CN114686385A - Recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof - Google Patents

Abstract

The invention relates to recombinant yarrowia lipolytica for high yield of beta-carotene, which improves the yield of the beta-carotene by establishing an oxidative stress defense system in the yarrowia lipolytica, wherein the oxidative stress defense system expresses one or more of superoxide dismutase gene (SOD1), catalase gene (CAT), glutathione peroxidase Gene (GPO), glutathione disulfide reductase Gene (GSR), thioredoxin reductase gene (TRXR) and glucose hexaphosphate dehydrogenase gene (ZWF) in the yarrowia lipolytica strain. The recombinant yarrowia lipolytica strain reaches 105g/L DCW in a 50L fermentation tank, the yield of beta-carotene reaches 3201mg/L (30.49mg/g DCW), and the yield is improved by 37.2 percent on the basis of a control strain.

Description

Recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof

[ technical field ] A

The present invention belongs to the field of gene engineering technology. In particular to yarrowia lipolytica for high yield of beta-carotene, a method for constructing an oxidative stress defense system in yarrowia lipolytica and application of the obtained recombinant yeast in producing the beta-carotene.

[ background of the invention ]

The beta-carotene is a fat-soluble natural carotenoid which exists in green vegetables such as carrots, pawpaw and the like in the nature in an all-trans structure, has good functions of inhibiting singlet oxygen, resisting oxidation, quenching free radicals and the like due to the fact that the beta-carotene contains 11 conjugated carbon-carbon double bonds, has the functions of delaying senescence, preventing cancer, resisting cancer and the like, and can be applied to industries such as food, cosmetics, animal husbandry and the like.

Lipolytica is a safe oleaginous microorganism with a clear genetic background that provides sufficient precursor compounds and energy supply substances acetyl COA, NADPH and ATP in vivo. Acetyl COA is a precursor substance for producing beta-carotene, and liposomes independently existing in lipolytic yarrowia cells are beneficial to storing the beta-carotene. Thus YL was used to produce beta-carotene by genetic engineering. CN109666596A has beta-carotene synthesizing ability by integrating genes carRP, carB, GGS1, tHMG and the like derived from the beta-carotene synthesizing pathway of Mucor circinelloides into yarrowia lipolytica. Shan Qiang et al over-express the copy number of Hxk and erg13 to promote the utilization of glucose, increase downstream HMG-CoA, increase the content of beta-carotene, and knocking out gut2 to push glycerol to flow to a beta-carotene biosynthesis pathway, increasing the content of intracellular liposome, providing a larger storage space for the beta-carotene, expressing carRP, carB, GGS1 and tHMG genes in yarrowia lipolytica, fermentation in a 50L bioreactor yields of 2.4g/L of beta-Carotene [ Qiang Shan, Wang Jing, Xiong Xiao Chao, Qu Yu Ling, Liu Liang, Hu Ching Yuan, Meng Yong hong, promotion of the Synthesis of the prognosis of the by overexpression Hexokinase (Hxk) and Hydroxymethylation-CoA Synthase (Erg13) to the expression beta-Carotene Production in Engineered Yarrowia lipolytica [ J ]. Frontiers in microbiology,2020,11: ].

Oxygen supply plays an important role in fermentation in aerobic fermentation. Oxygen-mediated cell damage is an important problem in aerobic fermentation. It has been reported that reactive oxygen ROS accumulation is stimulated in cellular metabolism, and the generated ROS cause lipid peroxidation on cellular biofilms, disrupting membrane structure and function, and thus leading to interruption of DNA replication, loss of protein function and even cell death [ Lamonte Gregory, Tang Xiaohu, Chen Julia Ling-Yu, Wu Juanli, Ding Chien-Kuang Cornella, Keean Melissa M, Sangoya Carolyn, Kung Hsiu-Ni, Ilkayeva Olga, Boros L-szl G, Newga Chohtopher B, Chi Jen-Tsan. Acidosus indexes, amplifying of cell metallic to oxidative strain [ J ]. Cancer & metabolic, 2013,1(1): 1) ]. Some antioxidant enzymes are overexpressed to combat damage caused by blocking oxygen radicals and repair cells in time, and some people express several antioxidant enzymes to establish an oxidative stress defense system to scavenge free radicals and their products to increase DHA production [ Han Xiao, Li Zohui, Wen Ying, Chen Zhi. The main antioxidant enzymes include Glutathione Peroxidase (GPO), glutathione disulfide reductase (GSR), superoxide dismutase (SOD1), thioredoxin reductase (TRXR), aldehyde dehydrogenase (ALDH), Catalase (CAT), Peroxidase (POD) and the like, wherein the GSR and the TRXR need NADHP as reducing agents to resist oxidative stress. NADPH required for biosynthesis is mainly provided by the pentose phosphate pathway, wherein the main controlling enzyme for NADPH production is glucose hexaphosphate dehydrogenase (ZWF). At present, no one can increase the content of beta-carotene by establishing an oxidation defense system in yarrowia lipolytica.

[ summary of the invention ]

The invention aims to provide recombinant yarrowia lipolytica capable of producing beta-carotene in high yield.

Based on this, the idea of the present invention is to select and verify an appropriate antioxidant enzyme to further increase the yield of β -carotene by establishing an oxidative stress defense system in yarrowia lipolytica.

In view of the above objects, the present invention provides a recombinant yarrowia lipolytica producing high levels of β -carotene, characterized in that the recombinant yarrowia lipolytica is obtained by expressing one or more genes selected from the group consisting of superoxide dismutase gene (SOD1), catalase gene (CAT), glutathione peroxidase Gene (GPO), glutathione disulfide reductase Gene (GSR), thioredoxin reductase gene (TRXR) and/or glucose hexaphosphate dehydrogenase gene (ZWF) in yarrowia lipolytica strain YL-C6.

Preferably, the recombinant yarrowia lipolytica is obtained by expressing superoxide dismutase gene (SOD1), catalase gene (CAT), glutathione peroxidase Gene (GPO), glutathione disulfide reductase Gene (GSR), thioredoxin reductase gene (TRXR), glucose hexaphosphate dehydrogenase gene (ZWF), thioredoxin reductase gene (TRXR) and glutathione peroxidase Gene (GPO) simultaneously, or thioredoxin reductase gene (TRXR), glutathione peroxidase Gene (GPO) and superoxide dismutase gene (SOD1) simultaneously in yarrowia lipolytica strain YL-C6.

