CN108456718A - A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method - Google Patents
A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method Download PDFInfo
- Publication number
- CN108456718A CN108456718A CN201810431600.1A CN201810431600A CN108456718A CN 108456718 A CN108456718 A CN 108456718A CN 201810431600 A CN201810431600 A CN 201810431600A CN 108456718 A CN108456718 A CN 108456718A
- Authority
- CN
- China
- Prior art keywords
- dna
- radix notoginseng
- data
- clouds
- module
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- G—PHYSICS
- G06—COMPUTING; CALCULATING OR COUNTING
- G06Q—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
- G06Q30/00—Commerce
- G06Q30/018—Certifying business or products
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Business, Economics & Management (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Health & Medical Sciences (AREA)
- Theoretical Computer Science (AREA)
- Microbiology (AREA)
- Marketing (AREA)
- Economics (AREA)
- Development Economics (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- General Physics & Mathematics (AREA)
- General Business, Economics & Management (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Finance (AREA)
- Molecular Biology (AREA)
- Accounting & Taxation (AREA)
- Entrepreneurship & Innovation (AREA)
- Strategic Management (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Information Retrieval, Db Structures And Fs Structures Therefor (AREA)
Abstract
The invention belongs to Radix Notoginseng to identify anti-counterfeit field, more particularly to a kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method, the DNA chip and retrospect label used including high in the clouds, DNA chip, identification apparatus, retrospect label, DNA searching terminals, retrospective retrival terminal Radix Notoginseng DNA Internet of Things anti-counterfeiting systems, have being used for quickly detecting by DNA chip for biological detection experimental ability, and it is true and false by the discriminating of DNA big data analysis, it carries out anti-fake.Do not have being traced by tracing label for biological detection experimental ability, checks that the information of Radix Notoginseng production, processing, storage, transaction, logistics, terminal and detection, high in the clouds can analyse whether to exist abnormal and analysis result issued inquiry.By big data make retrospect tag queries to data change with time and space, even if copying identical retrospect label, abnormal request for information also can be by system discovery.It realizes the duplication for having efficiently controlled fake producer, forms preferably counterfeit protection measures.
Description
Technical field
The invention belongs to Radix Notoginseng to identify anti-counterfeit field, and in particular to a kind of Radix Notoginseng networking based on DNA chip is anti-fake to trace to the source
System and anti-fake source tracing method.
Background technology
Radix Notoginseng main product is in Yunnan, Guangxi;Warm-natured, sweet in flavor, slight bitter has the function of styptic powder paralysis, detumescence ding-tong, extraction
Object notoginsenoside has the effects that cardiac stimulant, invigorates blood circulation, promotes blood circulation, and is clinically used for bleeding, traumatic injury, chest and abdomen shouting pain etc.,
Have been widely used and unique curative effect in tools such as orthopedics and traumatology of Chinese medicine, surgery, gynaecology, it is expensive in addition, in the market often
There is adulterant similar with its form and uses Radix Notoginseng, such as panax japonicus, panax japonicus majoris, curcuma zedoary as;Not only cause the mixed of medicinal material market
Disorderly, and adulterant does not have pharmacological action not only, in some instances it may even be possible to generate toxic side effect, endanger clinical application safety belt.
Traditional is anti-fake mainly using physics modes such as anti-counterfeiting label, false proof card, anti-counterfeit packages, by the straight of assessor
Connect the subjective mode such as observation, touch, number inquiry.As patent CN00213421.7 discloses a kind of Anti-false cylindrical paper container, including
Cover, tank bottom and tubular composite paper tank body, cover, tank bottom are fixed together with tank body, and tank body is equipped with by continuous
The point off circumference that breaking point or geosutures are constituted.This structure is easily copied.As patent CN200410012982.2 discloses one
Kind G 2 encoding method for commodity is the substance being applied in each field, commodity, equipment and other coding methods.Coding is divided into two
Grade, level encoder are merchandise classification, general important name and alias, and two level is encoded to the general important name of commodity or alias by level encoder
The commercial specification model that derives from, measurement unit, production firm, packaging label, authentication code, other marks, condition of storage
The relationship of equal codes, level encoder and two level coding is not only independent but also complementary two generations relationship, can be applied independently or together.Its
It is identified, as medical mark includes Chinese medicine mark, prescription medicine mark, imported medicine identifies, special management medicine identifies, country is basic
Medicine identifies, but coding can be replicated easily.Therefore, as long as product is once dispatch from the factory, fake producer is gratifying to be intended to be imitated for ground
It makes, is not broken away from always by counterfeit destiny.
