (30.49 mg/g DCW). The cell biomass of the control strain in the shake flask fermentation is 9.4g/L DCW, and the yield of beta-carotene reaches 296.1mg/L (31.5 mg/g DCW); the cell biomass reached 80.6g/L DCW in a 50L fermenter, and the yield of beta-carotene reached 2333mg/L (29.16 mg/g DCW). The yield of YL-C6 strain is improved by 37.2 percent on the basis of 2333mg/L, reaches 3201mg/L and is obviously higher than the record of the prior art.

[ description of the drawings ]

FIG. 1 schematic representation of the Chassis strain YL-C6

FIG. 2 is a diagram showing the mechanism of radical scavenging by several enzymes

FIG. 3 Shake flask fermentation results

FIG. 4 50L bioreactor fermentation results

FIG. 5 vector plasmid JN44 map

[ detailed description ] embodiments

The following examples serve to illustrate the technical solution of the present invention without limiting it.

In the present invention, "%" used for expression concentration is weight percent, ": "is a weight ratio.

The invention relates to the following engineering strains:

yarrowia lipolytica YL-C6: the Hxk gene was integrated into the genome of Yarrowia lipolytica Y.L-6 and obtained carrying plasmid pJN44-tHMG-GGS1-carRA-carB according to the method provided in Qiang Shan et al, promoting the Synthesis of the preceding stators by overexpression Hexokinase (Hxk) and hydroxymethy glutamyl-CoA synthsase (Erg 13) to expression beta-Carotene Production in Engineered Yarrowia lipolytica [ J ]. Frondiers in microbiology,2020, 11. According to the document, the final biomass of YL-C6 reached 82.1g/L, the maximum beta-carotene production was 2.4g/L and the beta-carotene content reached 29.23mg/g DCW when fermented in a 50L bioreactor.

Yarrowia lipolytica Y.L-6: the Hxk and two erg13 copies were combined into Y.L-1 (i.e., the original strain). These two genes were inserted into the gut2 locus chromosome of y.l-1 using a linearized integration cassette (erg 13-erg13-gut 2-up-loxp-down) to obtain a genetically stable strain. The beta-carotene yield of Y.L-6 was 9.56mg/g DCW.

The present invention relates to the following media:

LB liquid medium: 10g/L peptone, 10g/L NaCl and 5g/L yeast powder.

LB solid medium: 10g/L peptone, 10g/L NaCl, 5g/L yeast powder and 20g/L agar powder.

YPD liquid medium: 20g/L peptone, 20g/L glucose, 10g/L yeast powder

SD-leu liquid Medium: 20g/L glucose, 1.7g/L YNB (without amino acids and ammonium sulfate), 5g/L (NH) ₄ ) ₂ SO ₄ 、2g/L SD-leu。

SD-leu solid Medium: 20g/L glucose, 1.7g/L YNB (without amino acid and ammonium sulfate), 5g/L (NH) ₄ ) ₂ SO ₄ 2g/L SD-leu and 20g/L agar powder.

Fermentation medium: 25g/L glucose, 10g/L yeast powder, 15g/L peptone and 5g/L (NH) ₄ ) ₂ SO ₄ 、2.5g/L KH ₂ PO ₄ 、2.5g/L K ₂ HPO ₄ 、0.5g/L MgSO ₄ 6g/L leucine and 1g/L biotin.

The method for detecting the content of the beta-carotene comprises the following steps:

extracting beta-carotene: taking 1mL of bacterial liquid, centrifuging, and collecting thalli; adding 500 mu L of dimethyl sulfoxide, and incubating for 15 minutes at 55 ℃; adding 500 mu L of acetone, incubating for 15 minutes at 45 ℃, and taking out and shaking every two minutes; centrifuging, taking the supernatant, and filtering the supernatant by using a 0.45-micron filter membrane in a liquid phase sample bottle for testing.

Example 1: recombinant yarrowia lipolytica strains expressing single gene of interest

(1) Construction of an expression plasmid containing a Single Gene of interest

a) Extracting the original strain yarrowia lipolytica (Y.lipolytica) genome. Taking 1mL of bacterial liquid, centrifuging, and discarding the supernatant; adding 200. Mu.L of 200mM LioAc,1% SDS solution, shaking and mixing; performing metal bath at 70 ℃ for 15min; an equal volume (200 μ L) of saturated phenol was added: chloroform: the isoamyl alcohol (25; absorbing the water phase into a new sterilized 1.5mL centrifuge tube, adding isopropanol with the same volume, and uniformly mixing; standing at-20 deg.C for 1-2h, and centrifuging at 12000 Xg for 10min to obtain DNA; adding 1mL 70 vol% ethanol to wash DNA (repeating for 2 times), centrifuging for 4min, and discarding the supernatant; reversely buckling the centrifugal tube containing the DNA on clean filter paper for 15min, and carrying out metal bath at 50 ℃ for 2min to completely volatilize the ethanol; the DNA was dissolved in 10-20. Mu.L of deionized water and stored at-20 ℃ for further use.

b) Target genes SOD1 (YALI 0-E12133 g), GPO (YAL 10-E02310 g), GSR (YAL 10-E18029 g) and TRXR (YAL 10-D27126 g) of 4 antioxidases are found on NCBI, primers are designed according to gene sequences, proper enzyme cutting sites are inserted according to vectors during design, the primers are sent to Nanjing Kingshi Biotech, inc. for synthesis, and the target genes are amplified from original strain yarrowia lipolytica (Y.lipolytica) genome by utilizing PCR technology.