In the present invention, Yarrowia lipolytica strain YL-C6 is an Engineered strain obtained by integrating the Hxk gene into the genome of Yarrowia lipolytica yeast Y.L-6 according to the method provided in Qiang Shann et al, promoting the Synthesis of the preceding stators by Overexpressing Hexokinase (Hxk) and hydroxymethy gluteranyl-CoA synthetase (Erg13) to extract beta-Carotene Production in Engineered Yarrowia lipolytica [ J ]. Frontiers in microbiology,2020,11, and carrying plasmid pJN44-tHMG-GGS 1-carRA-carB. When cultured in a 50L fermenter, the final biomass of YL-C6 reached 82.1g/L, the maximum beta-carotene production was 2.4g/L, and the beta-carotene content reached 29.23mg/g DCW.

Among them, yarrowia lipolytica Y.L-6 combines Hxk and two erg13 copies into Y.L-1. These two genes were inserted into the gut2 locus chromosome of Y.L-1 using a linearized integration cassette (erg13-erg13-gut2-up-loxp-down) to obtain a genetically stable strain. Y.L-6 had a beta-carotene yield of 9.56mg/g DCW.

In the invention, the nucleotide sequence of superoxide dismutase gene (SOD1) is shown as SEQ ID NO.1, the nucleotide sequence of catalase gene (CAT) is shown as SEQ ID NO.2, the nucleotide sequence of glutathione peroxidase Gene (GPO) is shown as SEQ ID NO.3, the nucleotide sequence of glutathione disulfide reductase Gene (GSR) is shown as SEQ ID NO.4, the nucleotide sequence of thioredoxin reductase gene (TRXR) is shown as SEQ ID NO.5, and the nucleotide sequence of glucose hexaphosphate dehydrogenase gene (ZWF) is shown as SEQ ID NO. 6.

The invention also provides a construction method of the recombinant yarrowia lipolytica, which comprises the following steps:

(1) construction of plasmid vectors

To contain a promoter P_TEFExpression plasmid vectors pJN44 of selective markers of terminators Txpr2 and Leu2 are used as vectors, yarrowia lipolytica genomes are extracted, target genes SOD1, GPO, GSR and TRXR are obtained through PCR amplification respectively, target genes CAT and ZWF are artificially synthesized respectively, and the obtained target genes are connected with plasmid vectors pJN44 respectively to obtain plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR and pJN 44-ZWF;

excising the GPO gene from plasmid pJN44-GPO and ligating to plasmid pJN44-TRXR to construct plasmid pJN 44-TRXR-GPO;

the SOD1 gene was excised from plasmid pJN44-SOD1 and ligated to plasmid pJN44-TRXR-GPO to construct plasmid pJN44-TRXR-GPO-SOD 1;

(2) construction of recombinant yarrowia lipolytica Strain

According to the method for using the yeast transformation kit, the plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR, pJN44-ZWF, pJN44-TRXR-GPO and pJN44-TRXR-GPO-SOD1 obtained in the step (1) are respectively transformed into yarrowia lipolytica YL-C6, and cultured by using SD-leu solid medium to obtain recombinant yarrowia lipolytica YL-C6(pJN44-SOD pJN44), YL-C pJN44 (pJN44-CAT), YL-C pJN44 (pJN44-GPO), YL-C pJN44 (pJN44-GSR), YL-C pJN44 (pJN44-TRXR), YL-C4 (ZWF), YL-C pJN44 (pJN 44-TRXR-685), YL-C pJN44 (pJN 44-TRXR-pJN 44-685) and YL-TRXR-pJN 44-685 (pJN 44-685-pJN 44-685).

Furthermore, the invention also provides application of the recombinant yarrowia lipolytica strain in beta-carotene production.

According to a preferred embodiment, the obtained recombinant yarrowia lipolytica is cultured in SD-leu liquid medium in a constant temperature shaker at 180-220rpm and 28-30 ℃ for 24-48h to obtain a seed culture solution; then inoculating the seed culture solution into SD-leu liquid culture medium with an inoculation amount of 1-5%, and performing fermentation culture in a constant temperature shaking table at 180-220rpm and 28-30 ℃ for 4-6 days; finally, the optimal strain is inoculated with the seed culture solution into a 50L bioreactor containing a fermentation culture medium according to the inoculation amount of 1-5%, and fermentation culture is carried out for 4-6d under the conditions of the temperature of 28-30 ℃, the aeration rate of 30-50L/min, the rotation speed of 100-650rpm, the oxygen of 10-20% and the PH of 5.5-6.0.

More preferably, the SD-leu liquid medium is: 20g/L glucose, 1.7g/L YNB (without amino acid and ammonium sulfate), 5g/L (NH)₄)₂SO₄、2g/L SD-leu；

The fermentation medium is as follows: 25g/L glucose, 10g/L yeast powder, 15g/L peptone and 5g/L (NH)₄)₂SO₄、2.5g/L KH₂PO₄、2.5g/L K₂HPO₄、0.5g/L MgSO₄6g/L leucine and 1g/L biotin.

After the fermentation is finished, collecting cells, and detecting the content of beta-carotene by an HPLC method, wherein the method comprises the following steps:

extracting beta-carotene: taking 1mL of bacterial liquid, centrifuging, and collecting thalli; adding 500 mu L of dimethyl sulfoxide, and incubating for 15 minutes at 55 ℃; adding 500 mu L of acetone, incubating for 15 minutes at 45 ℃, and taking out and shaking every two minutes; centrifuging, taking the supernatant, and filtering the supernatant by using a 0.45-micron filter membrane in a liquid phase sample bottle for testing.

HPLC detection method: the chromatographic column is a C18 column (Diamonsil SB-C18 column, 4.6 mm. times.250 mm); the wavelength is as follows: 450 nm; the mobile phase is (v/v): methanol: acetonitrile: isopropanol 30: 50: 20; the flow rate is: 1 mL/min; the column temperature was 35 ℃ and elution was carried out by isocratic elution.

In a 50L fermentation tank, the cell biomass of the recombinant yarrowia lipolytica of the invention can reach 105g/L DCW at most, and the yield of beta-carotene can reach 3201mg/L (30.49mg/g DCW).

According to the invention, several antioxidant enzyme genes are overexpressed in yarrowia lipolytica chassis strain YL-C6, a combination of several enzyme genes with the best effect is screened out through fermentation, an oxidative stress defense system is established, the content of beta-carotene is improved, the cell biomass of a recombinant strain in shake flask fermentation reaches 12.3g/L DCW, and the yield of the beta-carotene reaches 394.83mg/L (32.1mg/g DCW); the cell biomass reached 105g/L DCW in a 50L fermenter, and the beta-carotene yield reached 3201mg/L (30.49mg/g DCW). The cell biomass of the control strain in the shake flask fermentation is 9.4g/L DCW, and the yield of beta-carotene reaches 296.1mg/L (31.5mg/g DCW); the cell biomass reached 80.6g/L DCW in a 50L fermenter, and the yield of beta-carotene reached 2333mg/L (29.16mg/g DCW). The yield of YL-C6 strain is improved by 37.2% on the basis of 2333mg/L, reaches 3201mg/L, and is obviously higher than the record of the prior art.