Invention content
The present invention is in view of the above-mentioned problems, providing a kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake tracing back
Source method.
The technical solution used in the present invention is as follows:A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip, including
High in the clouds, DNA chip, identification apparatus, retrospect label, DNA searching terminals, retrospective retrival terminal;
The high in the clouds includes storage module, analysis module, high in the clouds information receiving module, high in the clouds message output module, described
Storage module stores the information of Radix Notoginseng DNA databases and Radix Notoginseng production, processing, storage, transaction, logistics, terminal and detection,
The high in the clouds information receiving module receives the data of DNA searching terminals and retrospective retrival terminal by network and sends data to
Analysis module, the data of the analysis module analysis described information receiving module reception receive related data from storage module, are right
Than analysis DNA data, by DNA analysis result data and analysis Radix Notoginseng production, processing, storage, transaction, logistics, terminal and inspection
Data and analysis result are simultaneously transmitted to message output module by the information of survey, and the high in the clouds message output module transmits information to
DNA searching terminals, retrospective retrival terminal;
The DNA chip, including solid phase support object, gene probe, the gene probe include being directed to Radix Notoginseng gene as follows
The probe of design:
Probe one:GCGTAGCGCAGCGGGGGGTT;
Probe two:TTACCGGAGGGCACAGAGTG;
Probe three:GTGCTGTTCACCACCAACAA;
Probe four:GTTTTCGAGTGTACTGGGAC;
Probe five:TTTTCGGGAGAAGAGTACAG;
Probe six:CTCAGGAACCGCTACCTGCA.
It can also include existing known various plants DNA probe;
Each retrospect label includes corresponding and unique id information, the id information, Radix Notoginseng production, processing, store,
Transaction, logistics, the information of terminal and detection form the storage module in corresponding ID data packets storage beyond the clouds;
DNA searching terminals, including DNA data uploading module, DNA data reception modules, the DNA data uploading module will
DNA chip detection data is transmitted to high in the clouds, and the DNA data reception modules receive high in the clouds DNA analysis as a result, DNA searching terminals
Can be mobile phone, computer;
Retrospective retrival terminal includes retrospect label information read module, retrospective retrival data uploading module, retrospective retrival number
According to receiving module, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data
Label information and DNA testing results are transmitted to high in the clouds, the retrospect inspection by uploading module, the retrospective retrival data uploading module
Rope data reception module receives the information of Radix Notoginseng production, processing, storage, transaction, logistics, terminal and detection.
The Radix Notoginseng DNA databases are established in the following manner:
(1) certified products Radix Notoginseng sample is extracted into Radix Notoginseng DNA sample;
(2) the Radix Notoginseng DNA sample after extraction is subjected to hybridization reaction with DNA chip;
It (3) will be in hybridization reaction result input database;
(4) a variety of Radix Notoginseng samples without brand, different size, different sources, different batches are passed sequentially through into step
(1), (2), (3) are detected, and form Radix Notoginseng DNA databases.
In step (1), Radix Notoginseng sample is extracted by CTAB methods, and detailed process is as follows:4ml CTAB are added in centrifuge tube
Extracting solution and 80ul mercaptoethanols, preheat in 65 ± 5 DEG C of water-baths, and Radix Notoginseng sample, liquid nitrogen grinding is taken to be transferred to preheating at powder
In centrifuge tube afterwards, sealing keeps the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, taking-up centrifuge tube, fast cooling to room temperature,
4ml phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol is added, mixing forms mixed emulsion;12000r/min is centrifuged
10min takes supernatant, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10- after mixing
20min, 12000r/min centrifuge 10min, and supernatant, precipitation is gone to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, and TE bufferings are added
The RNase of liquid and final concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Radix Notoginseng DNA sample.