SOD1-FOR：TCCCCCGGGATGGTCAAGGCTGGTGAGTA

SOD1-REV：AAACTGCAGTTAGGCGGTAAGACCAATGA

GPO-FOR：CTCCCCGGGATGTCCGCCGAGAAAACCAA

GPO-REV：CCCAAGCTTTTAGGGCTTTTTGAGGAGGG

GSR-FOR：CTCCCCGGGATGGCTTCTATCCCCCATTA

GSR-REV：CCCAAGCTTCTATCTCATGGTCACCAGCT

TRXR-FOR：AAACTGCAGATGACCCACAGCCCAGTTGT

TRXR-REV：CGCGTCGACCTATTCCTCCTCAGCAAGCA

In addition, CAT and ZWF genes from e.coli ATCC 98082 were synthesized by shanghai bio ltd.

c) Treating the vector pJN44 and target gene fragments GPO and GSR for 2h at 37 ℃ by using restriction enzymes Xma I and Hind III respectively for enzyme digestion; treating the vector pJN44 and the target gene fragments SOD1, CAT and ZWF with restriction enzymes Sma I and PstI at 37 ℃ for 2h respectively for enzyme digestion; the vector pJN44 and the target gene fragment TRXR were digested with restriction enzymes PstI and SalI, respectively, by treating for 2h at 37 ℃. Respectively carrying out electrophoresis on the enzyme-cut vector and the target gene by using 1% agarose gel, respectively cutting off the required fragments under a gel imager, and recovering the DNA fragments of the target gene and the vector by using a gel recovery kit (AxyGen); the recovered vector fragment and the target fragment were ligated with T4 DNA ligase (Thermo Fisher), transformed into E.coli Trans 5. Alpha. And uniformly spread on LB solid medium containing 100. Mu.g/mL ampicillin (yeast extract 5g/L, peptone 10g/L, agar powder 17 g/L), cultured overnight at 37 ℃, single colonies were picked up on LB liquid medium containing 100. Mu.g/mL ampicillin, cultured overnight at 37 ℃, plasmids were extracted with a plasmid extraction kit (Axyy), and expression plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR and pJN44-ZWF were obtained, respectively.

The expression plasmid is verified to be cut by restriction enzymes Hind III and Sma I, agarose gel electrophoresis is carried out, a picture is taken under a gel imaging instrument for checking, and the expression plasmid with correct expression is verified to be expressed in yarrowia lipolytica YL-C6.

(2) Construction of recombinant yarrowia lipolytica Strain expressing 1 target Gene

The preserved yarrowia lipolytica YL-C6 strain is inoculated in 2mL YPD liquid culture medium and cultured in a shaker at 30 ℃ and 180rpm for 24h for activation.

The 6 expression plasmids obtained in (1) were each expressed according to the method of a Yeast Transformation Kit (Frozen-EZ Yeast Transformation II Kit): 1mL of cultured yarrowia lipolytica YL-C6 bacterial liquid is put into a centrifuge tube, centrifuged for 4min at 4000 Xg, and the supernatant is discarded; adding 500 μ L solution I, mixing by vortex, centrifuging at 4000 Xg for 4min, and removing supernatant; adding 50 μ L of solution II, and uniformly mixing and suspending by blowing and sucking with a gun; adding 5 mu L of plasmid to be transformed, shaking and mixing uniformly; adding 500 μ L solution III, mixing by vortex, culturing at 30 deg.C and 225rpm for 2h, spreading on corresponding auxotrophic SD-leu solid screening plate, and culturing at 30 deg.C for 3-4d. Obtaining recombinant yarrowia lipolytica YL-C6 (pJN 44-SOD 1), YL-C6 (pJN 44-CAT), YL-C6 (pJN 44-GPO), YL-C6 (pJN 44-GSR), YL-C6 (pJN 44-TRXR) and YL-C6 (pJN 44-ZWF).

(3) Application of recombinant yarrowia lipolytica strain in production of beta-carotene

Respectively culturing 6 recombinant yarrowia lipolytica strains obtained in the step (2) on SD-leu solid culture media at 30 ℃ for 3 days for activation, selecting a single colony to be inoculated into a 10mL/50mL small bottle SD-leu liquid seed culture medium, and carrying out shake flask culture for 48h at 30 ℃ and 200 r/min; then, the cells were inoculated into SD-leu liquid medium of 50mL/250mL in an inoculum size of 2%, fermented at 30 ℃ for 120 hours at 200r/min, and then collected, and the content of beta-carotene was measured, and the results are shown in FIG. 3 and Table 1.

