CN108898393A - Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method - Google Patents
Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method Download PDFInfo
- Publication number
- CN108898393A CN108898393A CN201810431576.1A CN201810431576A CN108898393A CN 108898393 A CN108898393 A CN 108898393A CN 201810431576 A CN201810431576 A CN 201810431576A CN 108898393 A CN108898393 A CN 108898393A
- Authority
- CN
- China
- Prior art keywords
- dna
- data
- cloud
- module
- chinese medicine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- G—PHYSICS
- G06—COMPUTING; CALCULATING OR COUNTING
- G06Q—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
- G06Q30/00—Commerce
- G06Q30/018—Certifying business or products
Landscapes
- Business, Economics & Management (AREA)
- Entrepreneurship & Innovation (AREA)
- Accounting & Taxation (AREA)
- Development Economics (AREA)
- Economics (AREA)
- Finance (AREA)
- Marketing (AREA)
- Strategic Management (AREA)
- Physics & Mathematics (AREA)
- General Business, Economics & Management (AREA)
- General Physics & Mathematics (AREA)
- Engineering & Computer Science (AREA)
- Theoretical Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to Materia Medica Identification anti-counterfeit fields, and in particular to a kind of Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method.The DNA chip and retrospect label used including cloud, DNA chip, identification apparatus, retrospect label, DNA searching terminal, retrospective retrival terminal Chinese medicine DNA Internet of Things anti-counterfeiting system, have being used for quickly detecting by DNA chip for biological detection experimental ability, and it is true and false by the identification of DNA big data analysis, it carries out anti-fake.Do not have being traced by tracing label for biological detection experimental ability, check Producing medicinal herbs, processing, storage, transaction, logistics, terminal and the information of detection, cloud can analyse whether to exist abnormal and analysis result is issued inquiry.By big data make trace tag queries to data as time and space change, even if copying identical retrospect label, abnormal request for information also can be by system discovery.It realizes the duplication for having efficiently controlled fake producer, forms preferably counterfeit protection measures.
Description
Technical field
The invention belongs to Materia Medica Identification anti-counterfeit fields, and in particular to a kind of Chinese medicine DNA Rapid identification Internet of Things is anti-fake
Traceability system and anti-fake source tracing method.
Background technique
Traditional Chinese medicine is anti-fake mainly using physics modes such as anti-counterfeiting label, false proof card, anti-counterfeit packages, by identification
The subjective mode such as the direct observation of person, touch, number inquiry.Therefore, as long as product is once dispatch from the factory, fake producer is gratifying be intended to for
Ground is copied, and is not got rid of always by counterfeit destiny.
Summary of the invention
The present invention is in view of the above-mentioned problems, provide a kind of vegetalitas Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system
And anti-fake source tracing method.
The technical solution used in the present invention is as follows：A kind of Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system, packet
Include cloud, DNA chip, identification apparatus, retrospect label, DNA searching terminal, retrospective retrival terminal；
The cloud includes storage module, analysis module, cloud information receiving module, cloud message output module, described
Storage module stores Chinese medicine DNA database and Producing medicinal herbs, processing, storage, transaction, logistics, terminal and detection
Information, the cloud information receiving module by network receive the data of DNA searching terminal and retrospective retrival terminal and by data
It is transmitted to analysis module, the analysis module analyzes the received data of the information receiving module, receives correlation from storage module
Data, comparative analysis DNA data, by DNA analysis result data and analysis Producing medicinal herbs, processing, storage, transaction, logistics,
Data and analysis result are simultaneously transmitted to message output module by terminal and the information of detection, and the cloud message output module will be believed
Breath is transmitted to DNA searching terminal, retrospective retrival terminal；
The DNA chip, including solid phase support object, gene probe；
Each retrospect label includes corresponding and unique id information, the id information, Producing medicinal herbs, processing, storage
It deposits, trade, the information of logistics, terminal and detection forms storage module in corresponding ID data packet storage beyond the clouds；
DNA searching terminal, including DNA data uploading module, DNA data reception module, the DNA data uploading module will
DNA chip detection data is transmitted to cloud, and the DNA data reception module receives cloud DNA analysis as a result, DNA searching terminal
It can be mobile phone, computer；
Retrospective retrival terminal includes retrospect label information read module, retrospective retrival data uploading module, retrospective retrival number
According to receiving module, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data
Label information and DNA testing result are transmitted to cloud, the retrospect inspection by uploading module, the retrospective retrival data uploading module
Rope data reception module receives Producing medicinal herbs, processing, storage, transaction, logistics, the information of terminal and detection.