[ description of the drawings ]

FIG. 1 schematic representation of Chassis strain YL-C6

FIG. 2 is a diagram showing the mechanism of radical scavenging by several enzymes

FIG. 3 Shake flask fermentation results

FIG. 450L bioreactor fermentation results

FIG. 5 vector plasmid JN44 map

[ detailed description ] embodiments

The following examples serve to illustrate the technical solution of the present invention without limiting it.

In the present invention, "%" used for expression concentration is weight percent, ": "is a weight ratio.

The invention relates to the following engineering strains:

yarrowia lipolytica YL-C6: the Hxk gene was integrated into the genome of Yarrowia lipolytica Y.L-6 and obtained carrying plasmid pJN44-tHMG-GGS1-carRA-carB according to the method provided in Qiang Shan et al, promoting the Synthesis of the preceding stators by overexpression Hexokinase (Hxk) and hydroxymethy glutamyl-CoA synthsase (Erg13) to extract β -Carotene Production in Engineered Yarrowia lipolytica [ J ]. Frontiers in microbiology,2020, 11. According to the literature, fermentation in a 50L bioreactor gives a final biomass of YL-C6 of 82.1g/L, a maximum beta-carotene yield of 2.4g/L and a beta-carotene content of 29.23mg/g DCW.

Yarrowia lipolytica Y.L-6: the Hxk and two copies of erg13 were combined into Y.L-1 (i.e., the original strain). These two genes were inserted into the gut2 locus chromosome of Y.L-1 using a linearized integration cassette (erg13-erg13-gut2-up-loxp-down) to obtain a genetically stable strain. Y.L-6 had a beta-carotene yield of 9.56mg/g DCW.

The present invention relates to the following media:

LB liquid medium: 10g/L peptone, 10g/L NaCl and 5g/L yeast powder.

LB solid medium: 10g/L peptone, 10g/L NaCl, 5g/L yeast powder and 20g/L agar powder.

YPD liquid medium: 20g/L peptone, 20g/L glucose, 10g/L yeast powder

SD-leu liquid Medium: 20g/L glucose, 1.7g/L YNB (without amino acid and ammonium sulfate), 5g/L (NH)₄)₂SO₄、2g/L SD-leu。

SD-leu solid Medium: 20g/L glucose, 1.7g/L YNB (without amino acid and ammonium sulfate), 5g/L (NH)₄)₂SO₄2g/L SD-leu and 20g/L agar powder.

Fermentation medium: 25g/L glucose, 10g/L yeast powder, 15g/L peptone and 5g/L (NH)₄)₂SO₄、2.5g/L KH₂PO₄、2.5g/L K₂HPO₄、0.5g/L MgSO₄6g/L leucine and 1g/L biotin.

The method for detecting the content of the beta-carotene comprises the following steps:

extracting beta-carotene: taking 1mL of bacterial liquid, centrifuging, and collecting thalli; adding 500 mu L of dimethyl sulfoxide, and incubating for 15 minutes at 55 ℃; adding 500 mu L of acetone, incubating for 15 minutes at 45 ℃, and taking out and shaking every two minutes; centrifuging, taking the supernatant, and filtering the supernatant by using a 0.45-micron filter membrane in a liquid phase sample bottle for testing.

HPLC detection method: the chromatographic column is a C18 column (Diamonsil SB-C18 column, 4.6 mm. times.250 mm); the wavelength is as follows: 450 nm; the mobile phase is (v/v): methanol: acetonitrile: isopropanol 30: 50: 20; the flow rate is: 1 mL/min; the column temperature was 35 ℃ and elution was carried out by isocratic elution.

Example 1: recombinant yarrowia lipolytica strains expressing single gene of interest

(1) Construction of an expression plasmid containing a Single Gene of interest

a) Extracting the original strain yarrowia lipolytica (Y.lipolytica) genome. Taking 1mL of bacterial liquid, centrifuging, and discarding the supernatant; adding 200 mu L of 200mM LioAc and 1% SDS solution, shaking and mixing uniformly; performing metal bath at 70 ℃ for 15 min; an equal volume (200 μ L) of saturated phenol was added: chloroform: performing vortex oscillation on an isoamyl alcohol (25:24:1, v/v) solution until the solution is milk white, and centrifuging for 10 min; absorbing the water phase into a new sterilized 1.5mL centrifuge tube, adding isopropanol with the same volume, and uniformly mixing; standing at-20 deg.C for 1-2h, and centrifuging at 12000 Xg for 10min to obtain DNA; adding 1mL of 70 vol% ethanol to wash the DNA (repeating for 2 times), centrifuging for 4min, and removing the supernatant; reversely buckling the centrifugal tube containing the DNA on clean filter paper for 15min, and carrying out metal bath at 50 ℃ for 2min to completely volatilize the ethanol; the DNA was dissolved in 10-20. mu.L of deionized water and stored at-20 ℃ for further use.

b) Target genes SOD1(YALI0-E12133g), GPO (YAL10-E02310g), GSR (YAL10-E18029g) and TRXR (YAL10-D27126g) of 4 antioxidant enzymes are found at NCBI, primers are designed according to gene sequences, proper enzyme cutting sites are inserted according to vectors during design, the primers are sent to Nanjing King Shirui biotechnology limited for synthesis, and the target genes are amplified from the genome of original strain yarrowia lipolytica (Y.lipolytica) by utilizing a PCR technology.