Analysis and detection results show that the expression of the over-expression antioxidant enzyme gene has little influence on the content of the beta-carotene, but the cell biomass is obviously increased, so that the yield of the beta-carotene is increased, the yield is increased from 296.1mg/L to 394.83mg/L, and is increased by 33.34%. After a single enzyme is expressed, in a shake flask fermentation experiment, the most obvious improvement of cell biomass and beta-carotene content is a recombinant bacterium for expressing TRXR gene, and then GPO, SOD1, ZWF, CAT and GSR are sequentially adopted.

Example 2: recombinant yarrowia lipolytica strains expressing multiple genes

(1) Construction of an expression plasmid containing multiple genes of interest

TRXR and GPO were ligated together onto vector JN 44: treating the plasmid pJN44-GPO obtained in example 1 with restriction enzymes XbaI and SpeI at 37 ℃ for 2h for enzyme digestion, treating the plasmid pJN44-TRXR obtained in example 1 with restriction enzymes SpeI at 37 ℃ for 2h for enzyme digestion, performing 1% agarose gel electrophoresis, cutting linear fragments of the target gene GPO and the vector pJN44-TRXR under a gel imaging instrument, and performing gel recovery by using a gel recovery kit (AxyGen) to respectively recover DNA fragments of the target gene and the vector; connecting the recovered vector pJN44-TRXR and the target gene GPO under the action of T4 DNA ligase (Thermo Fisher), transforming the vector pJN44-TRXR and the target gene GPO into E.coli Trans5 alpha, uniformly coating the E.coli Trans5 alpha on an LB solid culture medium containing 100 mu g/mL ampicillin, culturing overnight at 37 ℃, picking single colonies to an LB liquid culture medium containing 100 mu g/mL ampicillin, culturing overnight at 37 ℃, extracting plasmids by using a plasmid extraction kit (AxyGen), and performing enzyme digestion verification by using restriction enzymes XbaI and NsiI to obtain the expression plasmid pJN44-TRXR-GPO.

TRXR, GPO and SOD1 were ligated together onto carrier JN 44: treating a plasmid pJN44-SOD1 at 37 ℃ for 2h by using restriction enzymes XbaI and SpeI for enzyme digestion, treating a plasmid pJN44-TRXR-GPO at 37 ℃ for 2h by using restriction enzymes SpeI for enzyme digestion, performing 1% agarose gel electrophoresis, cutting a linear fragment of a target gene SOD1 and a vector pJN44-TRXR-GPO under a gel imaging instrument, and respectively performing gel recovery on a target gene and a DNA fragment of the vector by using a gel recovery kit (AxyGen); connecting the recovered vector pJN44-TRXR-GPO and the target gene SOD1 under the action of T4 DNA ligase (Thermo Fisher), transforming into E.coli Trans5 alpha, uniformly coating on an LB solid culture medium containing 100 mu g/mL ampicillin, culturing overnight at 37 ℃, picking single colonies to an LB liquid culture medium containing 100 mu g/mL ampicillin, culturing overnight at 37 ℃, extracting plasmids by using a plasmid extraction kit (AxyGen), and performing enzyme digestion verification by using restriction enzymes XbaI and NsiI to obtain the expression plasmid pJN44-TRXR-GPO-SOD1.

(2) Construction of recombinant strains expressing multiple genes of interest

The 2 expression plasmids obtained in (1) were each expressed according to the method of a Yeast Transformation Kit (Frozen-EZ Yeast Transformation II Kit): 1mL of bacterial liquid is taken out of a centrifugal tube, centrifuged for 4min at 4000 Xg, and the supernatant is discarded; adding 500 μ L solution I, mixing by vortex, centrifuging at 4000 Xg for 4min, and removing supernatant; adding 50 μ L of solution II, and uniformly mixing and suspending by blowing and sucking with a gun; adding 5 mu L of plasmid to be transformed, shaking and mixing uniformly; adding 500 μ L solution III, mixing by vortex, culturing at 30 deg.C and 225rpm for 2 hr, coating on corresponding auxotrophic SD-leu solid screening plate, and culturing at 30 deg.C for 3-4d. Obtaining recombinant yarrowia lipolytica YL-C6 (pJN 44-TRXR-GPO) and YL-C6 (pJN 44-TRXR-GPO-SOD 1).

(3) Application of yarrowia lipolytica recombinant strain in production of beta-carotene

Respectively culturing 2 recombinant yarrowia lipolytica strains obtained in the step (2) on SD-leu solid culture media at 30 ℃ for 3 days for activation, selecting a single colony to be inoculated into a small bottle of liquid SD-leu seed culture medium of 10mL/50mL, and carrying out shake-flask culture for 48h at 30 ℃ under the condition of 200 r/min; then, the cells were inoculated into 50mL/250mL of liquid SD-leu medium at 2%, fermented at 30 ℃ for 120 hours at 200r/min, and then the cells were collected and extracted as described above to determine the content of beta-carotene, the extraction and determination methods being the same as above, and the results are shown in FIG. 3 and Table 1.

