CN108315388A - A kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method - Google Patents
A kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method Download PDFInfo
- Publication number
- CN108315388A CN108315388A CN201810432497.2A CN201810432497A CN108315388A CN 108315388 A CN108315388 A CN 108315388A CN 201810432497 A CN201810432497 A CN 201810432497A CN 108315388 A CN108315388 A CN 108315388A
- Authority
- CN
- China
- Prior art keywords
- dna
- radix codonopsis
- clouds
- data
- module
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- G—PHYSICS
- G06—COMPUTING; CALCULATING OR COUNTING
- G06Q—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES; SYSTEMS OR METHODS SPECIALLY ADAPTED FOR ADMINISTRATIVE, COMMERCIAL, FINANCIAL, MANAGERIAL OR SUPERVISORY PURPOSES, NOT OTHERWISE PROVIDED FOR
- G06Q30/00—Commerce
- G06Q30/018—Certifying business or products
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Business, Economics & Management (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Entrepreneurship & Innovation (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Molecular Biology (AREA)
- Accounting & Taxation (AREA)
- Development Economics (AREA)
- Economics (AREA)
- Finance (AREA)
- Marketing (AREA)
- Strategic Management (AREA)
- General Business, Economics & Management (AREA)
- General Physics & Mathematics (AREA)
- Theoretical Computer Science (AREA)
- Information Retrieval, Db Structures And Fs Structures Therefor (AREA)
Abstract
The invention belongs to Radix Codonopsis to identify anti-counterfeit field, and in particular to a kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method.The DNA chip and retrospect label used including high in the clouds, DNA chip, identification apparatus, retrospect label, DNA searching terminals, retrospective retrival terminal Radix Codonopsis DNA Internet of Things anti-counterfeiting systems, have being used for quickly detecting by DNA chip for biological detection experimental ability, and it is true and false by the discriminating of DNA big data analysis, it carries out anti-fake.Do not have being traced by tracing label for biological detection experimental ability, checks that the information of Radix Codonopsis production, processing, storage, transaction, logistics, terminal and detection, high in the clouds can analyse whether to exist abnormal and analysis result issued inquiry.By big data make retrospect tag queries to data change with time and space, even if copying identical retrospect label, abnormal request for information also can be by system discovery.It realizes the duplication for having efficiently controlled fake producer, forms preferably counterfeit protection measures.
Description
Technical field
The invention belongs to Radix Codonopsis to identify anti-counterfeit field, and in particular to a kind of Radix Codonopsis DNA Rapid identification Internet of Things is anti-fake to trace to the source
System and anti-fake source tracing method.
Background technology
Radix Codonopsis is Campanulaceae, is used as medicine with dry root, is one of conventional Chinese medicine, and matter is slightly hard or slightly toughness, skin zone
For yellowish white to light brown, woody part is faint yellow, has special aroma, taste is slightly sweet.Radix Codonopsis is containing polysaccharide, phenols, sterol, volatile oil, Huang
A kind of reed mentioned in ancient books element glycoside, saponin and Alkaloid etc., Radix Codonopsis tonifying middle-Jiao and Qi and taste relieving thirst and restlessness, control the deficiency syndrome of the lung, and beneficial lung qi is enriched blood
Agent, suitable for controlling consumptive disease internal injury, intestines cold in the stomach is sliding to rush down protracted dysentery, and polydipsia of panting, generate heat spontaneous perspiration, and metrorrhagia, tire produce, are chronic poor
Blood, chlorosis, leukaemia, adenopathy, all diseases such as rickets, with being significantly increased for market Radix Codonopsis demand, plantation amount is also corresponding acute
Increase.
Traditional is anti-fake mainly using physics modes such as anti-counterfeiting label, false proof card, anti-counterfeit packages, by the straight of assessor
Connect the subjective mode such as observation, touch, number inquiry.Therefore, as long as product is once dispatch from the factory, fake producer is gratifying to be intended to be subject to for ground
It copys, is not broken away from always by counterfeit destiny.
Invention content
The present invention is in view of the above-mentioned problems, providing a kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake tracing back
Source method.