SOD1-FOR：TCCCCCGGGATGGTCAAGGCTGGTGAGTA

SOD1-REV：AAACTGCAGTTAGGCGGTAAGACCAATGA

GPO-FOR：CTCCCCGGGATGTCCGCCGAGAAAACCAA

GPO-REV：CCCAAGCTTTTAGGGCTTTTTGAGGAGGG

GSR-FOR：CTCCCCGGGATGGCTTCTATCCCCCATTA

GSR-REV：CCCAAGCTTCTATCTCATGGTCACCAGCT

TRXR-FOR：AAACTGCAGATGACCCACAGCCCAGTTGT

TRXR-REV：CGCGTCGACCTATTCCTCCTCAGCAAGCA

In addition, CAT and ZWF genes from e.coli ATCC 98082 were synthesized by shanghai bio ltd.

c) Treating the vector pJN44 and target gene fragments GPO and GSR with restriction enzymes Xma I and Hind III at 37 deg.C for 2h for enzyme digestion; treating the vector pJN44 and target gene fragments SOD1, CAT and ZWF with restriction enzymes Sma I and PstI at 37 ℃ for 2h respectively for enzyme digestion; the vector pJN44 and the target gene fragment TRXR were digested with restriction enzymes PstI and SalI, respectively, by treating for 2h at 37 ℃. Respectively carrying out electrophoresis on the enzyme-cut vector and the target gene by using 1% agarose gel, respectively cutting off the required fragments under a gel imager, and recovering the DNA fragments of the target gene and the vector by using a gel recovery kit (AxyGen); the recovered vector fragment and the target fragment were ligated by T4 DNA ligase (Thermo Fisher), transformed into E.coli Trans 5. alpha. and spread uniformly on LB solid medium containing 100. mu.g/mL ampicillin (yeast extract 5g/L, peptone 10g/L, agar powder 17g/L), cultured overnight at 37 ℃, single colonies were picked up on LB liquid medium containing 100. mu.g/mL ampicillin, cultured overnight at 37 ℃, plasmids were extracted with plasmid extraction kit (AxyGen), and expression plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR and pJN44-ZWF were obtained, respectively.

The expression plasmid is verified to be cut by restriction enzymes Hind III and Sma I, agarose gel electrophoresis and photo checking under a gel imager, and the expression of the correct expression plasmid in the yarrowia lipolytica YL-C6 is verified.

(2) Construction of recombinant yarrowia lipolytica Strain expressing 1 target Gene

The preserved yarrowia lipolytica YL-C6 strain was inoculated into 2mL YPD liquid medium, and cultured at 30 ℃ for 24h in a shaker at 180rpm for activation.

The 6 expression plasmids obtained in (1) were each expressed according to the method of a Yeast Transformation Kit (Frozen-EZ Yeast Transformation II Kit): taking 1mL of cultured yarrowia lipolytica YL-C6 bacterial liquid in a centrifuge tube, centrifuging for 4min at 4000 Xg, and discarding the supernatant; adding 500 μ L solution I, mixing by vortex, centrifuging at 4000 × g for 4min, and removing supernatant; adding 50 μ L of solution II, and uniformly mixing and suspending by blowing and sucking with a gun; adding 5 mu L of plasmid to be transformed, shaking and mixing uniformly; adding 500 μ L solution III, mixing by vortex, culturing at 30 deg.C and 225rpm for 2 hr, coating on corresponding auxotrophic SD-leu solid screening plate, and culturing at 30 deg.C for 3-4 d. Obtaining recombinant yarrowia lipolytica YL-C6(pJN44-SOD1), YL-C6(pJN44-CAT), YL-C6(pJN44-GPO), YL-C6(pJN44-GSR), YL-C6(pJN44-TRXR), YL-C6(pJN 44-ZWF).

(3) Application of recombinant yarrowia lipolytica strain in production of beta-carotene

Respectively culturing 6 recombinant yarrowia lipolytica strains obtained in the step (2) on SD-leu solid culture media at 30 ℃ for 3 days for activation, selecting a single colony to be inoculated into a small bottle of SD-leu liquid seed culture medium of 10mL/50mL, and carrying out shake-flask culture for 48h at 30 ℃ under the condition of 200 r/min; then, the cells were inoculated into SD-leu liquid medium of 50mL/250mL in an inoculum size of 2%, fermented at 30 ℃ for 120 hours at 200r/min, and then collected, and the content of beta-carotene was measured, and the results are shown in FIG. 3 and Table 1.

Analysis and detection results show that the expression of the over-expressed antioxidant enzyme gene has little influence on the content of the beta-carotene, but the cell biomass is obviously increased, so that the yield of the beta-carotene is increased, the yield is increased from 296.1mg/L to 394.83mg/L, and is increased by 33.34%. After a single enzyme is expressed, in a shake flask fermentation experiment, the most obvious improvement of cell biomass and beta-carotene content is a recombinant bacterium for expressing TRXR gene, and then GPO, SOD1, ZWF, CAT and GSR are sequentially carried out.

Example 2: recombinant yarrowia lipolytica strain expressing multiple genes

(1) Construction of an expression plasmid containing multiple genes of interest

TRXR and GPO were ligated together into vector JN 44: treating the plasmid pJN44-GPO obtained in example 1 with restriction enzymes XbaI and SpeI at 37 ℃ for 2h for enzyme digestion, treating the plasmid pJN44-TRXR obtained in example 1 at 37 ℃ for 2h with restriction enzyme SpeI for enzyme digestion, carrying out electrophoresis on 1% agarose gel, cutting a linear fragment of a target gene GPO and a vector pJN44-TRXR under a gel imager, and respectively carrying out gel recovery by a gel recovery kit (AxyGen) to obtain DNA fragments of the target gene and the vector; connecting the recovered vector pJN44-TRXR and the target gene GPO under the action of T4 DNA ligase (Thermo Fisher), transforming the vector into E.coli Trans5 alpha, uniformly coating the vector on an LB solid culture medium containing 100 mu g/mL ampicillin, culturing overnight at 37 ℃, picking a single colony to an LB liquid culture medium containing 100 mu g/mL ampicillin, culturing overnight at 37 ℃, extracting plasmids by using a plasmid extraction kit (AxyGen), and performing enzyme digestion verification by using restriction enzymes XbaI and NsiI to obtain the expression plasmid pJN 44-TRXR-GPO.

TRXR, GPO and SOD1 were ligated together onto vector JN 44: treating plasmid pJN44-SOD1 at 37 ℃ for 2h by using restriction enzymes XbaI and SpeI for enzyme digestion, treating plasmid pJN44-TRXR-GPO at 37 ℃ for 2h by using restriction enzymes SpeI for enzyme digestion, performing 1% agarose gel electrophoresis, cutting a linear fragment of a target gene SOD1 and a vector pJN44-TRXR-GPO under a gel imager, and performing gel recovery by using a gel recovery kit (AxyGen) to respectively recover DNA fragments of the target gene and the vector; the recovered vector pJN44-TRXR-GPO and the target gene SOD1 are connected under the action of T4 DNA ligase (Thermo Fisher), transformed into E.coli Trans5 alpha, uniformly coated on an LB solid culture medium containing 100 mu g/mL ampicillin, cultured overnight at 37 ℃, single colonies are picked up to an LB liquid culture medium containing 100 mu g/mL ampicillin, cultured overnight at 37 ℃, plasmids are extracted by a plasmid extraction kit (AxyGen), and restriction enzymes XbaI and NsiI are used for enzyme digestion verification, so that the expression plasmid pJN44-TRXR-GPO-SOD1 is obtained.