Analysis and detection results show that the effect difference between the TRXR-GPO gene for expressing two enzymes and the TRXR-GPO-SOD1 gene for expressing three enzymes is small, too much gene expression can cause the metabolic burden of bacteria, so that the ideal effect can be achieved by expressing the TRXR and GPO genes, and the cell biomass of YL-C6 (pJN 44-TRXR-GPO) in the shake flask fermentation reaches 12.3g/LDCW, and the yield of beta-carotene reaches 394.83mg/L (32.1 mg/g DCW).

Example 3: application of recombinant yarrowia lipolytica strain in production of beta-carotene

After the recombinant yarrowia lipolytica strain YL-C6 (pJN 44-TRXR-GPO) obtained in example 2 was cultured on SD-leu solid medium at 30 ℃ for 3 days for activation, single colonies were picked up and inoculated into 50mL/250mL liquid SD-leu medium, and cultured at 30 ℃ for 24 hours at 200 r/min; the mixture was inoculated in a 50L bioreactor containing fermentation medium at an inoculum size of 2% for fermentation.

The fermentation conditions of the fermentation tank are as follows: fermenting at 30 deg.C, ventilating at 30-50L/min, rotating at 100-650rpm, controlling oxygen content at 10-20% and pH at 5.8, maintaining sugar content in the fermentation tank at 5-10g/L, fermenting for 8 hr, and adding yeast powder 45g and (NH) ₄ ) ₂ SO ₄ 30g, after 20h, 2g of biotin is added. Fermenting for 160 hours, collecting thallus when the content of beta-carotene does not increase for 4 hours as the fermentation end point, processing bacterial liquid, measuring the yield of beta-carotene in the sample, and performing the extraction and detection methods as above, wherein the result is shown in figure 4.

The cell biomass reached 105g/L DCW in a 50L fermenter, and the beta-carotene yield reached 3201mg/L (30.49 mg/g DCW).

Comparative example 1: construction of reference strain and application thereof in beta-carotene production

(1) Construction of control strains

The plasmid JN44 was transformed into yarrowia lipolytica strain YL-C6 (JN 44) by the same method as described above using the Yeast Transformation Kit (Frozen-EZ Yeast Transformation II Kit) to obtain a yarrowia lipolytica strain YL-C6.

(2) Application of control strain in beta-carotene production

Taking yarrowia lipolytica yeast strain YL-C6 (JN 44) as a control strain, culturing for 3 days at 30 ℃ on an SD-leu solid culture medium for activation, selecting a single colony, inoculating a 10mL/50mL small bottle liquid YPD inoculum size, transferring the single colony into a 50mL/250mL liquid YPD culture medium, fermenting for 120 hours at 30 ℃ at 200r/min, collecting cells, detecting the content of beta-carotene, and performing extraction and detection methods as above.

The cell biomass of the control strain in the shake flask fermentation reaches 9.4g/L DCW, and the yield of beta-carotene reaches 296.1mg/L (31.5 mg/g DCW);

culturing a control strain YL-C6 (pJN 44) on an SD-leu solid culture medium at 30 ℃ for 3 days for activation, then picking a single colony to be inoculated into a liquid SD-leu culture medium of 50mL/250mL, and culturing for 24 hours at 30 ℃ under the condition of 200 r/min; inoculating the mixture into a 50L bioreactor containing a fermentation medium according to the inoculation amount of 2% to perform fermentation.

The fermentation conditions of the fermentation tank are as follows: introducing air at 30 deg.C and 30-50L/min, rotating at 100-650rpm, controlling oxygen content at 10-20% and pH at 5.8, maintaining sugar content at 5-10g/L in fermentation tank, fermenting for 8 hr, adding yeast powder 45g and (NH) ₄ ) ₂ SO ₄ 30g, after 20h, 2g of biotin is added. Fermenting for 140h, collecting thallus with 4h beta-carotene content not increased as fermentation end point, processing bacterial liquid, measuring beta-carotene yield of the sample, and extracting and detecting the same as above.

The cell biomass reached 80.6g/L DCW in a 50L fermenter, and the yield of beta-carotene reached 2333mg/L (29.16 mg/g DCW). The result is substantially consistent with the final biomass of 82.1g/L, the maximum yield of beta-carotene of 2.4g/L and the beta-carotene content of 29.23mg/g DCW described in the prior art.

As can be seen, when the fermentation of the fermentation tank is stopped, the cell amount of the strain YL-C6 (pJN 44-TRXR-GPO) obtained by the invention is 130.27% of that of the control group, and the yield of the beta-carotene is 137.21% of that of the control group. Proves that the yield of the beta-carotene can be effectively improved by establishing an oxidative stress defense system in the yarrowia lipolytica.