The DNA chip is surface plasma resonant sensor chip, and the solid phase support object is silicon chip, the solid phase
Layer of metal film is adhered on supporter surface, and the gene probe is fixed on metallic film surface.Utilize surface plasma resonance
(surface plasmon resonance, SPR) biosensor technology quickly detects the DNA of Radix Notoginseng.Surface plasma is total
Shake (Surface Plasmon Resonance, SPR) be a kind of optical physics phenomenon.When a branch of P polarization light is in certain angle
It is incident on prism end face in range, surface plasma-wave will be generated at the interface of prism and metallic film (Au or Ag).Work as incidence
When the propagation constant of light wave and the propagation constant of surface plasma-wave match, free electron in metal film is caused to generate resonance,
That is surface plasma resonance.When analysis, first one layer of biomolecule is fixed in censorchip surface and identify film, then by sample to be tested
Chip surface is flowed through, if there is the molecule that can identify membrane interaction with the biomolecule of chip surface in sample, gold can be caused
Film surface variations in refractive index eventually leads to the variation of the angles SPR and obtains concentration, the parent of analyte by detecting SPR angle changes
With the information such as power, kinetic constant and specificity.Occur both when Radix Notoginseng DNA sample after extraction is injected into chip surface special
The opposite sex combines, and changes so as to cause chip surface optical parameter, and show as electronic signals, specific bond determinand
Amount it is different, the response intensity of signal is different.
The retrospect label is RFID RFID tags.Radio frequency identification, RFID (Radio Frequency
Identification) technology, also known as radio frequency identification are a kind of communication technologys, are commonly called as electronic tag.Radio can be passed through
Signal identifies specific objective and reads and writes related data, is connect without establishing mechanical or optics between identifying system and specific objective
It touches.Convenient for identification, make the information Rapid input of production, processing, storage, transaction, logistics, terminal and detection.Item can also be taken
Shape code, Quick Response Code isotype, but need to be scanned one by one, it is unfavorable for the typing of high-volume information.
The retrospect label is arranged in DNA chip.Directly testing result can be chased after by scanning after tester's detection
The label that traces back connects high in the clouds, detection data is transmitted to high in the clouds, and obtain high in the clouds analysis result, coherent detection data are saved in cloud
On end.
Agent, logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to cloud
The data of correspondence ID in the storage module of end are surrounded by reading permission, number of the consumer to the correspondence ID in the storage module of high in the clouds
It reads permission according to being surrounded by and forbids the user read permission in addition to the manager of high in the clouds.Reading every time in this way has corresponding identity
Information produces exception reporting if the consumer of terminal repeatedly inquires, and retrospect label may be occurred by informing that consumer is larger
The case where being replicated, if there is consumer retracts commodity, sales end can typing correlation sales information, reduce the possibility of high in the clouds erroneous judgement
Property.
Each ID data packets are equipped with consumer's reading times restricted program on the high in the clouds storage module, are set to from identity and disappear
Restriction ID data packets are only capable of being registered the certain number of user's reading after the user of expense person reads ID data packets for the first time.
After each ID data packets start equipped with timing routine, self-generating ID on the high in the clouds storage module after a certain period of time,
Retrospective retrival terminal can not retrieve.High in the clouds manager can be according to the characteristic of Radix Notoginseng product, and be set according to actual conditions DNA has
The effect phase avoids the retrospect label on expired product or expired product from shifting and uses.
A kind of anti-fake source tracing method of the above-mentioned Radix Notoginseng networking anti-fake traceability system based on DNA chip, including it is following:
Personnel with detectability, detect in the following ways:
(1) DNA sample for being tested Radix Notoginseng sample is extracted by CTAB methods, and DNA sample with DNA chip hybridize instead
It answers, obtains response data;
(2) by retrospective retrival terminal scan retrospect label, by response data by DNA searching terminals be uploaded to high in the clouds with
Data in the DNA databases of high in the clouds are compared, and obtain true and false result;
(3) detection site, time, result are transmitted to high in the clouds retrospect label Radix Notoginseng sample and correspond to ID numbers corresponding to batch
According to packet;
The personnel for not having detectability, identify in the following ways:
(1) retrospect label is scanned by retrospective retrival terminal, obtains Radix Notoginseng production, processing, storage, transaction, logistics, terminal
With the information of detection;
(2) high in the clouds according to historical query information analyze and analysis result is sent to retrospective retrival terminal.
