CN108629388A - A kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology - Google Patents
A kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology Download PDFInfo
- Publication number
- CN108629388A CN108629388A CN201810432804.7A CN201810432804A CN108629388A CN 108629388 A CN108629388 A CN 108629388A CN 201810432804 A CN201810432804 A CN 201810432804A CN 108629388 A CN108629388 A CN 108629388A
- Authority
- CN
- China
- Prior art keywords
- dna
- rhizoma gastrodiae
- clouds
- data
- module
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/17—Systems in which incident light is modified in accordance with the properties of the material investigated
- G01N21/55—Specular reflectivity
- G01N21/552—Attenuated total reflection
- G01N21/553—Attenuated total reflection and using surface plasmons
-
- G—PHYSICS
- G06—COMPUTING; CALCULATING OR COUNTING
- G06K—GRAPHICAL DATA READING; PRESENTATION OF DATA; RECORD CARRIERS; HANDLING RECORD CARRIERS
- G06K17/00—Methods or arrangements for effecting co-operative working between equipments covered by two or more of main groups G06K1/00 - G06K15/00, e.g. automatic card files incorporating conveying and reading operations
- G06K17/0022—Methods or arrangements for effecting co-operative working between equipments covered by two or more of main groups G06K1/00 - G06K15/00, e.g. automatic card files incorporating conveying and reading operations arrangements or provisious for transferring data to distant stations, e.g. from a sensing device
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B25/00—ICT specially adapted for hybridisation; ICT specially adapted for gene or protein expression
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B50/00—ICT programming tools or database systems specially adapted for bioinformatics
Landscapes
- Physics & Mathematics (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Theoretical Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Biophysics (AREA)
- Bioinformatics & Computational Biology (AREA)
- Biotechnology (AREA)
- Evolutionary Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medical Informatics (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Genetics & Genomics (AREA)
- Databases & Information Systems (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Bioethics (AREA)
- Chemical & Material Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Information Retrieval, Db Structures And Fs Structures Therefor (AREA)
Abstract
The invention belongs to Rhizoma Gastrodiaes to identify anti-counterfeit field, and in particular to a kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology.The DNA chip and retrospect label used including high in the clouds, DNA chip, identification apparatus, retrospect label, DNA searching terminals, retrospective retrival terminal Rhizoma Gastrodiae DNA Internet of Things anti-counterfeiting systems, have being used for quickly detecting by DNA chip for biological detection experimental ability, and it is true and false by the discriminating of DNA big data analysis, it carries out anti-fake.Do not have being traced by tracing label for biological detection experimental ability, checks that the information of Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and detection, high in the clouds can analyse whether to exist abnormal and analysis result issued inquiry.By big data make retrospect tag queries to data change with time and space, even if copying identical retrospect label, abnormal request for information also can be by system discovery.It realizes the duplication for having efficiently controlled fake producer, forms preferably counterfeit protection measures.
Description
Technical field
The invention belongs to Rhizoma Gastrodiaes to identify anti-counterfeit field, and in particular to a kind of Rhizoma Gastrodiae based on surface plasma resonance technology is anti-
Pseudo- traceability system and method.
Background technology
Rhizoma Gastrodiae is the dry tuber of orchid Rhizoma Gastrodiae Gastrodia elata Bl..Also known as rhizoma gastrodiae, from mother, yellow moccasin flower,
God grass, solely shake sesame, rhizoma gastrodiae fat, wind grass, conjunction from grass, solely shake, automatic careless, water potato.After the Beginning of Winter to next year it is clear and bright before excavation (with
Winter fiber crops are preferably), it is famous Chinese medicine.Just it has been used as medicine before two thousand years, has been excellent with Zhaotong County, Yunnan production person.Rich in Rhizoma Gastrodiae
Element, Vanillin, protein, amino acid, trace element.Its property is pungent, warm, nontoxic, there is anti-epileptic, resists to throb with fear and faint, antirheumatic；Town
It is quiet, antispastic, analgesia, the effect of qi-restoratives, suppressing hyperactive liver for calming endogenous wind.Major function suppressing hyperactive liver for calming endogenous wind relieving convulsion.For dizziness of having a headache, extremity numbness,
Epilepsy clonus, lockjaw.It feels dizzy, neurasthenia, wind-cold-dampness arthralgia, the diseases such as child convulsion.Clinical application proves, to vascular
Nervous headache, postconcussion syndrome etc. have significant curative effect.Currently, most of Rhizoma Gastrodiae is that artificial cultivation forms, and
Often obscure with Rhizoma Gastrodiaes adulterants such as four-o'clock, dahlia, wild carraways, seriously affects clinical treatment quality and health body-building effect.