Sequence listing

<110> Shaanxi Haas Schff bioengineering GmbH

<120> recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 761

<212> DNA

<213> superoxide dismutase gene (SOD 1 Unknown)

<400> 1

atggtcaagg ctggtgagta cgagagcaag gcccggaatc gggcacattg agcggccagc 60

gggtcaattg aaggccgctc gaccggtcca cacccacagg ttggccgcta cgttgacttc 120

gacaaccgtc tggaaggtgg cggaacgttg cgccgtgtga ggtggcaggt gactcagaag 180

ttgctcattg tttgttgaga tcagacccca caagcacaat tgcattttag gagggaattg 240

agagccctac ctcacggaat agtccatgtc gttgttcgcc acttgcccac actgcacatt 300

ctaacccagt cgctgttctt cgaggagatt ccaaggtctc cggtactgtc actttcgagc 360

aggactctga gtccggcccc gtcactgtca cctacgacat caagggcaac gatcccaacg 420

ctgagcgagg attccacgtc cacgagtttg gtgacaacac caacggctgc acttctgccg 480

gcccccactt caaccccttc aagaagaacc acggtggtcc caccgactct gagcgacacg 540

ttggtgacct cggaaacgtc aagactgact ctgagggtgt tgccaagggt gttctcaagg 600

actctcttct caagctgact ggtgacaact ccattgttgg ccgaaccgtc gttatccacg 660

gtggtgagga cgatcttgga aagggtggcc atgccgactc tctcaagacc ggaaacgctg 720

gccctcgacc cgcctgcggt gtcattggtc ttaccgccta a 761

<210> 2

<211> 2201

<212> DNA

<213> Catalase Gene (CATUnknown)