The Chinese medicine DNA database is established in the following manner：
(1) certified products traditional Chinese medicinal material samples are subjected to batch extracting；
(2) by the Chinese medicine DNA sample and DNA chip progress hybridization reaction after extraction；
It (3) will be in hybridization reaction result input database；
(4) a variety of traditional Chinese medicinal material samples without brand, different size, different sources, different batches are passed sequentially through into step
(1), (2), (3) are detected, and form Chinese medicine DNA database.
In step (1), traditional Chinese medicinal material samples are extracted by CTAB method, and detailed process is as follows：4ml is added in centrifuge tube
CTAB extracting solution and 80ul mercaptoethanol preheat in 65 ± 5 DEG C of water-baths, take traditional Chinese medicinal material samples, and liquid nitrogen grinding turns at powder
In centrifuge tube after entering preheating, sealing keeps the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, takes out centrifuge tube, fast cooling is extremely
4ml phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol is added in room temperature, mixes, and forms mixed emulsion；12000r/min
It is centrifuged 10min, supernatant is taken, the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1 is added, in being placed at room temperature for after mixing
10-20min, 12000r/min are centrifuged 10min, remove supernatant, and precipitating successively uses dehydrated alcohol, 70% ethanol washing, and TE is added
The RNase of buffer and final concentration of 50 μ g/ml obtains Chinese medicine DNA sample in 37 DEG C of heat preservation 1h.
The DNA chip is surface plasma resonant sensor chip, and the solid phase support object is silicon chip, the solid phase
Layer of metal film is adhered on supporter surface, and the gene probe is fixed on metallic film surface.Utilize surface plasma resonance
(surface plasmon resonance, SPR) biosensor technology quickly detects the DNA of Chinese medicine.Surface plasma
Resonance (Surface Plasmon Resonance, SPR) is a kind of optical physics phenomenon.When a branch of P-polarized light is at certain angle
It is incident on prism end face in degree range, surface plasma-wave will be generated at the interface of prism and metallic film (Au or Ag).When entering
When the propagation constant of the propagation constant and surface plasma-wave of penetrating light wave matches, free electron in metal film is caused to generate altogether
Vibration, i.e. surface plasma resonance.When analysis, one layer of biomolecule identification film first is fixed in censorchip surface, it then will be to be measured
Sample flows through chip surface, if there is the molecule that can identify membrane interaction with the biomolecule of chip surface in sample, can draw
The variation of golden film surface refractive index is played, the variation of the angle SPR is eventually led to by detecting SPR angle change and obtains the dense of analyte
The information such as degree, affinity, kinetic constant and specificity.Two when Chinese medicine DNA sample after extraction is injected into chip surface
Person specifically binds, and so as to cause the variation of chip surface optical parameter, and shows as electronic signals, special to tie
The amount for closing determinand is different, and the response intensity of signal is different.
The retrospect label is RFID RFID tag.Radio frequency identification, RFID (Radio Frequency
Identification) technology, also known as radio frequency identification are a kind of communication technologys, are commonly called as electronic tag.Radio can be passed through
Signal identification specific objective simultaneously reads and writes related data, connects without establishing mechanical or optics between identifying system and specific objective
Touching.Convenient for identification, make the information Rapid input of production, processing, storage, transaction, logistics, terminal and detection.Item can also be taken
Shape code, two dimensional code isotype, but need to be scanned one by one, it is unfavorable for the typing of high-volume information.
The retrospect label is arranged in DNA chip.Result can directly be will test after tester's detection to chase after by scanning
The label that traces back connects cloud, will test data and is transmitted to cloud, and obtains cloud analysis as a result, coherent detection data are saved in cloud
On end.
Agent, logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to cloud
The data of correspondence ID in the storage module of end are surrounded by reading permission, number of the consumer to the correspondence ID in the storage module of cloud
It reads permission according to being surrounded by and forbids the user read permission in addition to the manager of cloud.Reading every time in this way has corresponding identity
Information produces exception reporting if the consumer of terminal repeatedly inquires, and informs the larger possible generation retrospect label of consumer
The case where being replicated, if there is consumer retracts commodity, sales end can typing correlation sales information, reduce the possibility of cloud erroneous judgement
Property.