Traditional is anti-fake mainly using physics modes such as anti-counterfeiting label, false proof card, anti-counterfeit packages, by the straight of assessor
Connect the subjective mode such as observation, touch, number inquiry.As patent CN00213421.7 discloses a kind of Anti-false cylindrical paper container, including
Cover, tank bottom and tubular composite paper tank body, cover, tank bottom are fixed together with tank body, and tank body is equipped with by continuous
The point off circumference that breaking point or geosutures are constituted.This structure is easily copied.As patent CN200410012982.2 discloses one
Kind G 2 encoding method for commodity is the substance being applied in each field, commodity, equipment and other coding methods.Coding is divided into two
Grade, level encoder are merchandise classification, general important name and alias, and two level is encoded to the general important name of commodity or alias by level encoder
The commercial specification model that derives from, measurement unit, production firm, packaging label, authentication code, other marks, condition of storage
The relationship of equal codes, level encoder and two level coding is not only independent but also complementary two generations relationship, can be applied independently or together.Its
It is identified, as medical mark includes Chinese medicine mark, prescription medicine mark, imported medicine identifies, special management medicine identifies, country is basic
Medicine identifies, but coding can be replicated easily.Therefore, as long as product is once dispatch from the factory, fake producer is gratifying to be intended to be imitated for ground
It makes, is not broken away from always by counterfeit destiny.
Invention content
The present invention in view of the above-mentioned problems, provide a kind of Rhizoma Gastrodiae anti-fake traceability system based on surface plasma resonance technology and
Method.
The technical solution used in the present invention is as follows：A kind of anti-fake trace to the source of the Rhizoma Gastrodiae based on surface plasma resonance technology be
System, including high in the clouds, DNA chip, identification apparatus, retrospect label, DNA searching terminals, retrospective retrival terminal；
The high in the clouds includes storage module, analysis module, high in the clouds information receiving module, high in the clouds message output module, described
Storage module stores the information of Rhizoma Gastrodiae DNA databases and Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and detection,
The high in the clouds information receiving module receives the data of DNA searching terminals and retrospective retrival terminal by network and sends data to
Analysis module, the data of the analysis module analysis described information receiving module reception receive related data from storage module, are right
Than analysis DNA data, by DNA analysis result data and analysis Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and inspection
Data and analysis result are simultaneously transmitted to message output module by the information of survey, and the high in the clouds message output module transmits information to
DNA searching terminals, retrospective retrival terminal；
The DNA chip, including solid phase support object, gene probe, the gene probe include such as Rhizoma Gastrodiae DNA designs
Lower probe：
Probe one：TGATATGCTTAAGTTCAGCGG；
Probe two：TCCTACCTGATTTGAGGTCAG；
Probe three：TTTGAAGCATGAATCC；
Probe four：AGATAATTATC；
Probe five：AGATAATTATCACAC；
Probe six：GCGTTCAAAGATTCGATGAT；It can also include existing known various plants DNA probe；
Each retrospect label includes corresponding and unique id information, the id information, Rhizoma Gastrodiae production, processing, store,
Transaction, logistics, the information of terminal and detection form the storage module in corresponding ID data packets storage beyond the clouds；
DNA searching terminals, including DNA data uploading module, DNA data reception modules, the DNA data uploading module will
DNA chip detection data is transmitted to high in the clouds, and the DNA data reception modules receive high in the clouds DNA analysis as a result, DNA searching terminals
Can be mobile phone, computer；
Retrospective retrival terminal includes retrospect label information read module, retrospective retrival data uploading module, retrospective retrival number
According to receiving module, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data
Label information and DNA testing results are transmitted to high in the clouds, the retrospect inspection by uploading module, the retrospective retrival data uploading module
Rope data reception module receives the information of Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and detection.
The Rhizoma Gastrodiae DNA databases are established in the following manner：
(1) certified products Rhizoma Gastrodiae sample is extracted into Rhizoma Gastrodiae DNA sample；
(2) the Rhizoma Gastrodiae DNA sample after extraction is subjected to hybridization reaction with DNA chip；
It (3) will be in hybridization reaction result input database；
(4) a variety of Rhizoma Gastrodiae samples without brand, different size, different sources, different batches are passed sequentially through into step
(1), (2), (3) are detected, and form Rhizoma Gastrodiae DNA databases.