Beneficial effects of the present invention are as follows:Based on DNA chip Radix Notoginseng networking anti-fake traceability system use DNA chip and
Label is traced, having the Chinese medicine trading company of biological detection experimental ability, large-scale transaction place, hospital etc. can be by DNA core
Piece is used for quickly detecting, and true and false by the discriminating of DNA big data analysis, is carried out anti-fake.Do not have biological detection experimental ability
Pharmacy, consumer etc. can by trace label trace, check Radix Notoginseng production, processing, storage, transaction, logistics, terminal and
The information of detection, high in the clouds can analyse whether to exist abnormal and analysis result issued inquiry.Make retrospect label by big data
The data inquired change with time and space, even if copying identical retrospect label, abnormal request for information also can
By system discovery.It realizes the duplication for having efficiently controlled fake producer, forms preferably counterfeit protection measures.
Description of the drawings
Fig. 1 is the schematic diagram of the Radix Notoginseng networking anti-fake traceability system based on DNA chip.
Fig. 2 is Radix Notoginseng DNA rapid identification method flow charts.
Specific implementation mode
Below in conjunction with the accompanying drawings and specific embodiment, the present invention can be better described.
Embodiment one:
DNA chip is prepared, detailed process is as follows:
Can be Au or Ag 1. adhering to the metal film of one layer of 150nm by metal coating technique in silicon chip surface;
2. in probe genetic fragment sulfhydrylation, then by the probe points of different sulfhydrylations to different zones, in 4 DEG C of conditions
It is lower to be kept for 12 hours, wherein the gene probe includes following probe:
Probe one:GCGTAGCGCAGCGGGGGGTT;
Probe two:TTACCGGAGGGCACAGAGTG;
Probe three:GTGCTGTTCACCACCAACAA;
Probe four:GTTTTCGAGTGTACTGGGAC;
Probe five:TTTTCGGGAGAAGAGTACAG;
Probe six:CTCAGGAACCGCTACCTGCA.
3. then washing the unbonded probe of metallic film surface with deionized water, then dried up with nitrogen.
There is good stability by DNA chip prepared by the above method, can for a long time be flowed on the market with product
Logical, the DNA probe on surface is designed for the DNA sequence dna of Radix Notoginseng, some existing DNA of plants probes are being added, are passing through spy
Needle tests the DNA information of Radix Notoginseng sample, has specificity, good test effect.
Embodiment two:
Radix Notoginseng DNA databases are built, detailed process is as follows:
1. Radix Notoginseng sample is extracted by CTAB methods, detailed process is as follows:In centrifuge tube be added 4ml CTAB extracting solutions and
80ul mercaptoethanols preheat in 65 ± 5 DEG C of water-baths, take Radix Notoginseng sample, liquid nitrogen grinding is at powder, the centrifugation being transferred to after preheating
Guan Zhong, sealing, 30 ± 10 minutes are kept the temperature in 65 ± 5 DEG C of water-baths, take out centrifuge tube, and 4ml phenol is added in fast cooling to room temperature
: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol, mixing form mixed emulsion;12000r/min centrifuges 10min, takes
Clear liquid, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10-20min after mixing,
12000r/min centrifuges 10min, goes supernatant, precipitation to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, TE buffer solutions and end is added
The RNase of a concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Radix Notoginseng DNA sample.
2. the Radix Notoginseng DNA sample after extraction is carried out hybridization reaction with DNA chip:Radix Notoginseng DNA sample is injected into DNA chip
Surface, hybridization reaction 5 hours at 45 DEG C.
3. the spr signal of each probe area is obtained, in input database;
4. a variety of Radix Notoginseng samples without brand, different size, different sources, different batches are passed sequentially through step 1 to 3
It is detected, forms Radix Notoginseng DNA databases.
The DNA information in Radix Notoginseng sample is extracted by step 1, relatively other methods, extracting concentration is high, relatively complete
It is whole, hybridization reaction is carried out with DNA chip, reaction is sensitiveer, and conjugation is relatively high, observes the data in DNA databases, finds
Without brand, different size, different sources, different batches Radix Notoginseng sample data it is roughly the same, have part have differences.