After each ID data packet starts equipped with timing routine, self-generating ID on the cloud storage module after a certain period of time,
Retrospective retrival terminal can not retrieve.Cloud manager can be set according to actual conditions DNA's according to the characteristic of Chinese medicine product
Validity period avoids the retrospect label on expired product or expired product from shifting and uses.
A kind of anti-fake source tracing method of above-mentioned Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system, including it is following：
Personnel with detectability, detect in the following ways：
(1) DNA sample hybridize instead with DNA chip by the DNA sample that tested traditional Chinese medicinal material samples are extracted by CTAB method
It answers, obtains response data；
(2) by retrospective retrival terminal scanning retrospect label, by response data by DNA searching terminal be uploaded to cloud and
Data in the DNA database of cloud compare, and obtain true and false result；
(3) it will test place, time, result are transmitted to cloud retrospect label traditional Chinese medicinal material samples and correspond to ID corresponding to batch
Data packet；
Do not have the personnel of detectability, identifies in the following ways：
(1) by retrospective retrival terminal scanning retrospect label, Producing medicinal herbs, processing, storage, transaction, logistics, end are obtained
The information at end and detection；
(2) cloud carries out analysis according to historical query information and analysis result is sent to retrospective retrival terminal.
Beneficial effects of the present invention are as follows：The DNA chip and retrospect label that Chinese medicine DNA Internet of Things anti-counterfeiting system uses,
Have the Chinese medicine trading company of biological detection experimental ability, large-scale transaction place, hospital etc. can be carried out by DNA chip it is quick
Detection, and it is true and false by the identification of DNA big data analysis, it carries out anti-fake.Do not have pharmacy, the consumer of biological detection experimental ability
Etc. can by trace label be traced, check Producing medicinal herbs, processing, storage, transaction, logistics, terminal and the letter of detection
Breath, cloud can analyse whether to exist abnormal and analysis result issued inquiry.Make to trace what tag queries arrived by big data
Data change with time and space, even if copying identical retrospect label, abnormal request for information can also be sent out by system
It is existing.It realizes the duplication for having efficiently controlled fake producer, forms preferably counterfeit protection measures.
Detailed description of the invention
Fig. 1 is the schematic diagram of Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system.
Fig. 2 is Chinese medicine DNA rapid identification method flow chart.
Specific embodiment
With reference to the accompanying drawing and specific embodiment, the present invention can be better described.
Embodiment one：
DNA chip is prepared, detailed process is as follows：
It can be Au or Ag 1. adhering to the metal film of one layer of 150nm by metal coating technique in silicon chip surface；
2. in probe genetic fragment sulfhydrylation, then by the probe points of different sulfhydrylations to different zones, in 4 DEG C of conditions
It is lower to be kept for 12 hours, it can choose the probe of different plant species according to the difference of medicinal material, wherein by taking Rhizoma Gastrodiae as an example, the base of Rhizoma Gastrodiae
Because probe includes following probe：
Probe one：TGATATGCTTAAGTTCAGCGG；
Probe two：TCCTACCTGATTTGAGGTCAG；
Probe three：TTTGAAGCATGAATCC；
Probe four：AGATAATTATC；
Probe five：AGATAATTATCACAC；
Probe six：GCGTTCAAAGATTCGATGAT；
3. then wash the unbonded probe of metallic film surface with deionized water, then with being dried with nitrogen.
There is good stability by DNA chip prepared by the above method, can be flowed for a long time on the market with product
Logical, the DNA probe on surface is designed for the DNA sequence dna of Chinese medicine, and some existing DNA of plants probes are being added, are passing through
Probe tests the DNA information of traditional Chinese medicinal material samples, has specificity, good test effect.