In step (1), Rhizoma Gastrodiae sample is extracted by CTAB methods, and detailed process is as follows：4ml CTAB are added in centrifuge tube
Extracting solution and 80ul mercaptoethanols, preheat in 65 ± 5 DEG C of water-baths, and Rhizoma Gastrodiae sample, liquid nitrogen grinding is taken to be transferred to preheating at powder
In centrifuge tube afterwards, sealing keeps the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, taking-up centrifuge tube, fast cooling to room temperature,
4ml phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol is added, mixing forms mixed emulsion；12000r/min is centrifuged
10min takes supernatant, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10- after mixing
20min, 12000r/min centrifuge 10min, and supernatant, precipitation is gone to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, and TE bufferings are added
The RNase of liquid and final concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Rhizoma Gastrodiae DNA sample.
The DNA chip is surface plasma resonant sensor chip, and the solid phase support object is silicon chip, the solid phase
Layer of metal film is adhered on supporter surface, and the gene probe is fixed on metallic film surface.Utilize surface plasma resonance
(surface plasmon resonance, SPR) biosensor technology quickly detects the DNA of Rhizoma Gastrodiae.Surface plasma is total
Shake (Surface Plasmon Resonance, SPR) be a kind of optical physics phenomenon.When a branch of P polarization light is in certain angle
It is incident on prism end face in range, surface plasma-wave will be generated at the interface of prism and metallic film (Au or Ag).Work as incidence
When the propagation constant of light wave and the propagation constant of surface plasma-wave match, free electron in metal film is caused to generate resonance,
That is surface plasma resonance.When analysis, first one layer of biomolecule is fixed in censorchip surface and identify film, then by sample to be tested
Chip surface is flowed through, if there is the molecule that can identify membrane interaction with the biomolecule of chip surface in sample, gold can be caused
Film surface variations in refractive index eventually leads to the variation of the angles SPR and obtains concentration, the parent of analyte by detecting SPR angle changes
With the information such as power, kinetic constant and specificity.Occur both when Rhizoma Gastrodiae DNA sample after extraction is injected into chip surface special
The opposite sex combines, and changes so as to cause chip surface optical parameter, and show as electronic signals, specific bond determinand
Amount it is different, the response intensity of signal is different.
The retrospect label is RFID RFID tags.Radio frequency identification, RFID (Radio Frequency
Identification) technology, also known as radio frequency identification are a kind of communication technologys, are commonly called as electronic tag.Radio can be passed through
Signal identifies specific objective and reads and writes related data, is connect without establishing mechanical or optics between identifying system and specific objective
It touches.Convenient for identification, make the information Rapid input of production, processing, storage, transaction, logistics, terminal and detection.Item can also be taken
Shape code, Quick Response Code isotype, but need to be scanned one by one, it is unfavorable for the typing of high-volume information.
The retrospect label is arranged in DNA chip.Directly testing result can be chased after by scanning after tester's detection
The label that traces back connects high in the clouds, detection data is transmitted to high in the clouds, and obtain high in the clouds analysis result, coherent detection data are saved in cloud
On end.
Agent, logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to cloud
The data of correspondence ID in the storage module of end are surrounded by reading permission, number of the consumer to the correspondence ID in the storage module of high in the clouds
It reads permission according to being surrounded by and forbids the user read permission in addition to the manager of high in the clouds.Reading every time in this way has corresponding identity
Information produces exception reporting if the consumer of terminal repeatedly inquires, and retrospect label may be occurred by informing that consumer is larger
The case where being replicated, if there is consumer retracts commodity, sales end can typing correlation sales information, reduce the possibility of high in the clouds erroneous judgement
Property.
Each ID data packets are equipped with consumer's reading times restricted program on the high in the clouds storage module, are set to from identity and disappear
Restriction ID data packets are only capable of being registered the certain number of user's reading after the user of expense person reads ID data packets for the first time.
After each ID data packets start equipped with timing routine, self-generating ID on the high in the clouds storage module after a certain period of time,
Retrospective retrival terminal can not retrieve.High in the clouds manager can be according to the characteristic of day ramie product, and be set according to actual conditions DNA has
The effect phase avoids the retrospect label on expired product or expired product from shifting and uses.