<400> 2

atgagcacgt cagacgatat ccataacacc acagccactg gcaaatgccc gttccatcag 60

ggcggtcacg accagagtgc gggggcgggc acaaccactc gcgactggtg gccaaatcaa 120

cttcgtgttg acctgttaaa ccaacattct aatcgttcta acccactggg tgaggacttt 180

gactaccgca aagaattcag caaattagat tactacggcc tgaaaaaaga tctgaaagcc 240

ctgttgacag aatctcaacc gtggtggcca gccgactggg gcagttacgc cggtctgttt 300

attcgtatgg cctggcacgg cgcggggact taccgttcaa tcgatggacg cggtggcgcg 360

ggtcgtggtc agcaacgttt tgcaccgctg aactcctggc cggataacgt aagcctcgat 420

aaagcgcgtc gcctgttgtg gccaatcaaa cagaaatatg gtcagaaaat ctcctgggcc 480

gacctgttta tcctcgcggg taacgtggcg ctagaaaact ccggcttccg taccttcggt 540

tttggtgccg gtcgtgaaga cgtctgggaa ccggatctgg atgttaactg gggtgatgaa 600

aaagcctggc tgactcaccg tcatccggaa gcgctggcga aagcaccgct gggtgcaacc 660

gagatgggtc tgatttacgt taacccggaa ggcccggatc acagcggcga accgctttct 720

gcggcagcag ctatccgcgc gaccttcggc aacatgggca tgaacgacga agaaaccgtg 780

gcgctgattg cgggtggtca tacgctgggt aaaacccacg gtgccggtcc gacatcaaat 840

gtaggtcctg atccagaagc tgcaccgatt gaagaacaag gtttaggttg ggcgagcact 900

tacggcagcg gcgttggcgc agatgccatt acctctggtc tggaagtagt ctggacccag 960

acgccgaccc agtggagcaa ctatttcttc gagaacctgt tcaagtatga gtgggtacag 1020

acccgcagcc cggctggcgc aatccagttc gaagcggtag acgcaccgga aattatcccg 1080

gatccgtttg atccgtcgaa gaaacgtaaa ccgacaatgc tggtgaccga cctgacgctg 1140

cgttttgatc ctgagttcga gaagatctct cgtcgtttcc tcaacgatcc gcaggcgttc 1200

aacgaagcct ttgcccgtgc ctggttcaaa ctgacgcaca gggatatggg gccgaaatct 1260

cgctacatcg ggccggaagt gccgaaagaa gatctgatct ggcaagatcc gctgccgcag 1320

ccgatctaca acccgaccga gcaggacatt atcgatctga aattcgcgat tgcggattct 1380

ggtctgtctg ttagtgagct ggtatcggtg gcctgggcat ctgcttctac cttccgtggt 1440

ggcgacaaac gcggtggtgc caacggtgcg cgtctggcat taatgccgca gcgcgactgg 1500

gatgtgaacg ccgcagccgt tcgtgctctg cctgttctgg agaaaatcca gaaagagtct 1560

ggtaaagcct cgctggcgga tatcatagtg ctggctggtg tggttggtgt tgagaaagcc 1620

gcaagcgccg caggtttgag cattcatgta ccgtttgcgc cgggtcgcgt tgatgcgcgt 1680

caggatcaga ctgacattga gatgtttgag ctgctggagc caattgctga cggtttccgt 1740

aactatcgcg ctcgtctgga cgtttccacc accgagtcac tgctgatcga caaagcacag 1800

caactgacgc tgaccgcgcc ggaaatgact gcgctggtgg gcggcatgcg tgtactgggt 1860

gccaacttcg atggcagcaa aaacggcgtc ttcactgacc gcgttggcgt attgagcaat 1920

gacttcttcg tgaacttgct ggatatgcgt tacgagtgga aagcgaccga cgaatcgaaa 1980

gagctgttcg aaggccgtga ccgtgaaacc ggcgaagtga aatttacggc cagccgtgcg 2040

gatctggtgt ttggttctaa ctccgtcctg cgtgcggtgg cggaagttta cgccagtagc 2100

gatgcccacg agaagtttgt taaagacttc gtggcggcat gggtgaaagt gatgaacctc 2160

gaccgtttcg acctgctgga ttataaagat gatgatgata a 2201

<210> 3

<211> 507

<212> DNA

<213> glutathione peroxidase Gene (GPOUnknown)

<400> 3

atgtccgccg agaaaaccaa taccgctttc tacaacctcg ctccactcga caagaacgga 60

gagcctttcc ccttcaagca gcttgagggc aaggtcgtgc tcatcgtgaa cgtcgcctcc 120

aagtgtggct ttactcccca atacaagggc cttgaggagg tctaccagaa gtacaaggat 180

cagggattca ccatcatcgg cttcccctgc aaccagtttg gtggccaaga gcctggttcc 240

gctgacgaga tctcctcctt ctgtcagctg aactacggcg tcactttccc cgttcttcag 300

aagatcaacg tcaacggcaa cgacgccgac cccgtctacg tctacctgaa ggagcagaag 360

gctggtctgc tgggcttccg aggaatcaag tggaactttg agaagttcct ggttgataag 420

cacggtaacg tcgtcgaccg atatgcttcc ctcaagaccc ccgccggcct cgaatccacc 480

atcgagaccc tcctcaaaaa gccctaa 507

<210> 4

<211> 1413

<212> DNA

<213> glutathione disulfide reductase Gene (GSRUnknown)

<400> 4

atggcttcta tcccccatta tgactatctg gttatcggcg gaggctctgg aggtgttgct 60

tctgctcgtc gagccgcctc gtacggcgcc aaaacactgc tgatcgaggg caaggcgctg 120

ggaggcacct gcgtcaacgt gggctgtgtg cccaaaaagg tcatgtggaa cgcgtccgat 180

ctggcgggcc gaatccgaca ggccaaggag tacggcttcc ccgacgtgga ccccaagtac 240

gccgacaact ttgactggtc cggattcaag gccaagcgag acgcttacgt caagcgactc 300

aatggaatct acgaacgaaa cctccagaag gagggcgtcg agtacgtgtt tggctgggcc 360

accctctaca agcaggaggg ccaggagttc cccctggtac atgtcaagag cgacgacggc 420

aataccaagc tgtattctgc caagaagatt atgattgcca ccggcggaaa gccccgtctg 480

cccgacgtgc ctggagccga gtacggcatt gactccgacg gcttctttgc tctcgagacc 540

cagcccaagc gagtggcggt ggttggagga ggctacattg gcgtggagct ggctggtgtc 600

ttccacggac tcaactccga gaccaccctc ttctgccgag gccagacggt gctccgagcg 660

ttcgacatca tgatccagga caccatcacc gactactacg tcaaggaggg catcaacgtg 720

ctcaagggct ccggcgtcaa gaagattgtc aagaaggaca atggcgagct gctcgtcacc 780

tacgagcagg atggcgccga gaaggatatc actcttgact cacttatttg gaccattgga 840

cgagagcctc tcaaggacac cctcaacctc ggcgagtttg gcatcaagac caacaagcgg 900

ggctacattg aggtcgacga gtaccagcga tcgtccgttg acaacattta ctcgcttgga 960

gacgtttgcg gcaaggtcga gctaaccccc atggctattg ctgccggacg aaagctgtcc 1020

aaccggctgt ttggtcccac agagttcaag aaccagaagc aggactacac cgatgttcct 1080

tctgccgtct tttcccaccc cgaggttggc tccatcggta tcaccgaggc tgccgccaag 1140

gagcagtatg gcgaggagaa cgtcaaggtc tacacctcca agtttgtcgc catgtactac 1200

gccatgctcg aggagaaggc tcccaccgcc tacaagctgg tgtgtgccgg caaggacgag 1260

aaggttgttg gtctgcacat tgttggcgct gactctgccg agattctgca gggtttcggc 1320

gtggccattc gaatgggagc caccaaggcc gatttcgaca atgttgtggc tatccatccc 1380

acttctgccg aggagctggt gaccatgaga tag 1413

<210> 5

<211> 960

<212> DNA

<213> thioredoxin reductase Gene (TRXRUnknown)