The technical solution used in the present invention is as follows：A kind of Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system, including
High in the clouds, DNA chip, identification apparatus, retrospect label, DNA searching terminals, retrospective retrival terminal；
The high in the clouds includes storage module, analysis module, high in the clouds information receiving module, high in the clouds message output module, described
Storage module stores the information of Radix Codonopsis DNA databases and Radix Codonopsis production, processing, storage, transaction, logistics, terminal and detection,
The high in the clouds information receiving module receives the data of DNA searching terminals and retrospective retrival terminal by network and sends data to
Analysis module, the data of the analysis module analysis described information receiving module reception receive related data from storage module, are right
Than analysis DNA data, by DNA analysis result data and analysis Radix Codonopsis production, processing, storage, transaction, logistics, terminal and inspection
Data and analysis result are simultaneously transmitted to message output module by the information of survey, and the high in the clouds message output module transmits information to
DNA searching terminals, retrospective retrival terminal；
The DNA chip, including solid phase support object, gene probe；
Each retrospect label includes corresponding and unique id information, the id information, Radix Codonopsis production, processing, store,
Transaction, logistics, the information of terminal and detection form the storage module in corresponding ID data packets storage beyond the clouds；
DNA searching terminals, including DNA data uploading module, DNA data reception modules, the DNA data uploading module will
DNA chip detection data is transmitted to high in the clouds, and the DNA data reception modules receive high in the clouds DNA analysis as a result, DNA searching terminals
Can be mobile phone, computer；
Retrospective retrival terminal includes retrospect label information read module, retrospective retrival data uploading module, retrospective retrival number
According to receiving module, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data
Label information and DNA testing results are transmitted to high in the clouds, the retrospect inspection by uploading module, the retrospective retrival data uploading module
Rope data reception module receives the information of Radix Codonopsis production, processing, storage, transaction, logistics, terminal and detection.
The Radix Codonopsis DNA databases are established in the following manner：
(1) certified products Radix Codonopsis sample is subjected to batch extracting；
(2) the Radix Codonopsis DNA sample after extraction is subjected to hybridization reaction with DNA chip；
It (3) will be in hybridization reaction result input database；
(4) a variety of Radix Codonopsis samples without brand, different size, different sources, different batches are passed sequentially through into step
(1), (2), (3) are detected, and form Radix Codonopsis DNA databases.
In step (1), Radix Codonopsis sample is extracted by CTAB methods, and detailed process is as follows：4mlCTAB is added in centrifuge tube to carry
Liquid and 80ul mercaptoethanols are taken, is preheated in 65 ± 5 DEG C of water-baths, takes Radix Codonopsis sample, liquid nitrogen grinding is at powder, after being transferred to preheating
Centrifuge tube in, sealing keep the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, and taking-up centrifuge tube, fast cooling to room temperature adds
Enter 4ml phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol, mixing forms mixed emulsion；12000r/min is centrifuged
10min takes supernatant, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10- after mixing
20min, 12000r/min centrifuge 10min, and supernatant, precipitation is gone to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, and TE bufferings are added
The RNase of liquid and final concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Radix Codonopsis DNA sample.
The gene probe includes following probe：
Probe one：TCAGTGAGTTATGCTTAACGG；
Probe two：TTCCTACCTGATGAGGTTCAG；
Probe three：AATTATGTTGAAGCCC；
Probe four：GATATATAATC；
Probe five：GATACACATTATAAC；
Probe six：GAGCGTGATTCTCAAATGAT.
It can also include existing known various plants DNA probe.