(2) Construction of recombinant strains expressing multiple genes of interest

The 2 expression plasmids obtained in (1) were each expressed according to the method of a Yeast Transformation Kit (Frozen-EZ Yeast Transformation II Kit): 1mL of bacterial liquid is taken out of a centrifugal tube, centrifuged for 4min at 4000 Xg, and the supernatant is discarded; adding 500 μ L solution I, mixing by vortex, centrifuging at 4000 Xg for 4min, and removing supernatant; adding 50 μ L of solution II, and uniformly mixing and suspending by blowing and sucking with a gun; adding 5 mu L of plasmid to be transformed, shaking and mixing uniformly; adding 500 μ L solution III, mixing by vortex, culturing at 30 deg.C and 225rpm for 2h, spreading on corresponding auxotrophic SD-leu solid screening plate, and culturing at 30 deg.C for 3-4 d. Recombinant yarrowia lipolytica YL-C6(pJN44-TRXR-GPO) and YL-C6(pJN44-TRXR-GPO-SOD1) are obtained.

(3) Application of yarrowia lipolytica recombinant strain in production of beta-carotene

Respectively culturing 2 recombinant yarrowia lipolytica strains obtained in the step (2) on SD-leu solid culture media at 30 ℃ for 3 days for activation, selecting a single colony to be inoculated into 10mL/50mL of vial liquid SD-leu seed culture media, and carrying out shake flask culture for 48h at 30 ℃ and 200 r/min; then, the cells were inoculated into 50mL/250mL of liquid SD-leu medium at an inoculum size of 2%, fermented at 30 ℃ for 120 hours at 200r/min, collected, and extracted and tested for the content of beta-carotene as described above, and the results are shown in FIG. 3 and Table 1.

Analysis and detection results show that the effect difference between the TRXR-GPO gene for expressing two enzymes and the TRXR-GPO-SOD1 gene for expressing three enzymes is not large, too much gene expression can cause the metabolic burden of bacteria, so that the ideal effect can be achieved by expressing the TRXR and GPO genes, and the cell biomass of YL-C6(pJN44-TRXR-GPO) in the shake flask fermentation reaches 12.3g/LDCW, and the yield of beta-carotene reaches 394.83mg/L (32.1mg/g DCW).

Example 3: application of recombinant yarrowia lipolytica strain in production of beta-carotene

After the recombinant yarrowia lipolytica strain YL-C6(pJN44-TRXR-GPO) obtained in example 2 was cultured on SD-leu solid medium at 30 ℃ for 3 days for activation, single colonies were picked up and inoculated into 50mL/250mL liquid SD-leu medium, and cultured at 30 ℃ for 24h at 200 r/min; the mixture was inoculated in a 50L bioreactor containing fermentation medium at an inoculum size of 2% for fermentation.

The fermentation conditions of the fermentation tank are as follows: the temperature is 30 ℃, the ventilation is 30-50L/min, the rotation speed is 100-650rpm, the oxygen is controlled to be 10-20 percent, the PH is 5.8, and the sugar in the fermentation tank is maintainedThe content is 5-10g/L, and after 8h of fermentation, 45g of yeast powder, (NH) is added₄)₂SO₄30g, and 2g of biotin is added after 20 hours. Fermenting for 160 hours, collecting thallus when the content of beta-carotene does not increase for 4 hours as the fermentation end point, processing bacterial liquid, measuring the yield of beta-carotene in the sample, and performing the extraction and detection methods as above, wherein the result is shown in figure 4.

The cell biomass reached 105g/L DCW in a 50L fermenter, and the beta-carotene yield reached 3201mg/L (30.49mg/g DCW).

Comparative example 1: construction of reference strain and application thereof in beta-carotene production

(1) Construction of control strains

Plasmid JN44 was transformed into yarrowia lipolytica strain YL-C6 by the same method as described above using the Yeast Transformation Kit (Frozen-EZ Yeast Transformation II Kit) to give yarrowia lipolytica strain YL-C6(JN 44).

(2) Application of control strain in beta-carotene production

Taking yarrowia lipolytica strain YL-C6(JN44) as a control strain, culturing for 3 days at 30 ℃ on an SD-leu solid culture medium for activation, selecting a single colony, inoculating a small bottle of liquid YPD with the volume of 10mL/50mL, transferring the single colony into a liquid YPD with the volume of 50mL/250mL, fermenting for 120 hours at 30 ℃ under the condition of 200r/min, collecting cells, detecting the content of beta-carotene, and performing the extraction and detection methods as above.

The cell biomass of the control strain in the shake flask fermentation reaches 9.4g/L DCW, and the yield of beta-carotene reaches 296.1mg/L (31.5mg/g DCW);

culturing a control strain YL-C6(pJN44) on an SD-leu solid culture medium at 30 ℃ for 3 days for activation, then picking a single colony to inoculate into a liquid SD-leu culture medium with the concentration of 50mL/250mL, and culturing for 24 hours at the temperature of 30 ℃ and at the speed of 200 r/min; the mixture was inoculated in a 50L bioreactor containing fermentation medium at an inoculum size of 2% for fermentation.

The fermentation conditions of the fermentation tank are as follows: the temperature is 30 ℃, the ventilation is 30-50L/min, the rotating speed is 100-650rpm, the oxygen is controlled to be 10-20 percent, the PH is 5.8, the sugar content in the fermentation tank is maintained to be 5-10g/L, and after 8 hours of fermentation, 45g of yeast powder, (NH) is added₄)₂SO₄30g, and 2g of biotin is added after 20 hours. Fermenting for 140h, collecting thallus with 4h beta-carotene content not increased as fermentation end point, processing bacterial liquid, measuring beta-carotene output of the sample, and extracting and detecting the same.

The cell biomass reached 80.6g/L DCW in a 50L fermenter, and the yield of beta-carotene reached 2333mg/L (29.16mg/g DCW). The result is substantially consistent with the final biomass of 82.1g/L, the maximum yield of beta-carotene of 2.4g/L and the beta-carotene content of 29.23mg/g DCW described in the prior art.

Therefore, when the fermentation of the fermentation tank is stopped, the cell amount of the obtained strain YL-C6(pJN44-TRXR-GPO) is 130.27% of that of the control group, and the yield of the beta-carotene is 137.21% of that of the control group. Proves that the yield of the beta-carotene can be effectively improved by establishing an oxidative stress defense system in the yarrowia lipolytica.