Embodiment two：
Chinese medicine DNA database is constructed, detailed process is as follows：
1. traditional Chinese medicinal material samples are extracted by CTAB method, detailed process is as follows：4ml CTAB extracting solution is added in centrifuge tube
And 80ul mercaptoethanol, it is preheated in 65 ± 5 DEG C of water-baths, takes traditional Chinese medicinal material samples, liquid nitrogen grinding is at powder, after being transferred to preheating
In centrifuge tube, sealing keeps the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, takes out centrifuge tube, and fast cooling to room temperature is added
4ml phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol mixes, and forms mixed emulsion；12000r/min is centrifuged 10min,
Supernatant is taken, the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1 is added, in being placed at room temperature for 10-20min after mixing,
12000r/min is centrifuged 10min, removes supernatant, and precipitating successively uses dehydrated alcohol, 70% ethanol washing, and TE buffer and end is added
Concentration is that the RNase of 50 μ g/ml obtains Chinese medicine DNA sample in 37 DEG C of heat preservation 1h.
2. by Chinese medicine DNA sample and DNA chip progress hybridization reaction after extraction：Chinese medicine DNA sample is injected into DNA
Chip surface, hybridization reaction 5 hours at 45 DEG C.
3. the spr signal of each probe area is obtained, in input database；
4. a variety of traditional Chinese medicinal material samples without brand, different size, different sources, different batches are passed sequentially through step 1
It is detected to 3, forms Chinese medicine DNA database.
The DNA information in traditional Chinese medicinal material samples is extracted by step 1, relatively other methods, extracting concentration is high, relatively complete
It is whole, hybridization reaction is carried out with DNA chip, reacts sensitiveer, conjugation is relatively high, observes the data in DNA database, discovery
Data without brand, the traditional Chinese medicinal material samples of different size, different sources, different batches are roughly the same, have part to have differences.
Embodiment three：
Check the validity of DNA chip and Chinese medicine DNA database, testing staff does not know the true of tested traditional Chinese medicinal material samples
It is pseudo-：
1. tested traditional Chinese medicinal material samples are extracted by CTAB method, detailed process is as follows：4ml CTAB is added in centrifuge tube
Extracting solution and 80ul mercaptoethanol preheat in 65 ± 5 DEG C of water-baths, take traditional Chinese medicinal material samples, and liquid nitrogen grinding is transferred to pre- at powder
In centrifuge tube after heat, sealing keeps the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, takes out centrifuge tube, fast cooling to room
4ml phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol is added in temperature, mixes, and forms mixed emulsion；12000r/min from
Heart 10min, takes supernatant, and the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1 is added, in being placed at room temperature for 10- after mixing
20min, 12000r/min are centrifuged 10min, remove supernatant, and precipitating successively uses dehydrated alcohol, 70% ethanol washing, and TE buffering is added
The RNase of liquid and final concentration of 50 μ g/ml obtains Chinese medicine DNA sample in 37 DEG C of heat preservation 1h.2. by the Chinese medicine after extraction
DNA sample and DNA chip carry out hybridization reaction：Chinese medicine DNA sample is injected into DNA chip surface, and hybridization reaction 5 is small at 45 DEG C
When.
3. obtain the spr signal of each probe area, the spr signal data that will test and Chinese medicine DNA database are carried out pair
Than the sample that similarity is more than 90% is that very, the sample being less than is false.
4. several kinds of Chinese medicinal materials sample is passed sequentially through step 1 to detect to 3, the identification true and false is obtained as a result, detection is correct
Rate is 100%.Illustrate that DNA chip and Chinese medicine DNA database can be effectively used for the identification of the Chinese medicine true and false.
Through this embodiment, it may be said that bright DNA chip and Chinese medicine DNA database can be effectively used for Chinese medicine true and false mirror
Not.The DNA chip detection data and Chinese medicine DNA database similarity of adulterant traditional Chinese medicinal material samples are below 85%, and in certified products
The DNA chip detection data and Chinese medicine DNA database similarity of medicinal material sample are above 95%, can obviously distinguish, this
Sample is small by DNA chip testing result error.It cloud can be between 85%-95% to the setting of certified products similarity limit.