The DNA chip is surface plasma resonant sensor chip, and the solid phase support object is silicon chip, the solid phase
Layer of metal film is adhered on supporter surface, and the gene probe is fixed on metallic film surface.Utilize surface plasma resonance
(surface plasmon resonance, SPR) biosensor technology quickly detects the DNA of Radix Codonopsis.Surface plasma is total
Shake (Surface Plasmon Resonance, SPR) be a kind of optical physics phenomenon.When a branch of P polarization light is in certain angle
It is incident on prism end face in range, surface plasma-wave will be generated at the interface of prism and metallic film (Au or Ag).Work as incidence
When the propagation constant of light wave and the propagation constant of surface plasma-wave match, free electron in metal film is caused to generate resonance,
That is surface plasma resonance.When analysis, first one layer of biomolecule is fixed in censorchip surface and identify film, then by sample to be tested
Chip surface is flowed through, if there is the molecule that can identify membrane interaction with the biomolecule of chip surface in sample, gold can be caused
Film surface variations in refractive index eventually leads to the variation of the angles SPR and obtains concentration, the parent of analyte by detecting SPR angle changes
With the information such as power, kinetic constant and specificity.Occur both when Radix Codonopsis DNA sample after extraction is injected into chip surface special
The opposite sex combines, and changes so as to cause chip surface optical parameter, and show as electronic signals, specific bond determinand
Amount it is different, the response intensity of signal is different.
The retrospect label is RFID RFID tags.Radio frequency identification, RFID (Radio Frequency
Identification) technology, also known as radio frequency identification are a kind of communication technologys, are commonly called as electronic tag.Radio can be passed through
Signal identifies specific objective and reads and writes related data, is connect without establishing mechanical or optics between identifying system and specific objective
It touches.Convenient for identification, make the information Rapid input of production, processing, storage, transaction, logistics, terminal and detection.Item can also be taken
Shape code, Quick Response Code isotype, but need to be scanned one by one, it is unfavorable for the typing of high-volume information.
The retrospect label is arranged in DNA chip.Directly testing result can be chased after by scanning after tester's detection
The label that traces back connects high in the clouds, detection data is transmitted to high in the clouds, and obtain high in the clouds analysis result, coherent detection data are saved in cloud
On end.
Agent, logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to cloud
The data of correspondence ID in the storage module of end are surrounded by reading permission, number of the consumer to the correspondence ID in the storage module of high in the clouds
It reads permission according to being surrounded by and forbids the user read permission in addition to the manager of high in the clouds.Reading every time in this way has corresponding identity
Information produces exception reporting if the consumer of terminal repeatedly inquires, and retrospect label may be occurred by informing that consumer is larger
The case where being replicated, if there is consumer retracts commodity, sales end can typing correlation sales information, reduce the possibility of high in the clouds erroneous judgement
Property.
After each ID data packets start equipped with timing routine, self-generating ID on the high in the clouds storage module after a certain period of time,
Retrospective retrival terminal can not retrieve.High in the clouds manager can be according to the characteristic of Radix Codonopsis product, and be set according to actual conditions DNA has
The effect phase avoids the retrospect label on expired product or expired product from shifting and uses.
A kind of anti-fake source tracing method of above-mentioned Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems, including it is following：
Personnel with detectability, detect in the following ways：
(1) DNA sample for being tested Radix Codonopsis sample is extracted by CTAB methods, and DNA sample with DNA chip hybridize instead
It answers, obtains response data；
(2) by retrospective retrival terminal scan retrospect label, by response data by DNA searching terminals be uploaded to high in the clouds with
Data in the DNA databases of high in the clouds are compared, and obtain true and false result；
(3) detection site, time, result are transmitted to high in the clouds retrospect label Radix Codonopsis sample and correspond to ID numbers corresponding to batch
According to packet；
The personnel for not having detectability, identify in the following ways：
(1) retrospect label is scanned by retrospective retrival terminal, obtains Radix Codonopsis production, processing, storage, transaction, logistics, terminal
With the information of detection；
(2) high in the clouds according to historical query information analyze and analysis result is sent to retrospective retrival terminal.
Beneficial effects of the present invention are as follows：The DNA chip and retrospect label that Radix Codonopsis DNA Internet of Things anti-counterfeiting systems use, tool
The Chinese medicine trading company of standby biological detection experimental ability, large-scale transaction place, hospital etc. can quickly be examined by DNA chip
It surveys, and true and false by the discriminating of DNA big data analysis, carries out anti-fake.Do not have pharmacy, the consumer etc. of biological detection experimental ability
It can be traced by tracing label, check the information of Radix Codonopsis production, processing, storage, transaction, logistics, terminal and detection, cloud
End can analyse whether to exist abnormal and analysis result is issued inquiry.By big data make the data that retrospect tag queries arrive with
It time and space and changes, even if copying identical retrospect label, abnormal request for information also can be by system discovery.It realizes
The duplication of fake producer has been efficiently controlled, preferably counterfeit protection measures are formed.