Sequence listing

<110> Shaanxi Haas Schff bioengineering GmbH

<120> recombinant yarrowia lipolytica for high yield of beta-carotene, construction method and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 761

<212> DNA

<213> superoxide dismutase gene (SOD1Unknown)

<400> 1

atggtcaagg ctggtgagta cgagagcaag gcccggaatc gggcacattg agcggccagc 60

gggtcaattg aaggccgctc gaccggtcca cacccacagg ttggccgcta cgttgacttc 120

gacaaccgtc tggaaggtgg cggaacgttg cgccgtgtga ggtggcaggt gactcagaag 180

ttgctcattg tttgttgaga tcagacccca caagcacaat tgcattttag gagggaattg 240

agagccctac ctcacggaat agtccatgtc gttgttcgcc acttgcccac actgcacatt 300

ctaacccagt cgctgttctt cgaggagatt ccaaggtctc cggtactgtc actttcgagc 360

aggactctga gtccggcccc gtcactgtca cctacgacat caagggcaac gatcccaacg 420

ctgagcgagg attccacgtc cacgagtttg gtgacaacac caacggctgc acttctgccg 480

gcccccactt caaccccttc aagaagaacc acggtggtcc caccgactct gagcgacacg 540

ttggtgacct cggaaacgtc aagactgact ctgagggtgt tgccaagggt gttctcaagg 600

actctcttct caagctgact ggtgacaact ccattgttgg ccgaaccgtc gttatccacg 660

gtggtgagga cgatcttgga aagggtggcc atgccgactc tctcaagacc ggaaacgctg 720

gccctcgacc cgcctgcggt gtcattggtc ttaccgccta a 761

<210> 2

<211> 2201

<212> DNA

<213> Catalase Gene (CATUnknown)

<400> 2

atgagcacgt cagacgatat ccataacacc acagccactg gcaaatgccc gttccatcag 60

ggcggtcacg accagagtgc gggggcgggc acaaccactc gcgactggtg gccaaatcaa 120

cttcgtgttg acctgttaaa ccaacattct aatcgttcta acccactggg tgaggacttt 180

gactaccgca aagaattcag caaattagat tactacggcc tgaaaaaaga tctgaaagcc 240

ctgttgacag aatctcaacc gtggtggcca gccgactggg gcagttacgc cggtctgttt 300

attcgtatgg cctggcacgg cgcggggact taccgttcaa tcgatggacg cggtggcgcg 360

ggtcgtggtc agcaacgttt tgcaccgctg aactcctggc cggataacgt aagcctcgat 420

aaagcgcgtc gcctgttgtg gccaatcaaa cagaaatatg gtcagaaaat ctcctgggcc 480

gacctgttta tcctcgcggg taacgtggcg ctagaaaact ccggcttccg taccttcggt 540

tttggtgccg gtcgtgaaga cgtctgggaa ccggatctgg atgttaactg gggtgatgaa 600

aaagcctggc tgactcaccg tcatccggaa gcgctggcga aagcaccgct gggtgcaacc 660

gagatgggtc tgatttacgt taacccggaa ggcccggatc acagcggcga accgctttct 720

gcggcagcag ctatccgcgc gaccttcggc aacatgggca tgaacgacga agaaaccgtg 780

gcgctgattg cgggtggtca tacgctgggt aaaacccacg gtgccggtcc gacatcaaat 840

gtaggtcctg atccagaagc tgcaccgatt gaagaacaag gtttaggttg ggcgagcact 900

tacggcagcg gcgttggcgc agatgccatt acctctggtc tggaagtagt ctggacccag 960

acgccgaccc agtggagcaa ctatttcttc gagaacctgt tcaagtatga gtgggtacag 1020

acccgcagcc cggctggcgc aatccagttc gaagcggtag acgcaccgga aattatcccg 1080

gatccgtttg atccgtcgaa gaaacgtaaa ccgacaatgc tggtgaccga cctgacgctg 1140

cgttttgatc ctgagttcga gaagatctct cgtcgtttcc tcaacgatcc gcaggcgttc 1200

aacgaagcct ttgcccgtgc ctggttcaaa ctgacgcaca gggatatggg gccgaaatct 1260

cgctacatcg ggccggaagt gccgaaagaa gatctgatct ggcaagatcc gctgccgcag 1320

ccgatctaca acccgaccga gcaggacatt atcgatctga aattcgcgat tgcggattct 1380

ggtctgtctg ttagtgagct ggtatcggtg gcctgggcat ctgcttctac cttccgtggt 1440

ggcgacaaac gcggtggtgc caacggtgcg cgtctggcat taatgccgca gcgcgactgg 1500

gatgtgaacg ccgcagccgt tcgtgctctg cctgttctgg agaaaatcca gaaagagtct 1560

ggtaaagcct cgctggcgga tatcatagtg ctggctggtg tggttggtgt tgagaaagcc 1620

gcaagcgccg caggtttgag cattcatgta ccgtttgcgc cgggtcgcgt tgatgcgcgt 1680

caggatcaga ctgacattga gatgtttgag ctgctggagc caattgctga cggtttccgt 1740

aactatcgcg ctcgtctgga cgtttccacc accgagtcac tgctgatcga caaagcacag 1800

caactgacgc tgaccgcgcc ggaaatgact gcgctggtgg gcggcatgcg tgtactgggt 1860

gccaacttcg atggcagcaa aaacggcgtc ttcactgacc gcgttggcgt attgagcaat 1920

gacttcttcg tgaacttgct ggatatgcgt tacgagtgga aagcgaccga cgaatcgaaa 1980

gagctgttcg aaggccgtga ccgtgaaacc ggcgaagtga aatttacggc cagccgtgcg 2040

gatctggtgt ttggttctaa ctccgtcctg cgtgcggtgg cggaagttta cgccagtagc 2100

gatgcccacg agaagtttgt taaagacttc gtggcggcat gggtgaaagt gatgaacctc 2160

gaccgtttcg acctgctgga ttataaagat gatgatgata a 2201

<210> 3

<211> 507

<212> DNA

<213> glutathione peroxidase Gene (GPOUnknown)

<400> 3

atgtccgccg agaaaaccaa taccgctttc tacaacctcg ctccactcga caagaacgga 60

gagcctttcc ccttcaagca gcttgagggc aaggtcgtgc tcatcgtgaa cgtcgcctcc 120

aagtgtggct ttactcccca atacaagggc cttgaggagg tctaccagaa gtacaaggat 180

cagggattca ccatcatcgg cttcccctgc aaccagtttg gtggccaaga gcctggttcc 240

gctgacgaga tctcctcctt ctgtcagctg aactacggcg tcactttccc cgttcttcag 300

aagatcaacg tcaacggcaa cgacgccgac cccgtctacg tctacctgaa ggagcagaag 360

gctggtctgc tgggcttccg aggaatcaag tggaactttg agaagttcct ggttgataag 420

cacggtaacg tcgtcgaccg atatgcttcc ctcaagaccc ccgccggcct cgaatccacc 480

atcgagaccc tcctcaaaaa gccctaa 507

<210> 4

<211> 1413

<212> DNA

<213> glutathione disulfide reductase Gene (GSRUnknown)