Example IV：
A kind of Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system, including cloud, DNA chip, identification apparatus, chase after
It traces back label, DNA searching terminal, retrospective retrival terminal；
The cloud includes storage module, analysis module, cloud information receiving module, cloud message output module, described
Storage module stores Chinese medicine DNA database and Producing medicinal herbs, processing, storage, transaction, logistics, terminal and detection
Information, the cloud information receiving module by network receive the data of DNA searching terminal and retrospective retrival terminal and by data
It is transmitted to analysis module, the analysis module analyzes the received data of the information receiving module, receives correlation from storage module
Data, comparative analysis DNA data, by DNA analysis result data and analysis Producing medicinal herbs, processing, storage, transaction, logistics,
Data and analysis result are simultaneously transmitted to message output module by terminal and the information of detection, and the cloud message output module will be believed
Breath is transmitted to DNA searching terminal, retrospective retrival terminal；
The DNA chip, including solid phase support object, gene probe；
Each retrospect label includes corresponding and unique id information, the id information, Producing medicinal herbs, processing, storage
It deposits, trade, the information of logistics, terminal and detection forms storage module in corresponding ID data packet storage beyond the clouds；
DNA searching terminal, including DNA data uploading module, DNA data reception module, the DNA data uploading module will
DNA chip detection data is transmitted to cloud, and the DNA data reception module receives cloud DNA analysis result；
Retrospective retrival terminal includes retrospect label information read module, retrospective retrival data uploading module, retrospective retrival number
According to receiving module, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data
Label information and DNA testing result are transmitted to cloud, the retrospect inspection by uploading module, the retrospective retrival data uploading module
Rope data reception module receives Producing medicinal herbs, processing, storage, transaction, logistics, the information of terminal and detection.
The DNA chip and retrospect label that Chinese medicine DNA Internet of Things anti-counterfeiting system uses, have biological detection experimental ability
Chinese medicine trading company, large-scale transaction place, hospital etc. can be used for quickly detecting by DNA chip, and pass through DNA big data point
Analysis identification is true and false, carries out anti-fake.Not having pharmacy, consumer of biological detection experimental ability etc. can be carried out by retrospect label
Retrospect, checks Producing medicinal herbs, processing, storage, transaction, logistics, terminal and the information of detection, cloud can analyse whether that there are different
Often and by analysis result issue inquiry.By big data make trace tag queries to data as time and space become
Change, even if copying identical retrospect label, abnormal request for information also can be by system discovery.Realization has efficiently controlled fraud
The duplication of person forms preferably counterfeit protection measures.
The retrospect label is RFID RFID tag.The retrospect label is arranged in DNA chip.DNA retrieval is eventually
End and retrospective retrival terminal can be a terminal, i.e., the dress handled simultaneous with RFID radio frequency recognition function and networking data
It sets, such as with mobile phone, the terminal of RFID identification function.
Agent, logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to cloud
The data of correspondence ID in the storage module of end are surrounded by reading permission, number of the consumer to the correspondence ID in the storage module of cloud
It reads permission according to being surrounded by and forbids the user read permission in addition to the manager of cloud.Reading every time in this way has corresponding identity
Information produces exception reporting if the consumer of terminal repeatedly inquires, and informs the larger possible generation retrospect label of consumer
The case where being replicated, if there is consumer retracts commodity, sales end can typing correlation sales information, reduce the possibility of cloud erroneous judgement
Property.
After each ID data packet starts equipped with timing routine, self-generating ID on the cloud storage module after a certain period of time,
Retrospective retrival terminal can not retrieve.Retrospect label can be set according to actual conditions according to the characteristic of itself product in medicinal material manufacturer
The validity period of data retrieval, retrieval number, timeliness one arrive, then trace label automatic damage, even if personator has recycled retrospect mark
Label, and scheme in vain.
Medicinal material manufacturer can according to the actual situation nullify specified retrospect tag ID when specific.Make to trace label
The validity of ID among the control of medicinal material manufacturer, allows fake producer to have no exploits always.
Cloud manager needs the safety of strict control cloud data, can set management code key, it is ensured that cloud data are tight
Lattice rest in production firm.
The above description is only an embodiment of the present invention, the protection scope being not intended to limit the invention；Protection of the invention
Range is limited by the claim in claims, and all according to made equivalence changes and modification is invented, all in this hair
Within the protection scope of bright patent.