<400> 5

atgacccaca gcccagttgt tatcatcggt tccggccccg ccgcccacac cgctgccatc 60

tacctttctc gagccgagat caagcccact ctctacgagg gaatgatggc caacggcatt 120

gctgccggcg gtcagctcac cactaccact gagattgaga acttccccgg cttccccgac 180

ggaatcatgg gctcccagct catggaggac atgcgaaagc agtccatccg attcggcacc 240

gagatcatca ccgagaccgt ctccaaggtc gatctgtccc agcgaccctt caagtactgg 300

accgagttca atgaggacga ggagccccac actgccgacg ccattattct tgccaccggt 360

gcctctgcca agcgactctc tctgcccggt gaggaccagt actggcagca gggtatctct 420

gcctgcgctg tctgtgacgg tgctgtcccc attttccgaa acaagcctct cgccgttgtc 480

ggaggaggag actctgccgc tgaggaggcc ctcttcctca ccaagtacgg ctccaaggtc 540

tacgtcattg tccgaaagga caagctgcga gcttccgccg ttatggccaa gcgactggcc 600

tcccacccca aggtcgagat tctcttcaac cacgtgtcca tcgaggccaa gggagacggc 660

aagctgctga acgccctgga gatcgagaac accctgaccg gcgagaagcg agacctcgag 720

gtcaacggtc tgttctacgc cattggtcac atccccgcca cctccatcgt caagggccag 780

gtcgagaccg acgaggaggg ctacgttgtt accgtccccg gtaccgccaa cacctccgtc 840

aagggtgtct ttgccgctgg tgatgtccag gacaagcgat accgacaggc cattacctct 900

gctggtaccg gctgcatggc tgctctcgac tgtgagaagc tgcttgctga ggaggaatag 960

<210> 6

<211> 1476

<212> DNA

<213> glucose hexaphosphate dehydrogenase gene (ZWFUnknown)

<400> 6

atggcggtaa cgcaaacagc ccaggcctgt gacctggtca ttttcggcgc gaaaggcgac 60

cttgcgcgtc gtaaattgct gccttccctg tatcaactgg aaaaagccgg tcagctcaac 120

ccggacaccc ggattatcgg cgtagggcgt gctgactggg ataaagcggc atataccaaa 180

gttgtccgcg aggcgctcga aactttcatg aaagaaacca ttgatgaagg tttatgggac 240

accctgagtg cacgtctgga tttttgtaat ctcgatgtca atgacactgc tgcattcagc 300

cgtctcggcg cgatgctgga tcaaaaaaat cgtatcacca ttaactactt tgccatgccg 360

cccagcactt ttggcgcaat ttgcaaaggg cttggcgagg caaaactgaa tgctaaaccg 420

gcacgcgtag tcatggagaa accgctgggg acgtcgctgg cgacctcgca ggaaatcaat 480

gatcaggttg gcgaatactt cgaggagtgc caggtttacc gtatcgacca ctatcttggt 540

aaagaaacgg tgctgaacct gttggcgctg cgttttgcta actccctgtt tgtgaataac 600

tgggacaatc gcaccattga tcatgttgag attaccgtgg cagaagaagt ggggatcgaa 660

gggcgctggg gctattttga taaagccggt cagatgcgcg acatgatcca gaaccacctg 720

ctgcaaattc tttgcatgat tgcgatgtct ccgccgtctg acctgagcgc agacagcatc 780

cgcgatgaaa aagtgaaagt actgaagtct ctgcgccgca tcgaccgctc caacgtacgc 840

gaaaaaaccg tacgcgggca atatactgcg ggcttcgccc agggcaaaaa agtgccggga 900

tatctggaag aagagggcgc gaacaagagc agcaatacag aaactttcgt ggcgatccgc 960

gtcgacattg ataactggcg ctgggccggt gtgccattct acctgcgtac tggtaaacgt 1020

ctgccgacca aatgttctga agtcgtggtc tatttcaaaa cacctgaact gaatctgttt 1080

aaagaatcgt ggcaggatct gccgcagaat aaactgacta tccgtctgca acctgatgaa 1140

ggcgtggata tccaggtact gaataaagtt cctggccttg accacaaaca taacctgcaa 1200

atcaccaagc tggatctgag ctattcagaa acctttaatc agacgcatct ggcggatgcc 1260

tatgaacgtt tgctgctgga aaccatgcgt ggtattcagg cactgtttgt acgtcgcgac 1320

gaagtggaag aagcctggaa atgggtagac tccattactg aggcgtgggc gatggacaat 1380

gatgcgccga aaccgtatca ggccggaacc tggggacccg ttgcctcggt ggcgatgatt 1440

acccgtgatg gtcgttcctg gaatgagttt gagtaa 1476

Claims

1. Recombinant Yarrowia lipolytica (Yarrowia lipolytica) for high yield of beta-carotene is characterized in that the recombinant Yarrowia lipolytica is obtained by expressing superoxide dismutase gene SOD1, catalase gene CAT, glutathione peroxidase gene GPO, glutathione disulfide reductase gene GSR, thioredoxin reductase gene TRXR, glucose hexaphosphate dehydrogenase gene ZWF, simultaneously expressing thioredoxin reductase gene TRXR and glutathione peroxidase gene GPO or simultaneously expressing thioredoxin reductase gene TRXR, glutathione peroxidase gene GPO and superoxide dismutase gene SOD1 in Yarrowia lipolytica strain YL-C6;