Description of the drawings
Fig. 1 is the schematic diagram of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems.
Fig. 2 is Radix Codonopsis DNA rapid identification method flow charts.
Specific implementation mode
Below in conjunction with the accompanying drawings and specific embodiment, the present invention can be better described.
Embodiment one：
DNA chip is prepared, detailed process is as follows：
Can be Au or Ag 1. adhering to the metal film of one layer of 150nm by metal coating technique in silicon chip surface；
2. in probe genetic fragment sulfhydrylation, then by the probe points of different sulfhydrylations to different zones, in 4 DEG C of conditions
It is lower to be kept for 12 hours, wherein the gene probe includes following probe：
Probe one：TCAGTGAGTTATGCTTAACGG；
Probe two：TTCCTACCTGATGAGGTTCAG；
Probe three：AATTATGTTGAAGCCC；
Probe four：GATATATAATC；
Probe five：GATACACATTATAAC；
Probe six：GAGCGTGATTCTCAAATGAT；
3. then washing the unbonded probe of metallic film surface with deionized water, then dried up with nitrogen.
There is good stability by DNA chip prepared by the above method, can for a long time be flowed on the market with product
Logical, the DNA probe on surface is designed for the DNA sequence dna of Radix Codonopsis, some existing DNA of plants probes are being added, are passing through spy
Needle tests the DNA information of Radix Codonopsis sample, has specificity, good test effect.
Embodiment two：
Radix Codonopsis DNA databases are built, detailed process is as follows：
1. Radix Codonopsis sample is extracted by CTAB methods, detailed process is as follows：In centrifuge tube be added 4mlCTAB extracting solutions and
80ul mercaptoethanols preheat in 65 ± 5 DEG C of water-baths, take Radix Codonopsis sample, liquid nitrogen grinding is at powder, the centrifugation being transferred to after preheating
Guan Zhong, sealing, 30 ± 10 minutes are kept the temperature in 65 ± 5 DEG C of water-baths, take out centrifuge tube, and 4ml phenol is added in fast cooling to room temperature
: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol, mixing form mixed emulsion；12000r/min centrifuges 10min, takes
Clear liquid, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10-20min after mixing,
12000r/min centrifuges 10min, goes supernatant, precipitation to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, TE buffer solutions and end is added
The RNase of a concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Radix Codonopsis DNA sample.
2. the Radix Codonopsis DNA sample after extraction is carried out hybridization reaction with DNA chip：Radix Codonopsis DNA sample is injected into DNA chip
Surface, hybridization reaction 5 hours at 45 DEG C.
3. the spr signal of each probe area is obtained, in input database；
4. a variety of Radix Codonopsis samples without brand, different size, different sources, different batches are passed sequentially through step 1 to 3
It is detected, forms Radix Codonopsis DNA databases.
The DNA information in Radix Codonopsis sample is extracted by step 1, relatively other methods, extracting concentration is high, relatively complete
It is whole, hybridization reaction is carried out with DNA chip, reaction is sensitiveer, and conjugation is relatively high, observes the data in DNA databases, finds
Without brand, different size, different sources, different batches Radix Codonopsis sample data it is roughly the same, have part have differences.