A kind of anti-fake source tracing method of the above-mentioned Rhizoma Gastrodiae anti-fake traceability system based on surface plasma resonance technology, including
Below：
Personnel with detectability, detect in the following ways：
(1) DNA sample for being tested Rhizoma Gastrodiae sample is extracted by CTAB methods, and DNA sample with DNA chip hybridize instead
It answers, obtains response data；
(2) by retrospective retrival terminal scan retrospect label, by response data by DNA searching terminals be uploaded to high in the clouds with
Data in the DNA databases of high in the clouds are compared, and obtain true and false result；
(3) detection site, time, result are transmitted to high in the clouds retrospect label Rhizoma Gastrodiae sample and correspond to ID numbers corresponding to batch
According to packet；
The personnel for not having detectability, identify in the following ways：
(1) retrospect label is scanned by retrospective retrival terminal, obtains Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal
With the information of detection；
(2) high in the clouds according to historical query information analyze and analysis result is sent to retrospective retrival terminal.
Beneficial effects of the present invention are as follows：The DNA chip and retrospect label that Rhizoma Gastrodiae DNA Internet of Things anti-counterfeiting systems use, tool
The Chinese medicine trading company of standby biological detection experimental ability, large-scale transaction place, hospital etc. can quickly be examined by DNA chip
It surveys, and true and false by the discriminating of DNA big data analysis, carries out anti-fake.Do not have pharmacy, the consumer etc. of biological detection experimental ability
It can be traced by tracing label, check the information of Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and detection, cloud
End can analyse whether to exist abnormal and analysis result is issued inquiry.By big data make the data that retrospect tag queries arrive with
It time and space and changes, even if copying identical retrospect label, abnormal request for information also can be by system discovery.It realizes
The duplication of fake producer has been efficiently controlled, preferably counterfeit protection measures are formed.
Description of the drawings
Fig. 1 is the schematic diagram of the Rhizoma Gastrodiae anti-fake traceability system based on surface plasma resonance technology.
Fig. 2 is Rhizoma Gastrodiae DNA rapid identification method flow charts.
Specific implementation mode
Below in conjunction with the accompanying drawings and specific embodiment, the present invention can be better described.
Embodiment one：
DNA chip is prepared, detailed process is as follows：
Can be Au or Ag 1. adhering to the metal film of one layer of 150nm by metal coating technique in silicon chip surface；
2. in probe genetic fragment sulfhydrylation, then by the probe points of different sulfhydrylations to different zones, in 4 DEG C of conditions
It is lower to be kept for 12 hours, wherein the gene probe includes following probe：
Probe one：TGATATGCTTAAGTTCAGCGG；
Probe two：TCCTACCTGATTTGAGGTCAG；
Probe three：TTTGAAGCATGAATCC；
Probe four：AGATAATTATC；
Probe five：AGATAATTATCACAC；
Probe six：GCGTTCAAAGATTCGATGAT；
3. then washing the unbonded probe of metallic film surface with deionized water, then dried up with nitrogen.
There is good stability by DNA chip prepared by the above method, can for a long time be flowed on the market with product
Logical, the DNA probe on surface is designed for the DNA sequence dna of Rhizoma Gastrodiae, some existing DNA of plants probes are being added, are passing through spy
Needle tests the DNA information of Rhizoma Gastrodiae sample, has specificity, good test effect.
Embodiment two：
Rhizoma Gastrodiae DNA databases are built, detailed process is as follows：
1. Rhizoma Gastrodiae sample is extracted by CTAB methods, detailed process is as follows：In centrifuge tube be added 4ml CTAB extracting solutions and
80ul mercaptoethanols preheat in 65 ± 5 DEG C of water-baths, take Rhizoma Gastrodiae sample, liquid nitrogen grinding is at powder, the centrifugation being transferred to after preheating
Guan Zhong, sealing, 30 ± 10 minutes are kept the temperature in 65 ± 5 DEG C of water-baths, take out centrifuge tube, and 4ml phenol is added in fast cooling to room temperature
: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol, mixing form mixed emulsion；12000r/min centrifuges 10min, takes
Clear liquid, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10-20min after mixing,
12000r/min centrifuges 10min, goes supernatant, precipitation to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, TE buffer solutions and end is added
The RNase of a concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Rhizoma Gastrodiae DNA sample.
2. the Rhizoma Gastrodiae DNA sample after extraction is carried out hybridization reaction with DNA chip：Rhizoma Gastrodiae DNA sample is injected into DNA chip
Surface, hybridization reaction 5 hours at 45 DEG C.