Embodiment three:
Check that the validity of DNA chip and Radix Notoginseng DNA databases, testing staff do not know the true and false of tested Radix Notoginseng sample:
1. tested Radix Notoginseng sample is extracted by CTAB methods, detailed process is as follows:4ml CTAB are added in centrifuge tube to carry
Liquid and 80ul mercaptoethanols are taken, is preheated in 65 ± 5 DEG C of water-baths, takes Radix Notoginseng sample, liquid nitrogen grinding is at powder, after being transferred to preheating
Centrifuge tube in, sealing keep the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, and taking-up centrifuge tube, fast cooling to room temperature adds
Enter 4ml phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol, mixing forms mixed emulsion;12000r/min is centrifuged
10min takes supernatant, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10- after mixing
20min, 12000r/min centrifuge 10min, and supernatant, precipitation is gone to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, and TE bufferings are added
The RNase of liquid and final concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Radix Notoginseng DNA sample.2. by the Radix Notoginseng DNA samples after extraction
Product carry out hybridization reaction with DNA chip:Radix Notoginseng DNA sample is injected into DNA chip surface, hybridization reaction 5 hours at 45 DEG C.
3. obtaining the spr signal of each probe area, the spr signal data of detection and Radix Notoginseng DNA databases are compared,
The sample that similarity is more than 90% is true, and the sample being less than is false.
4. a variety of Radix Notoginseng samples are passed sequentially through step 1 to be detected to 3, the identification true and false is obtained as a result, detection accuracy
It is 100%.Illustrate that DNA chip and Radix Notoginseng DNA databases can be effectively used for the discriminating of the Radix Notoginseng true and false.
Through this embodiment, it may be said that bright DNA chip and Radix Notoginseng DNA databases can be effectively used for the discriminating of the Radix Notoginseng true and false.It is pseudo-
The DNA chip detection data of product Radix Notoginseng sample and Radix Notoginseng DNA database similarities are below 85%, and certified products Radix Notoginseng sample
DNA chip detection data is above 95% with Radix Notoginseng DNA database similarities, can obviously distinguish, pass through DNA chip in this way
Testing result error is small.It high in the clouds can be between 85%-95% to the setting of certified products similarity limit.
Example IV:
A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip, including high in the clouds, DNA chip, identification apparatus, retrospect
Label, DNA searching terminals, retrospective retrival terminal;
The high in the clouds includes storage module, analysis module, high in the clouds information receiving module, high in the clouds message output module, described
Storage module stores the information of Radix Notoginseng DNA databases and Radix Notoginseng production, processing, storage, transaction, logistics, terminal and detection,
The high in the clouds information receiving module receives the data of DNA searching terminals and retrospective retrival terminal by network and sends data to
Analysis module, the data of the analysis module analysis described information receiving module reception receive related data from storage module, are right
Than analysis DNA data, by DNA analysis result data and analysis Radix Notoginseng production, processing, storage, transaction, logistics, terminal and inspection
Data and analysis result are simultaneously transmitted to message output module by the information of survey, and the high in the clouds message output module transmits information to
DNA searching terminals, retrospective retrival terminal;
The DNA chip is the DNA chip prepared by embodiment one;
Each retrospect label includes corresponding and unique id information, the id information, Radix Notoginseng production, processing, store,
Transaction, logistics, the information of terminal and detection form the storage module in corresponding ID data packets storage beyond the clouds;
DNA searching terminals, including DNA data uploading module, DNA data reception modules, the DNA data uploading module will
DNA chip detection data is transmitted to high in the clouds, and the DNA data reception modules receive high in the clouds DNA analysis result;
Retrospective retrival terminal includes retrospect label information read module, retrospective retrival data uploading module, retrospective retrival number
According to receiving module, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data
Label information and DNA testing results are transmitted to high in the clouds, the retrospect inspection by uploading module, the retrospective retrival data uploading module
Rope data reception module receives the information of Radix Notoginseng production, processing, storage, transaction, logistics, terminal and detection.