Embodiment three：
Check that the validity of DNA chip and Radix Codonopsis DNA databases, testing staff do not know the true and false of tested Radix Codonopsis sample：
1. tested Radix Codonopsis sample is extracted by CTAB methods, detailed process is as follows：4ml CTAB are added in centrifuge tube to carry
Liquid and 80ul mercaptoethanols are taken, is preheated in 65 ± 5 DEG C of water-baths, takes Radix Codonopsis sample, liquid nitrogen grinding is at powder, after being transferred to preheating
Centrifuge tube in, sealing keep the temperature 30 ± 10 minutes in 65 ± 5 DEG C of water-baths, and taking-up centrifuge tube, fast cooling to room temperature adds
Enter 4ml phenol: chloroform: 25: 24: 1 mixed solution of isoamyl alcohol, mixing forms mixed emulsion；12000r/min is centrifuged
10min takes supernatant, is added the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10- after mixing
20min, 12000r/min centrifuge 10min, and supernatant, precipitation is gone to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, and TE bufferings are added
The RNase of liquid and final concentration of 50 μ g/ml keeps the temperature 1h in 37 DEG C, obtains Radix Codonopsis DNA sample.2. by the Radix Codonopsis DNA samples after extraction
Product carry out hybridization reaction with DNA chip：Radix Codonopsis DNA sample is injected into DNA chip surface, hybridization reaction 5 hours at 45 DEG C.
3. obtaining the spr signal of each probe area, the spr signal data of detection and Radix Codonopsis DNA databases are compared,
The sample that similarity is more than 90% is true, and the sample being less than is false.
4. a variety of Radix Codonopsis samples are passed sequentially through step 1 to be detected to 3, the identification true and false is obtained as a result, detection accuracy
It is 100%.Illustrate that DNA chip and Radix Codonopsis DNA databases can be effectively used for the discriminating of the Radix Codonopsis true and false.
Through this embodiment, it may be said that bright DNA chip and Radix Codonopsis DNA databases can be effectively used for the discriminating of the Radix Codonopsis true and false.It is pseudo-
The DNA chip detection data of product Radix Codonopsis sample and Radix Codonopsis DNA database similarities are below 85%, and certified products Radix Codonopsis sample
DNA chip detection data is above 95% with Radix Codonopsis DNA database similarities, can obviously distinguish, pass through DNA chip in this way
Testing result error is small.It high in the clouds can be between 85%-95% to the setting of certified products similarity limit.
Example IV：
A kind of Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system, including high in the clouds, DNA chip, identification apparatus, retrospect
Label, DNA searching terminals, retrospective retrival terminal；
The high in the clouds includes storage module, analysis module, high in the clouds information receiving module, high in the clouds message output module, described
Storage module stores the information of Radix Codonopsis DNA databases and Radix Codonopsis production, processing, storage, transaction, logistics, terminal and detection,
The high in the clouds information receiving module receives the data of DNA searching terminals and retrospective retrival terminal by network and sends data to
Analysis module, the data of the analysis module analysis described information receiving module reception receive related data from storage module, are right
Than analysis DNA data, by DNA analysis result data and analysis Radix Codonopsis production, processing, storage, transaction, logistics, terminal and inspection
Data and analysis result are simultaneously transmitted to message output module by the information of survey, and the high in the clouds message output module transmits information to
DNA searching terminals, retrospective retrival terminal；
The DNA chip, including solid phase support object, gene probe；
Each retrospect label includes corresponding and unique id information, the id information, Radix Codonopsis production, processing, store,
Transaction, logistics, the information of terminal and detection form the storage module in corresponding ID data packets storage beyond the clouds；
DNA searching terminals, including DNA data uploading module, DNA data reception modules, the DNA data uploading module will
DNA chip detection data is transmitted to high in the clouds, and the DNA data reception modules receive high in the clouds DNA analysis result；
Retrospective retrival terminal includes retrospect label information read module, retrospective retrival data uploading module, retrospective retrival number
According to receiving module, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data
Label information and DNA testing results are transmitted to high in the clouds, the retrospect inspection by uploading module, the retrospective retrival data uploading module
Rope data reception module receives the information of Radix Codonopsis production, processing, storage, transaction, logistics, terminal and detection.
The DNA chip and retrospect label that Radix Codonopsis DNA Internet of Things anti-counterfeiting systems use, have in biological detection experimental ability
Medicine trading company, large-scale transaction place, hospital etc. can be used for quickly detecting by DNA chip, and pass through DNA big data analysis
Differentiate it is true and false, carry out it is anti-fake.Not having pharmacy, consumer of biological detection experimental ability etc. can be chased after by tracing label
It traces back, checks that the information of Radix Codonopsis production, processing, storage, transaction, logistics, terminal and detection, high in the clouds can analyse whether there is exception simultaneously
Analysis result is issued into inquiry.By big data make retrospect tag queries to data change with time and space, i.e.,
Just identical retrospect label is copied, abnormal request for information also can be by system discovery.Realization has efficiently controlled fake producer's
It replicates, forms preferably counterfeit protection measures.