3. the spr signal of each probe area is obtained, in input database；
4. a variety of Rhizoma Gastrodiae samples without brand, different size, different sources, different batches are passed sequentially through step 1 to 3
It is detected, forms Rhizoma Gastrodiae DNA databases.
The DNA information in Rhizoma Gastrodiae sample is extracted by step 1, relatively other methods, extracting concentration is high, relatively complete
It is whole, hybridization reaction is carried out with DNA chip, reaction is sensitiveer, and conjugation is relatively high, observes the data in DNA databases, finds
Without brand, different size, different sources, different batches Rhizoma Gastrodiae sample data it is roughly the same, have part have differences.
Embodiment three：
Check that the validity of DNA chip and Rhizoma Gastrodiae DNA databases, testing staff do not know the true and false of tested Rhizoma Gastrodiae sample：
1. tested Rhizoma Gastrodiae sample is extracted by CTAB methods, detailed process is as follows：4ml CTAB are added in centrifuge tube to carry
Liquid and 80ul mercaptoethanols are taken, is preheated in 65 ± 5 DEG C of water-baths, takes Rhizoma Gastrodiae sample, liquid nitrogen grinding is at powder, after being transferred to preheating
Centrifuge tube in, sealing keep the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, and taking-up centrifuge tube, fast cooling to room temperature adds
Enter 4ml phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol, mixing forms mixed emulsion；12000r/min is centrifuged
10min takes supernatant, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10- after mixing
20min, 12000r/min centrifuge 10min, and supernatant, precipitation is gone to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, and TE bufferings are added
The RNase of liquid and final concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Rhizoma Gastrodiae DNA sample.2. by the Rhizoma Gastrodiae DNA samples after extraction
Product carry out hybridization reaction with DNA chip：Rhizoma Gastrodiae DNA sample is injected into DNA chip surface, hybridization reaction 5 hours at 45 DEG C.
3. obtaining the spr signal of each probe area, the spr signal data of detection and Rhizoma Gastrodiae DNA databases are compared,
The sample that similarity is more than 90% is true, and the sample being less than is false.
4. a variety of Rhizoma Gastrodiae samples are passed sequentially through step 1 to be detected to 3, the identification true and false is obtained as a result, detection accuracy
It is 100%.Illustrate that DNA chip and Rhizoma Gastrodiae DNA databases can be effectively used for the discriminating of the Rhizoma Gastrodiae true and false.
Through this embodiment, it may be said that bright DNA chip and Rhizoma Gastrodiae DNA databases can be effectively used for the discriminating of the Rhizoma Gastrodiae true and false.It is pseudo-
The DNA chip detection data of product Rhizoma Gastrodiae sample and Rhizoma Gastrodiae DNA database similarities are below 85%, and certified products Rhizoma Gastrodiae sample
DNA chip detection data is above 95% with Rhizoma Gastrodiae DNA database similarities, can obviously distinguish, pass through DNA chip in this way
Testing result error is small.It high in the clouds can be between 85%-95% to the setting of certified products similarity limit.
Example IV：
A kind of Rhizoma Gastrodiae anti-fake traceability system based on surface plasma resonance technology, including high in the clouds, DNA chip, identification dress
It sets, trace label, DNA searching terminals, retrospective retrival terminal；
The high in the clouds includes storage module, analysis module, high in the clouds information receiving module, high in the clouds message output module, described
Storage module stores the information of Rhizoma Gastrodiae DNA databases and Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and detection,
The high in the clouds information receiving module receives the data of DNA searching terminals and retrospective retrival terminal by network and sends data to
Analysis module, the data of the analysis module analysis described information receiving module reception receive related data from storage module, are right
Than analysis DNA data, by DNA analysis result data and analysis Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and inspection
Data and analysis result are simultaneously transmitted to message output module by the information of survey, and the high in the clouds message output module transmits information to
DNA searching terminals, retrospective retrival terminal；
The DNA chip is the DNA chip prepared by embodiment one；
Each retrospect label includes corresponding and unique id information, the id information, Rhizoma Gastrodiae production, processing, store,
Transaction, logistics, the information of terminal and detection form the storage module in corresponding ID data packets storage beyond the clouds；
DNA searching terminals, including DNA data uploading module, DNA data reception modules, the DNA data uploading module will
DNA chip detection data is transmitted to high in the clouds, and the DNA data reception modules receive high in the clouds DNA analysis result；
Retrospective retrival terminal includes retrospect label information read module, retrospective retrival data uploading module, retrospective retrival number
According to receiving module, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data
Label information and DNA testing results are transmitted to high in the clouds, the retrospect inspection by uploading module, the retrospective retrival data uploading module
Rope data reception module receives the information of Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and detection.