The DNA chip and retrospect label that Radix Notoginseng networking anti-fake traceability system based on DNA chip uses, have biological detection
The Chinese medicine trading company of experimental ability, large-scale transaction place, hospital etc. can be used for quickly detecting by DNA chip, and be passed through
The discriminating of DNA big data analysis is true and false, carries out anti-fake.Pharmacy, the consumer etc. for not having biological detection experimental ability can pass through
Retrospect label is traced, and checks the information of Radix Notoginseng production, processing, storage, transaction, logistics, terminal and detection, high in the clouds can be analyzed
With the presence or absence of exception and analysis result is issued into inquiry.Make the data that retrospect tag queries arrive with the time by big data and
Space and change, even if copying identical retrospect label, abnormal request for information also can be by system discovery.Realization is effectively controlled
The duplication of fake producer has been made, preferably counterfeit protection measures are formed.
The retrospect label is RFID RFID tags.The retrospect label is arranged in DNA chip.DNA retrievals are eventually
End and retrospective retrival terminal can be a terminal, i.e., the dress handled simultaneous with RFID radio frequency recognition functions and networking data
It sets, such as mobile phone, terminal with RFID identification function.
Agent, logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to cloud
The data of correspondence ID in the storage module of end are surrounded by reading permission, number of the consumer to the correspondence ID in the storage module of high in the clouds
It reads permission according to being surrounded by and forbids the user read permission in addition to the manager of high in the clouds.Reading every time in this way has corresponding identity
Information produces exception reporting if the consumer of terminal repeatedly inquires, and retrospect label may be occurred by informing that consumer is larger
The case where being replicated, if there is consumer retracts commodity, sales end can typing correlation sales information, reduce the possibility of high in the clouds erroneous judgement
Property.
After each ID data packets start equipped with timing routine, self-generating ID on the high in the clouds storage module after a certain period of time,
Retrospective retrival terminal can not retrieve.Medicinal material manufacturer can be set according to actual conditions retrospect label according to the characteristic of itself product
The term of validity of data retrieval, retrieval number, timeliness one arrive, then trace label automatic damage, even if personator has recycled retrospect mark
Label, and scheme in vain.
Medicinal material manufacturer can be nullified specified retrospect tag ID when specific according to actual conditions.Make retrospect label
The validity of ID among the control of medicinal material manufacturer, allows fake producer to have no exploits always.
High in the clouds manager needs the safety of stringent control high in the clouds data, can set management secret key, it is ensured that high in the clouds data are tight
Lattice rest in production firm.
Example the above is only the implementation of the present invention is not used for limiting the scope of the invention;The protection of the present invention
Range is limited by the claim in claims, and every according to equivalence changes made by invention and modification, all in this hair
Within the protection domain of bright patent.
Claims (10)
- The anti-fake traceability system 1. a kind of Radix Notoginseng based on DNA chip is networked, it is characterised in that:Including high in the clouds, DNA chip, identification Device, retrospect label, DNA searching terminals, retrospective retrival terminal;The high in the clouds includes storage module, analysis module, high in the clouds information receiving module, high in the clouds message output module, the storage Module stores the information of Radix Notoginseng DNA databases and Radix Notoginseng production, processing, storage, transaction, logistics, terminal and detection, described High in the clouds information receiving module receives the data of DNA searching terminals and retrospective retrival terminal by network and sends data to analysis Module, the data of the analysis module analysis described information receiving module reception receive related data from storage module, to score Analyse DNA data, by DNA analysis result data and the production of analysis Radix Notoginseng, processing, storage, transaction, logistics, terminal and detection Data and analysis result are simultaneously transmitted to message output module by information, and the high in the clouds message output module transmits information to DNA Searching terminal, retrospective retrival terminal;The DNA chip, including solid phase support object, gene probe, the gene probe include being designed as follows for Radix Notoginseng gene Probe:Probe one:GCGTAGCGCAGCGGGGGGTT;Probe two:TTACCGGAGGGCACAGAGTG;Probe three:GTGCTGTTCACCACCAACAA;Probe four:GTTTTCGAGTGTACTGGGAC;Probe five:TTTTCGGGAGAAGAGTACAG;Probe six:CTCAGGAACCGCTACCTGCA;Each retrospect label includes corresponding and unique id information, and the id information, processing, storage, is handed at Radix Notoginseng production Easily, logistics, terminal and the information of detection form the storage module in corresponding ID data packets storage beyond the clouds;DNA searching terminals, including DNA data uploading module, DNA data reception modules, the DNA data uploading module is by DNA Chip detection data is transmitted to high in the clouds, and the DNA data reception modules receive high in the clouds DNA analysis result;Retrospective retrival terminal includes tracing label information read module, retrospective retrival data uploading module, retrospective retrival data to connect Module is received, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data and uploads Label information and DNA testing results are transmitted to high in the clouds, the retrospective retrival number by module, the retrospective retrival data uploading module The information of Radix Notoginseng production, processing, storage, transaction, logistics, terminal and detection is received according to receiving module.