Claims (9)
1. a kind of Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system, it is characterised in that：Including cloud, DNA chip, mirror
Determine device, retrospect label, DNA searching terminal, retrospective retrival terminal；
The cloud includes storage module, analysis module, cloud information receiving module, cloud message output module, the storage
Module stores Chinese medicine DNA database and Producing medicinal herbs, processing, storage, transaction, logistics, terminal and the information of detection,
The cloud information receiving module receives the data of DNA searching terminal and retrospective retrival terminal by network and sends data to
Analysis module, the analysis module analyze the received data of the information receiving module, related data are received from storage module, is right
Than analysis DNA data, by DNA analysis result data and analysis Producing medicinal herbs, processing, storage, transaction, logistics, terminal and
Data and analysis result are simultaneously transmitted to message output module by the information of detection, and the cloud message output module transmits information
To DNA searching terminal, retrospective retrival terminal；
The DNA chip, including solid phase support object, gene probe；
Each retrospect label includes corresponding and unique id information, the id information, Producing medicinal herbs, processing, storage, friendship
Easily, logistics, terminal and the information of detection form the storage module in corresponding ID data packet storage beyond the clouds；
DNA searching terminal, including DNA data uploading module, DNA data reception module, the DNA data uploading module is by DNA
Chip detection data is transmitted to cloud, and the DNA data reception module receives cloud DNA analysis result；
Retrospective retrival terminal includes tracing label information read module, retrospective retrival data uploading module, retrospective retrival data to connect
Module is received, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data and uploads
Label information and DNA testing result are transmitted to cloud, the retrospective retrival number by module, the retrospective retrival data uploading module
Producing medicinal herbs, processing, storage, transaction, logistics, the information of terminal and detection are received according to receiving module.
2. Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：It is described
Chinese medicine DNA database is established in the following manner：
(1) certified products traditional Chinese medicinal material samples are subjected to batch extracting；
(2) by the Chinese medicine DNA sample and DNA chip progress hybridization reaction after extraction；
It (3) will be in hybridization reaction result input database；
(4) by it is a variety of without brand, different size, different sources, different batches traditional Chinese medicinal material samples pass sequentially through step (1),
(2), (3) are detected, and form Chinese medicine DNA database.
3. Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system according to claim 2, it is characterised in that：Step
(1) in, traditional Chinese medicinal material samples are extracted by CTAB method, and detailed process is as follows：In centrifuge tube be added 4ml CTAB extracting solution and
80ul mercaptoethanol preheats in 65 ± 5 DEG C of water-baths, takes traditional Chinese medicinal material samples, liquid nitrogen grinding at powder, after being transferred to preheating from
In heart pipe, sealing keeps the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, takes out centrifuge tube, and 4ml is added in fast cooling to room temperature
Phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol mixes, and forms mixed emulsion；12000r/min is centrifuged 10min, takes
The chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1 is added in supernatant, in being placed at room temperature for 10-20min after mixing,
12000r/min is centrifuged 10min, removes supernatant, and precipitating successively uses dehydrated alcohol, 70% ethanol washing, and TE buffer and end is added
Concentration is that the RNase of 50 μ g/ml obtains Chinese medicine DNA sample in 37 DEG C of heat preservation 1h.
4. Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：It is described
DNA chip is surface plasma resonant sensor chip, and the solid phase support object is silicon chip, and solid phase support object surface is attached
Layer of metal film, the gene probe be fixed on metallic film surface.
5. Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：It is described
Retrospect label is RFID RFID tag.
6. Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：It is described
Label is traced to be arranged in DNA chip.
7. Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：It is intermediate
Quotient, logistics, consumer need to register and carry out on beyond the clouds proof of identity, and the agent, logistics are in the storage module of cloud
The data of correspondence ID be surrounded by reading permission, the consumer is surrounded by reading power to the data of the correspondence ID in the storage module of cloud
Limit and forbid the user read permission in addition to the manager of cloud.
8. Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：It is described
After each ID data packet starts equipped with timing routine, self-generating ID on the storage module of cloud after a certain period of time, retrospective retrival terminal
It can not retrieve.