The DNA chip and retrospect label that Rhizoma Gastrodiae DNA Internet of Things anti-counterfeiting systems use, have in biological detection experimental ability
Medicine trading company, large-scale transaction place, hospital etc. can be used for quickly detecting by DNA chip, and pass through DNA big data analysis
Differentiate it is true and false, carry out it is anti-fake.Not having pharmacy, consumer of biological detection experimental ability etc. can be chased after by tracing label
It traces back, checks that the information of Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and detection, high in the clouds can analyse whether there is exception simultaneously
Analysis result is issued into inquiry.By big data make retrospect tag queries to data change with time and space, i.e.,
Just identical retrospect label is copied, abnormal request for information also can be by system discovery.Realization has efficiently controlled fake producer's
It replicates, forms preferably counterfeit protection measures.
The retrospect label is RFID RFID tags.The retrospect label is arranged in DNA chip.DNA retrievals are eventually
End and retrospective retrival terminal can be a terminal, i.e., the dress handled simultaneous with RFID radio frequency recognition functions and networking data
It sets, such as mobile phone, terminal with RFID identification function.
Agent, logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to cloud
The data of correspondence ID in the storage module of end are surrounded by reading permission, number of the consumer to the correspondence ID in the storage module of high in the clouds
It reads permission according to being surrounded by and forbids the user read permission in addition to the manager of high in the clouds.Reading every time in this way has corresponding identity
Information produces exception reporting if the consumer of terminal repeatedly inquires, and retrospect label may be occurred by informing that consumer is larger
The case where being replicated, if there is consumer retracts commodity, sales end can typing correlation sales information, reduce the possibility of high in the clouds erroneous judgement
Property.
Each ID data packets are equipped with consumer's reading times restricted program on the high in the clouds storage module, are set to from identity and disappear
Restriction ID data packets are only capable of being registered the certain number of user's reading after the user of expense person reads ID data packets for the first time.The high in the clouds
After each ID data packets start equipped with timing routine, self-generating ID on storage module after a certain period of time, retrospective retrival terminal can not
It retrieves.Medicinal material manufacturer can according to the characteristic of itself product, be set according to actual conditions retrospect label data retrieval the term of validity,
Number is retrieved, timeliness one arrives, then traces label automatic damage, even if personator has recycled retrospect label, and scheme in vain.
Medicinal material manufacturer can be nullified specified retrospect tag ID when specific according to actual conditions.Make retrospect label
The validity of ID among the control of medicinal material manufacturer, allows fake producer to have no exploits always.
High in the clouds manager needs the safety of stringent control high in the clouds data, can set management secret key, it is ensured that high in the clouds data are tight
Lattice rest in production firm.
Example the above is only the implementation of the present invention is not used for limiting the scope of the invention；The protection of the present invention
Range is limited by the claim in claims, and every according to equivalence changes made by invention and modification, all in this hair
Within the protection domain of bright patent.
Claims (10)
1. a kind of Rhizoma Gastrodiae anti-fake traceability system based on surface plasma resonance technology, it is characterised in that：Including high in the clouds, DNA cores
Piece, identification apparatus, retrospect label, DNA searching terminals, retrospective retrival terminal；
The high in the clouds includes storage module, analysis module, high in the clouds information receiving module, high in the clouds message output module, the storage
Module stores the information of Rhizoma Gastrodiae DNA databases and Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and detection, described
High in the clouds information receiving module receives the data of DNA searching terminals and retrospective retrival terminal by network and sends data to analysis
Module, the data of the analysis module analysis described information receiving module reception receive related data from storage module, to score
Analyse DNA data, by DNA analysis result data and the production of analysis Rhizoma Gastrodiae, processing, storage, transaction, logistics, terminal and detection
Data and analysis result are simultaneously transmitted to message output module by information, and the high in the clouds message output module transmits information to DNA
Searching terminal, retrospective retrival terminal；
The DNA chip is based on surface plasma resonance technology, including solid phase support object, gene probe, the gene probe needle
Include following probe to Rhizoma Gastrodiae DNA designs：
Probe one：TGATATGCTTAAGTTCAGCGG；
Probe two：TCCTACCTGATTTGAGGTCAG；
Probe three：TTTGAAGCATGAATCC；
Probe four：AGATAATTATC；
Probe five：AGATAATTATCACAC；
Probe six：GCGTTCAAAGATTCGATGAT；
Each retrospect label includes corresponding and unique id information, and the id information, processing, storage, is handed at Rhizoma Gastrodiae production
Easily, logistics, terminal and the information of detection form the storage module in corresponding ID data packets storage beyond the clouds；
DNA searching terminals, including DNA data uploading module, DNA data reception modules, the DNA data uploading module is by DNA
Chip detection data is transmitted to high in the clouds, and the DNA data reception modules receive high in the clouds DNA analysis result；
Retrospective retrival terminal includes tracing label information read module, retrospective retrival data uploading module, retrospective retrival data to connect
Module is received, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data and uploads
Label information and DNA testing results are transmitted to high in the clouds, the retrospective retrival number by module, the retrospective retrival data uploading module
The information of Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and detection is received according to receiving module.