- The anti-fake traceability system 2. Radix Notoginseng according to claim 1 based on DNA chip is networked, it is characterised in that:Described three Seven DNA databases are established in the following manner:(1) certified products Radix Notoginseng sample is extracted into Radix Notoginseng DNA sample;(2) the Radix Notoginseng DNA sample after extraction is subjected to hybridization reaction with DNA chip;It (3) will be in hybridization reaction result input database;(4) by it is a variety of without brand, different size, different sources, different batches Radix Notoginseng sample pass sequentially through step (1), (2), (3) are detected, and form Radix Notoginseng DNA databases.
- The anti-fake traceability system 3. Radix Notoginseng according to claim 2 based on DNA chip is networked, it is characterised in that:Step (1) In, Radix Notoginseng sample is extracted by CTAB methods, and detailed process is as follows:4ml CTAB extracting solutions and 80ul sulfydryls are added in centrifuge tube Ethyl alcohol preheats in 65 ± 5 DEG C of water-baths, takes Radix Notoginseng sample, and liquid nitrogen grinding is transferred in the centrifuge tube after preheating, envelope at powder Mouthful, 30 ± 10 minutes are kept the temperature in 65 ± 5 DEG C of water-baths, takes out centrifuge tube, 4ml phenol: three chloromethanes is added in fast cooling to room temperature Alkane: 25: 24: 1 mixed solution of isoamyl alcohol, mixing form mixed emulsion;12000r/min centrifuges 10min, takes supernatant, adds Enter the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10-20min after mixing, 12000r/min from Heart 10min goes supernatant, precipitation to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, TE buffer solutions and final concentration of 50 μ g/ is added The RNase of ml keeps the temperature 1h in 37 DEG C, obtains Radix Notoginseng DNA sample.
- The anti-fake traceability system 4. Radix Notoginseng according to claim 1 based on DNA chip is networked, it is characterised in that:The DNA Chip is surface plasma resonant sensor chip, and the solid phase support object is silicon chip, the attachment of solid phase support object surface Layer of metal film, the gene probe are fixed on metallic film surface.
- The anti-fake traceability system 5. Radix Notoginseng according to claim 1 based on DNA chip is networked, it is characterised in that:It is described to chase after The label that traces back is RFID RFID tags.
- The anti-fake traceability system 6. Radix Notoginseng according to claim 1 based on DNA chip is networked, it is characterised in that:It is described to chase after The label that traces back is arranged in DNA chip.
- The anti-fake traceability system 7. Radix Notoginseng according to claim 1 based on DNA chip is networked, it is characterised in that:Agent, Logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to pair in the storage module of high in the clouds Answer the data of ID to be surrounded by reading permission, the consumer data of the correspondence ID in the storage module of high in the clouds are surrounded by read permission with And forbid the user read permission in addition to the manager of high in the clouds.
- The anti-fake traceability system 8. Radix Notoginseng according to claim 7 based on DNA chip is networked, it is characterised in that:The cloud It holds each ID data packets on storage module to be equipped with consumer's reading times restricted program, the user first of consumer is set to from identity ID data packets are limited after secondary reading ID data packets to be only capable of being registered the certain number of user's reading.
- The anti-fake traceability system 9. Radix Notoginseng according to claim 1 based on DNA chip is networked, it is characterised in that:The cloud Hold on storage module each ID data packets to be equipped with timing routine, self-generating ID start after after a certain period of time, retrospective retrival terminal without Method retrieves.