9. a kind of anti-fake tracing back of the described in any item Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability systems of claim 1-8
Source method, which is characterized in that including following：
Personnel with detectability, detect in the following ways：
(1) DNA sample that tested traditional Chinese medicinal material samples are extracted by CTAB method, carries out hybridization reaction for DNA sample and DNA chip,
Obtain response data；
(2) by retrospective retrival terminal scanning retrospect label, response data is uploaded to cloud and cloud by DNA searching terminal
Data in DNA database compare, and obtain true and false result；
(3) it will test place, time, result are transmitted to cloud retrospect label traditional Chinese medicinal material samples and correspond to ID data corresponding to batch
Packet；
Do not have the personnel of detectability, identifies in the following ways：
(1) by retrospective retrival terminal scanning retrospect label, obtain Producing medicinal herbs, processing, storage, transaction, logistics, terminal and
The information of detection；
(2) cloud carries out analysis according to historical query information and analysis result is sent to retrospective retrival terminal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810431576.1A CN108898393A (en) | 2018-05-08 | 2018-05-08 | Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810431576.1A CN108898393A (en) | 2018-05-08 | 2018-05-08 | Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108898393A true CN108898393A (en) | 2018-11-27 |
Family
ID=64342651
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810431576.1A Withdrawn CN108898393A (en) | 2018-05-08 | 2018-05-08 | Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108898393A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112200591A (en) * | 2020-10-21 | 2021-01-08 | 湖南康凯信息技术有限公司 | Internet of things identification anti-counterfeiting traceability system for traditional Chinese medicinal materials |
| WO2022166671A1 (en) * | 2021-02-04 | 2022-08-11 | 严太亨 | Biomedical consumable purchase analysis system and method |
| CN116071091A (en) * | 2023-03-16 | 2023-05-05 | 山东丰茂源认证服务有限公司 | Pharmacy raw material traceability system based on Internet of things |
-
2018
- 2018-05-08 CN CN201810431576.1A patent/CN108898393A/en not_active Withdrawn
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112200591A (en) * | 2020-10-21 | 2021-01-08 | 湖南康凯信息技术有限公司 | Internet of things identification anti-counterfeiting traceability system for traditional Chinese medicinal materials |
| WO2022166671A1 (en) * | 2021-02-04 | 2022-08-11 | 严太亨 | Biomedical consumable purchase analysis system and method |
| CN116071091A (en) * | 2023-03-16 | 2023-05-05 | 山东丰茂源认证服务有限公司 | Pharmacy raw material traceability system based on Internet of things |
| CN116071091B (en) * | 2023-03-16 | 2023-06-20 | 山东丰茂源认证服务有限公司 | Pharmacy raw material traceability system based on Internet of things |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Heumos et al. | Best practices for single-cell analysis across modalities | |
| CN108898393A (en) | Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| Qian et al. | Rapid single-particle chemical imaging of nanoplastics by SRS microscopy | |
| Tomic et al. | SIMON, an automated machine learning system, reveals immune signatures of influenza vaccine responses | |
| Drexler et al. | False and mycoplasma‐contaminated leukemia–lymphoma cell lines: time for a reappraisal | |
| CN102519912B (en) | Method for detecting object to be detected by using surface plasmon resonance (SPR) biosensor | |
| CN104123370A (en) | Method and system for detecting sensitive information in database | |
| CN104395759B (en) | The method and system recognized for graphical analysis | |
| CN101871891A (en) | Method and system for discriminating alcoholic liquor commodity real and false | |
| CN108614956A (en) | A kind of Internet of Things for the stem of noble dendrobium differentiates traceability system and differentiates source tracing method | |
| CN108629604A (en) | Anti-fake traceability system based on American Ginseng DNA and anti-fake source tracing method | |
| CN108315388A (en) | A kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method | |
| Zhang et al. | Automatic scratch detector for optical surface | |
| CN108645797A (en) | Donkey-hide gelatin DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method | |
| Pistiki et al. | Application of Raman spectroscopy in the hospital environment | |
| CN103698353A (en) | Bird's nest identification method | |
| CN108629388A (en) | A kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology | |
| CN108456718A (en) | A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method | |
| CN108866158A (en) | A kind of ganoderma lucidum DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| CN108492122A (en) | A kind of Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| CN108681906A (en) | A kind of radix pseudostellariae Internet of Things anti-fake traceability system and application process | |
| CN103606101A (en) | An examining method for discriminating product authenticity based on an article vocal print identification technique | |
| Hu et al. | [Retracted] Research on Online Rapid Sorting Method of Waste Textiles Based on Near‐Infrared Spectroscopy and Generative Adversity Network | |
| CN108898394A (en) | A kind of safflower DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| Chen et al. | Label-free single-particle imaging approach for ultra-rapid detection of pathogenic bacteria in clinical samples |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20181127 |
|
| WW01 | Invention patent application withdrawn after publication |