2. the Rhizoma Gastrodiae anti-fake traceability system according to claim 1 based on surface plasma resonance technology, it is characterised in that：
The Rhizoma Gastrodiae DNA databases are established in the following manner：
(1) certified products Rhizoma Gastrodiae sample is extracted into Rhizoma Gastrodiae DNA sample；
(2) the Rhizoma Gastrodiae DNA sample after extraction is subjected to hybridization reaction with DNA chip；
It (3) will be in hybridization reaction result input database；
(4) by it is a variety of without brand, different size, different sources, different batches Rhizoma Gastrodiae sample pass sequentially through step (1),
(2), (3) are detected, and form Rhizoma Gastrodiae DNA databases.
3. the Rhizoma Gastrodiae anti-fake traceability system according to claim 2 based on surface plasma resonance technology, it is characterised in that：
In step (1), Rhizoma Gastrodiae sample is extracted by CTAB methods, and detailed process is as follows：In centrifuge tube be added 4ml CTAB extracting solutions and
80ul mercaptoethanols preheat in 65 ± 5 DEG C of water-baths, take Rhizoma Gastrodiae sample, liquid nitrogen grinding is at powder, the centrifugation being transferred to after preheating
Guan Zhong, sealing, 30 ± 10 minutes are kept the temperature in 65 ± 5 DEG C of water-baths, take out centrifuge tube, and 4ml phenol is added in fast cooling to room temperature
: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol, mixing form mixed emulsion；12000r/min centrifuges 10min, takes
Clear liquid, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10-20min after mixing,
12000r/min centrifuges 10min, goes supernatant, precipitation to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, TE buffer solutions and end is added
The RNase of a concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Rhizoma Gastrodiae DNA sample.
4. the Rhizoma Gastrodiae anti-fake traceability system according to claim 1 based on surface plasma resonance technology, it is characterised in that：
The DNA chip is surface plasma resonant sensor chip, and the solid phase support object is silicon chip, the solid phase support object table
Layer of metal film is adhered in face, and the gene probe is fixed on metallic film surface.
5. the Rhizoma Gastrodiae anti-fake traceability system according to claim 1 based on surface plasma resonance technology, it is characterised in that：
The retrospect label is RFID RFID tags.
6. the Rhizoma Gastrodiae anti-fake traceability system according to claim 1 based on surface plasma resonance technology, it is characterised in that：
The retrospect label is arranged in DNA chip.
7. the Rhizoma Gastrodiae anti-fake traceability system according to claim 1 based on surface plasma resonance technology, it is characterised in that：
Agent, logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics store mould to high in the clouds
The data of corresponding ID in the block are surrounded by reading permission, and the consumer is surrounded by reading to the data of the correspondence ID in the storage module of high in the clouds
Weighting limits and forbids the user read permission in addition to the manager of high in the clouds.
8. the Rhizoma Gastrodiae anti-fake traceability system according to claim 7 based on surface plasma resonance technology, it is characterised in that：
Each ID data packets are equipped with consumer's reading times restricted program on the high in the clouds storage module, and the use of consumer is set to from identity
Restriction ID data packets are only capable of being registered the certain number of user's reading after ID data packets are read at family for the first time.
9. the Rhizoma Gastrodiae anti-fake traceability system according to claim 1 based on surface plasma resonance technology, it is characterised in that：
After each ID data packets start equipped with timing routine, self-generating ID on the high in the clouds storage module after a certain period of time, retrospective retrival
Terminal can not retrieve.