the nucleotide sequence of the superoxide dismutase gene SOD1 is shown as SEQ ID NO.1, the nucleotide sequence of the catalase gene CAT is shown as SEQ ID NO.2, the nucleotide sequence of the glutathione peroxidase gene GPO is shown as SEQ ID NO.3, the nucleotide sequence of the glutathione disulfide reductase gene GSR is shown as SEQ ID NO.4, the nucleotide sequence of the thioredoxin reductase gene TRXR is shown as SEQ ID NO.5, and the nucleotide sequence of the glucose hexaphosphate dehydrogenase gene ZWF is shown as SEQ ID NO. 6;

the yarrowia lipolytica strain YL-C6 is an engineered strain obtained by integrating the Hxk gene into the genome of yarrowia lipolytica Y.L-6 and carrying plasmid pJN44-tHMG-GGS 1-carRA-carB.

2. The method for constructing recombinant yarrowia lipolytica according to claim 1, comprising the steps of:

(1) Construction of plasmid vectors

To contain a promoter P _TEF Expression plasmid vector pJN44 of selective marker of terminator Txpr2 and Leu2 is used as vector to extract lipolytica yarrowia baseRespectively carrying out PCR amplification on the genes to obtain target genes SOD1, GPO, GSR and TRXR, respectively artificially synthesizing the target genes CAT and ZWF, respectively connecting the obtained target genes with a plasmid vector pJN44 to obtain plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR and pJN44-ZWF;

cutting off GPO genes from the plasmid pJN44-GPO and connecting the GPO genes to the plasmid pJN44-TRXR to construct a plasmid pJN44-TRXR-GPO;

the obtained plasmid is cut by restriction enzymes Hind III and Sma I, and the correctness is verified by agarose gel electrophoresis;

(2) Construction of recombinant yarrowia lipolytica Strain

Transforming the plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR, pJN44-ZWF, pJN44-TRXR-GPO and pJN44-TRXR-GPO-SOD1 obtained in the step (1) into yarrowia lipolytica YL-C6 respectively according to the using method of the yeast transformation kit, and culturing by using an SD-leu solid medium to obtain recombinant yarrowia lipolytica YL-C6 (JN 44-SOD 1), YL-C6 (JN 44-CAT), YL-C6 (JN 44-GPO), YL-C6 (JN 44-GSR), YL-C6 (JN 44-TRXR), YL-C6 (JN 44-ZWF), YL-C6 (JN 44-XR-GPO) and YL-TRXR-6 (JN 44-GPO-SOD);

the SD-leu solid culture medium comprises: 20g/L glucose, 1.7g/L YNB, 5g/L (NH) ₄ ） ₂ SO ₄ 2g/L SD-leu and 20g/L agar powder, wherein the YNB does not contain amino acid and ammonium sulfate.

3. Use of a recombinant yarrowia lipolytica strain according to claim 1 for the production of β -carotene.

4. The use according to claim 3, characterized in that the recombinant yarrowia lipolytica obtained is cultured in SD-leu liquid medium in a constant temperature shaker at 180-220rpm and 28-30 ℃ for 24-48h to obtain seed culture solution; then inoculating the seed culture solution into SD-leu liquid culture medium with an inoculation amount of 1-5%, and performing fermentation culture in a constant temperature shaking table at 180-220rpm and 28-30 ℃ for 4-6d; finally, inoculating the seed culture solution into a 50L bioreactor containing a fermentation culture medium by using the optimal strain in an inoculation amount of 1-5%, and fermenting and culturing for 4-6d under the conditions of temperature of 28-30 ℃, ventilation of 30-50L/min, rotation speed of 100-650rpm, oxygen of 10-20% and pH of 5.5-6.0;

the SD-leu liquid culture medium comprises: 20g/L glucose, 1.7g/L YNB, 5g/L (NH) ₄ ） ₂ SO ₄ 2g/L SD-leu, the YNB does not contain amino acid and ammonium sulfate;

the fermentation medium is as follows: 25g/L glucose, 10g/L yeast powder, 15g/L peptone and 5g/L (NH) ₄ ） ₂ SO ₄ 、2.5g/L KH ₂ PO ₄ 、2.5g/L K ₂ HPO ₄ 、0.5g/L MgSO ₄ 6g/L leucine and 1g/L biotin.