<400> 4

atggcttcta tcccccatta tgactatctg gttatcggcg gaggctctgg aggtgttgct 60

tctgctcgtc gagccgcctc gtacggcgcc aaaacactgc tgatcgaggg caaggcgctg 120

ggaggcacct gcgtcaacgt gggctgtgtg cccaaaaagg tcatgtggaa cgcgtccgat 180

ctggcgggcc gaatccgaca ggccaaggag tacggcttcc ccgacgtgga ccccaagtac 240

gccgacaact ttgactggtc cggattcaag gccaagcgag acgcttacgt caagcgactc 300

aatggaatct acgaacgaaa cctccagaag gagggcgtcg agtacgtgtt tggctgggcc 360

accctctaca agcaggaggg ccaggagttc cccctggtac atgtcaagag cgacgacggc 420

aataccaagc tgtattctgc caagaagatt atgattgcca ccggcggaaa gccccgtctg 480

cccgacgtgc ctggagccga gtacggcatt gactccgacg gcttctttgc tctcgagacc 540

cagcccaagc gagtggcggt ggttggagga ggctacattg gcgtggagct ggctggtgtc 600

ttccacggac tcaactccga gaccaccctc ttctgccgag gccagacggt gctccgagcg 660

ttcgacatca tgatccagga caccatcacc gactactacg tcaaggaggg catcaacgtg 720

ctcaagggct ccggcgtcaa gaagattgtc aagaaggaca atggcgagct gctcgtcacc 780

tacgagcagg atggcgccga gaaggatatc actcttgact cacttatttg gaccattgga 840

cgagagcctc tcaaggacac cctcaacctc ggcgagtttg gcatcaagac caacaagcgg 900

ggctacattg aggtcgacga gtaccagcga tcgtccgttg acaacattta ctcgcttgga 960

gacgtttgcg gcaaggtcga gctaaccccc atggctattg ctgccggacg aaagctgtcc 1020

aaccggctgt ttggtcccac agagttcaag aaccagaagc aggactacac cgatgttcct 1080

tctgccgtct tttcccaccc cgaggttggc tccatcggta tcaccgaggc tgccgccaag 1140

gagcagtatg gcgaggagaa cgtcaaggtc tacacctcca agtttgtcgc catgtactac 1200

gccatgctcg aggagaaggc tcccaccgcc tacaagctgg tgtgtgccgg caaggacgag 1260

aaggttgttg gtctgcacat tgttggcgct gactctgccg agattctgca gggtttcggc 1320

gtggccattc gaatgggagc caccaaggcc gatttcgaca atgttgtggc tatccatccc 1380

acttctgccg aggagctggt gaccatgaga tag 1413

<210> 5

<211> 960

<212> DNA

<213> thioredoxin reductase Gene (TRXRUnknown)

<400> 5

atgacccaca gcccagttgt tatcatcggt tccggccccg ccgcccacac cgctgccatc 60

tacctttctc gagccgagat caagcccact ctctacgagg gaatgatggc caacggcatt 120

gctgccggcg gtcagctcac cactaccact gagattgaga acttccccgg cttccccgac 180

ggaatcatgg gctcccagct catggaggac atgcgaaagc agtccatccg attcggcacc 240

gagatcatca ccgagaccgt ctccaaggtc gatctgtccc agcgaccctt caagtactgg 300

accgagttca atgaggacga ggagccccac actgccgacg ccattattct tgccaccggt 360

gcctctgcca agcgactctc tctgcccggt gaggaccagt actggcagca gggtatctct 420

gcctgcgctg tctgtgacgg tgctgtcccc attttccgaa acaagcctct cgccgttgtc 480

ggaggaggag actctgccgc tgaggaggcc ctcttcctca ccaagtacgg ctccaaggtc 540

tacgtcattg tccgaaagga caagctgcga gcttccgccg ttatggccaa gcgactggcc 600

tcccacccca aggtcgagat tctcttcaac cacgtgtcca tcgaggccaa gggagacggc 660

aagctgctga acgccctgga gatcgagaac accctgaccg gcgagaagcg agacctcgag 720

gtcaacggtc tgttctacgc cattggtcac atccccgcca cctccatcgt caagggccag 780

gtcgagaccg acgaggaggg ctacgttgtt accgtccccg gtaccgccaa cacctccgtc 840

aagggtgtct ttgccgctgg tgatgtccag gacaagcgat accgacaggc cattacctct 900

gctggtaccg gctgcatggc tgctctcgac tgtgagaagc tgcttgctga ggaggaatag 960

<210> 6

<211> 1476

<212> DNA

<213> glucose hexaphosphate dehydrogenase gene (ZWFUnknown)