- 10. a kind of Radix Notoginseng networking anti-fake traceability system anti-fake of claim 1-9 any one of them based on DNA chip is traced to the source Method, which is characterized in that including following:Personnel with detectability, detect in the following ways:(1) DNA sample for being tested Radix Notoginseng sample is extracted by CTAB methods, and DNA sample and DNA chip are subjected to hybridization reaction, obtained Take response data;(2) retrospect label is scanned by retrospective retrival terminal, response data is uploaded to high in the clouds and high in the clouds by DNA searching terminals Data in DNA databases are compared, and obtain true and false result;(3) detection site, time, result are transmitted to high in the clouds retrospect label Radix Notoginseng sample and correspond to ID data corresponding to batch Packet;The personnel for not having detectability, identify in the following ways:(1) retrospect label is scanned by retrospective retrival terminal, obtains Radix Notoginseng production, processing, storage, transaction, logistics, terminal and inspection The information of survey;(2) high in the clouds according to historical query information analyze and analysis result is sent to retrospective retrival terminal.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810431600.1A CN108456718A (en) | 2018-05-08 | 2018-05-08 | A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810431600.1A CN108456718A (en) | 2018-05-08 | 2018-05-08 | A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method |
Publications (1)
Publication Number | Publication Date |
---|---|
CN108456718A true CN108456718A (en) | 2018-08-28 |
Family
ID=63214952
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810431600.1A Withdrawn CN108456718A (en) | 2018-05-08 | 2018-05-08 | A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108456718A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020248271A1 (en) * | 2019-06-14 | 2020-12-17 | 胡永生 | Internet-of-things data traceability system |
-
2018
- 2018-05-08 CN CN201810431600.1A patent/CN108456718A/en not_active Withdrawn
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020248271A1 (en) * | 2019-06-14 | 2020-12-17 | 胡永生 | Internet-of-things data traceability system |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11206138B2 (en) | Biosignature-based tokenization of assets in a blockchain | |
JP2019030296A (en) | System and method of information management using biological signature | |
US20100045789A1 (en) | Apparatus, method and article to perform assays using assay strips | |
EP1850289A1 (en) | Application and system for rfid in workflow of blood center | |
CN109342407A (en) | A kind of quickly investigation drug abuse detection system | |
TW200911194A (en) | Specimen tracking and management verification | |
CN103958662A (en) | Selection of preferred sample handling and processing protocol for identification of disease biomarkers and sample quality assessment | |
CN108898393A (en) | Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
CN110208238A (en) | It is a kind of based on SVM models coupling image to the accurate positioning method of cancerous lung tissue | |
CN107292096A (en) | Clinical examination report auditing system and method based on bar code scan | |
CN100530213C (en) | Method and device for confirming safety level of biology identification systemic | |
CN108315388A (en) | A kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method | |
CN108614956A (en) | A kind of Internet of Things for the stem of noble dendrobium differentiates traceability system and differentiates source tracing method | |
CN106845156B (en) | Classification method, apparatus and system based on blood platelet difference expression gene label | |
CN108456718A (en) | A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method | |
CN108629604A (en) | Anti-fake traceability system based on American Ginseng DNA and anti-fake source tracing method | |
CN107003312A (en) | The method and apparatus that (RDT) is tested in real-time diagnosis for Ebola and animal infectious diease | |
CN108645797A (en) | Donkey-hide gelatin DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method | |
Vuk et al. | Error management in blood establishments: results of eight years of experience (2003–2010) at the Croatian Institute of Transfusion Medicine | |
WO2000013588A1 (en) | Verification of human medical data | |
Farooq et al. | Rapid identification of breast cancer subtypes using micro-FTIR and machine learning methods | |
CN108492122A (en) | A kind of Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
CN103698353A (en) | Bird's nest identification method | |
CN114005530A (en) | Intelligent reminding and monitoring method and system for medical repeated examination and inspection in area | |
CN108629388A (en) | A kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WW01 | Invention patent application withdrawn after publication |
Application publication date: 20180828 |
|
WW01 | Invention patent application withdrawn after publication |