10. a kind of Rhizoma Gastrodiae anti-fake traceability system of claim 1-9 any one of them based on surface plasma resonance technology
Anti-fake source tracing method, which is characterized in that including following：
Personnel with detectability, detect in the following ways：
(1) DNA sample for being tested Rhizoma Gastrodiae sample is extracted by CTAB methods, and DNA sample and DNA chip are subjected to hybridization reaction, obtained
Take response data；
(2) retrospect label is scanned by retrospective retrival terminal, response data is uploaded to high in the clouds and high in the clouds by DNA searching terminals
Data in DNA databases are compared, and obtain true and false result；
(3) detection site, time, result are transmitted to high in the clouds retrospect label Rhizoma Gastrodiae sample and correspond to ID data corresponding to batch
Packet；
The personnel for not having detectability, identify in the following ways：
(1) retrospect label is scanned by retrospective retrival terminal, obtains Rhizoma Gastrodiae production, processing, storage, transaction, logistics, terminal and inspection
The information of survey；
(2) high in the clouds according to historical query information analyze and analysis result is sent to retrospective retrival terminal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810432804.7A CN108629388A (en) | 2018-05-08 | 2018-05-08 | A kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810432804.7A CN108629388A (en) | 2018-05-08 | 2018-05-08 | A kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108629388A true CN108629388A (en) | 2018-10-09 |
Family
ID=63695875
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810432804.7A Withdrawn CN108629388A (en) | 2018-05-08 | 2018-05-08 | A kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108629388A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116071091A (en) * | 2023-03-16 | 2023-05-05 | 山东丰茂源认证服务有限公司 | Pharmacy raw material traceability system based on Internet of things |
-
2018
- 2018-05-08 CN CN201810432804.7A patent/CN108629388A/en not_active Withdrawn
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116071091A (en) * | 2023-03-16 | 2023-05-05 | 山东丰茂源认证服务有限公司 | Pharmacy raw material traceability system based on Internet of things |
| CN116071091B (en) * | 2023-03-16 | 2023-06-20 | 山东丰茂源认证服务有限公司 | Pharmacy raw material traceability system based on Internet of things |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Qian et al. | Rapid single-particle chemical imaging of nanoplastics by SRS microscopy | |
| US20020150966A1 (en) | Specimen-linked database | |
| CN108898393A (en) | Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| CN101788564A (en) | Control method for reagent matched with clinical examining and analyzing system | |
| CN109554474A (en) | A kind of method and kit of BCR-ABL fusion quantitative detection | |
| CN110208238A (en) | It is a kind of based on SVM models coupling image to the accurate positioning method of cancerous lung tissue | |
| CN108315388A (en) | A kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method | |
| CN108614956A (en) | A kind of Internet of Things for the stem of noble dendrobium differentiates traceability system and differentiates source tracing method | |
| Sohn et al. | Identification of Amaranthus species using visible-near-infrared (vis-NIR) spectroscopy and machine learning methods | |
| CN108629388A (en) | A kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology | |
| Castrejón-Jiménez et al. | Challenges in the detection of SARS-CoV-2: evolution of the lateral flow immunoassay as a valuable tool for viral diagnosis | |
| CN115064215A (en) | Method for tracing strain and identifying attribute through similarity | |
| CN108645797A (en) | Donkey-hide gelatin DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method | |
| CN103698353A (en) | Bird's nest identification method | |
| CN108456718A (en) | A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method | |
| CN108492122A (en) | A kind of Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| CN108629604A (en) | Anti-fake traceability system based on American Ginseng DNA and anti-fake source tracing method | |
| CN103852455B (en) | Equipment and method for quantitatively and rapidly detecting uranium at constant temperature in real time | |
| CN108681906A (en) | A kind of radix pseudostellariae Internet of Things anti-fake traceability system and application process | |
| CN108898394A (en) | A kind of safflower DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| CN108866158A (en) | A kind of ganoderma lucidum DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| Harnly et al. | Variance of commercial powdered milks analyzed by proton nuclear magnetic resonance and impact on detection of adulterants | |
| Zhao et al. | Microbial spore genetic marker technology, a potential technology for traditional Chinese medicine traceability system | |
| CN111696623B (en) | Laboratory information management system based on DNA coding compound library | |
| Horacek et al. | Differentiation of Apricots of Different Geographic Origin in Central and Southern Europe by Applying 87Sr/86Sr Analysis: Potential and Limitations |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20181009 |
|
| WW01 | Invention patent application withdrawn after publication |