<400> 6

atggcggtaa cgcaaacagc ccaggcctgt gacctggtca ttttcggcgc gaaaggcgac 60

cttgcgcgtc gtaaattgct gccttccctg tatcaactgg aaaaagccgg tcagctcaac 120

ccggacaccc ggattatcgg cgtagggcgt gctgactggg ataaagcggc atataccaaa 180

gttgtccgcg aggcgctcga aactttcatg aaagaaacca ttgatgaagg tttatgggac 240

accctgagtg cacgtctgga tttttgtaat ctcgatgtca atgacactgc tgcattcagc 300

cgtctcggcg cgatgctgga tcaaaaaaat cgtatcacca ttaactactt tgccatgccg 360

cccagcactt ttggcgcaat ttgcaaaggg cttggcgagg caaaactgaa tgctaaaccg 420

gcacgcgtag tcatggagaa accgctgggg acgtcgctgg cgacctcgca ggaaatcaat 480

gatcaggttg gcgaatactt cgaggagtgc caggtttacc gtatcgacca ctatcttggt 540

aaagaaacgg tgctgaacct gttggcgctg cgttttgcta actccctgtt tgtgaataac 600

tgggacaatc gcaccattga tcatgttgag attaccgtgg cagaagaagt ggggatcgaa 660

gggcgctggg gctattttga taaagccggt cagatgcgcg acatgatcca gaaccacctg 720

ctgcaaattc tttgcatgat tgcgatgtct ccgccgtctg acctgagcgc agacagcatc 780

cgcgatgaaa aagtgaaagt actgaagtct ctgcgccgca tcgaccgctc caacgtacgc 840

gaaaaaaccg tacgcgggca atatactgcg ggcttcgccc agggcaaaaa agtgccggga 900

tatctggaag aagagggcgc gaacaagagc agcaatacag aaactttcgt ggcgatccgc 960

gtcgacattg ataactggcg ctgggccggt gtgccattct acctgcgtac tggtaaacgt 1020

ctgccgacca aatgttctga agtcgtggtc tatttcaaaa cacctgaact gaatctgttt 1080

aaagaatcgt ggcaggatct gccgcagaat aaactgacta tccgtctgca acctgatgaa 1140

ggcgtggata tccaggtact gaataaagtt cctggccttg accacaaaca taacctgcaa 1200

atcaccaagc tggatctgag ctattcagaa acctttaatc agacgcatct ggcggatgcc 1260

tatgaacgtt tgctgctgga aaccatgcgt ggtattcagg cactgtttgt acgtcgcgac 1320

gaagtggaag aagcctggaa atgggtagac tccattactg aggcgtgggc gatggacaat 1380

gatgcgccga aaccgtatca ggccggaacc tggggacccg ttgcctcggt ggcgatgatt 1440

acccgtgatg gtcgttcctg gaatgagttt gagtaa 1476

Claims (7)

1. The recombinant yarrowia lipolytica for high yield of beta-carotene is characterized in that the recombinant yarrowia lipolytica is obtained by expressing one or more genes of superoxide dismutase gene (SOD1), catalase gene (CAT), glutathione peroxidase Gene (GPO), glutathione disulfide reductase Gene (GSR), thioredoxin reductase gene (TRXR) and/or glucose hexaphosphate dehydrogenase gene (ZWF) in yarrowia lipolytica strain YL-C6.

2. The recombinant yarrowia lipolytica of claim 1, wherein the recombinant yarrowia lipolytica is obtained by expressing superoxide dismutase gene (SOD1), catalase gene (CAT), glutathione peroxidase Gene (GPO), glutathione disulfide reductase Gene (GSR), thioredoxin reductase gene (TRXR), glucose hexaphosphate dehydrogenase gene (ZWF), simultaneous expression of thioredoxin reductase gene (TRXR) and glutathione peroxidase Gene (GPO), or simultaneous expression of thioredoxin reductase gene (TRXR) and glutathione peroxidase Gene (GPO) and superoxide dismutase gene (SOD1) in yarrowia lipolytica strain YL-C6.

3. The recombinant yarrowia lipolytica of claim 1, characterized in that the nucleotide sequence of the superoxide dismutase gene (SOD1) is shown as SEQ ID No.1, the nucleotide sequence of the catalase gene (CAT) is shown as SEQ ID No.2, the nucleotide sequence of the glutathione peroxidase Gene (GPO) is shown as SEQ ID No.3, the nucleotide sequence of the glutathione disulfide reductase Gene (GSR) is shown as SEQ ID No.4, the nucleotide sequence of the thioredoxin reductase gene (TRXR) is shown as SEQ ID No.5, and the nucleotide sequence of the glucose hexaphosphate dehydrogenase gene (ZWF) is shown as SEQ ID No. 6.

4. The method for constructing recombinant yarrowia lipolytica according to claim 1 or 3, comprising the steps of:

(1) construction of plasmid vectors

To contain a promoter P_TEFExpression plasmid vectors pJN44 of selective markers of terminators Txpr2 and Leu2 are used as vectors, yarrowia lipolytica genomes are extracted, target genes SOD1, GPO, GSR and TRXR are obtained through PCR amplification respectively, target genes CAT and ZWF are artificially synthesized respectively, and the obtained target genes are connected with plasmid vectors pJN44 respectively to obtain plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR and pJN 44-ZWF;

excising the GPO gene from plasmid pJN44-GPO and ligating to plasmid pJN44-TRXR to construct plasmid pJN 44-TRXR-GPO;

the SOD1 gene was cut from the plasmid pJN44-SOD1 and ligated to the plasmid pJN44-TRXR-GPO to construct plasmid pJN44-TRXR-GPO-SOD 1;

the obtained plasmid is cut by restriction enzymes Hind III and Sma I, and the correctness is verified by agarose gel electrophoresis;

(2) construction of recombinant yarrowia lipolytica Strain

According to the method for using the yeast transformation kit, the plasmids pJN44-SOD1, pJN44-CAT, pJN44-GPO, pJN44-GSR, pJN44-TRXR, pJN44-ZWF, pJN44-TRXR-GPO and pJN44-TRXR-GPO-SOD1 obtained in the step (1) are respectively transformed into yarrowia lipolytica YL-C6, and cultured by using SD-leu solid medium to obtain recombinant yarrowia lipolytica YL-C6(JN44-SOD1), YL-C6(JN44-CAT), YL-C44 (JN44-GPO), YL-C44 (JN44-GSR), YL-C44 (JN 4-TRXR), YL-C44 (JN44-ZWF), YL-44 (ZYL 44-TRXR) and TRXR-44 (GPXR-44-685).

5. Use of a recombinant yarrowia lipolytica strain according to claim 1 for the production of β -carotene.

6. The use as claimed in claim 5, wherein the recombinant yarrowia lipolytica is cultured in SD-leu liquid medium at 180-220rpm and 28-30 ℃ for 24-48h in a constant temperature shaker to obtain seed culture solution; then inoculating the seed culture solution into SD-leu liquid culture medium with 1-5% of inoculation amount, and performing fermentation culture in a constant temperature shaking table at 180-220rpm and 28-30 ℃ for 4-6 d; finally, inoculating the seed culture solution into a 50L bioreactor containing a fermentation culture medium by using the optimal strain with the inoculation amount of 1-5%, and fermenting and culturing for 4-6d under the conditions of 28-30 ℃ of temperature, 30-50L/min of ventilation, 650rpm of rotation speed, 10-20% of oxygen and 5.5-6.0 of PH.

7. The use according to claim 6, characterized in that the SD-leu liquid medium is: 20g/L glucose, 1.7g/L YNB (without amino acid and ammonium sulfate), 5g/L (NH)₄)₂SO₄、2g/L SD-leu；

The fermentation medium is as follows: 25g/L glucose, 10g/L yeast powder, 15g/L peptone and 5g/L (NH)₄)₂SO₄、2.5g/L KH₂PO₄、2.5g/L K₂HPO₄、0.5g/L MgSO₄6g/L leucine and 1g/L biotin.

Images