The retrospect label is RFID RFID tags.The retrospect label is arranged in DNA chip.DNA retrievals are eventually
End and retrospective retrival terminal can be a terminal, i.e., the dress handled simultaneous with RFID radio frequency recognition functions and networking data
It sets, such as mobile phone, terminal with RFID identification function.
Agent, logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to cloud
The data of correspondence ID in the storage module of end are surrounded by reading permission, number of the consumer to the correspondence ID in the storage module of high in the clouds
It reads permission according to being surrounded by and forbids the user read permission in addition to the manager of high in the clouds.Reading every time in this way has corresponding identity
Information produces exception reporting if the consumer of terminal repeatedly inquires, and retrospect label may be occurred by informing that consumer is larger
The case where being replicated, if there is consumer retracts commodity, sales end can typing correlation sales information, reduce the possibility of high in the clouds erroneous judgement
Property.
After each ID data packets start equipped with timing routine, self-generating ID on the high in the clouds storage module after a certain period of time,
Retrospective retrival terminal can not retrieve.Medicinal material manufacturer can be set according to actual conditions retrospect label according to the characteristic of itself product
The term of validity of data retrieval, retrieval number, timeliness one arrive, then trace label automatic damage, even if personator has recycled retrospect mark
Label, and scheme in vain.
Medicinal material manufacturer can be nullified specified retrospect tag ID when specific according to actual conditions.Make retrospect label
The validity of ID among the control of medicinal material manufacturer, allows fake producer to have no exploits always.
High in the clouds manager needs the safety of stringent control high in the clouds data, can set management secret key, it is ensured that high in the clouds data are tight
Lattice rest in production firm.
Example the above is only the implementation of the present invention is not used for limiting the scope of the invention；The protection of the present invention
Range is limited by the claim in claims, and every according to equivalence changes made by invention and modification, all in this hair
Within the protection domain of bright patent.
Claims (10)
1. a kind of Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system, it is characterised in that：Including high in the clouds, DNA chip, identification
Device, retrospect label, DNA searching terminals, retrospective retrival terminal；
The high in the clouds includes storage module, analysis module, high in the clouds information receiving module, high in the clouds message output module, the storage
Module stores the information of Radix Codonopsis DNA databases and Radix Codonopsis production, processing, storage, transaction, logistics, terminal and detection, described
High in the clouds information receiving module receives the data of DNA searching terminals and retrospective retrival terminal by network and sends data to analysis
Module, the data of the analysis module analysis described information receiving module reception receive related data from storage module, to score
Analyse DNA data, by DNA analysis result data and the production of analysis Radix Codonopsis, processing, storage, transaction, logistics, terminal and detection
Data and analysis result are simultaneously transmitted to message output module by information, and the high in the clouds message output module transmits information to DNA
Searching terminal, retrospective retrival terminal；
The DNA chip, including solid phase support object, gene probe；
Each retrospect label includes corresponding and unique id information, and the id information, processing, storage, is handed at Radix Codonopsis production
Easily, logistics, terminal and the information of detection form the storage module in corresponding ID data packets storage beyond the clouds；
DNA searching terminals, including DNA data uploading module, DNA data reception modules, the DNA data uploading module is by DNA
Chip detection data is transmitted to high in the clouds, and the DNA data reception modules receive high in the clouds DNA analysis result；
Retrospective retrival terminal includes tracing label information read module, retrospective retrival data uploading module, retrospective retrival data to connect
Module is received, the retrospect label information read module reads label information and label information is transmitted to retrospective retrival data and uploads
Label information and DNA testing results are transmitted to high in the clouds, the retrospective retrival number by module, the retrospective retrival data uploading module
The information of Radix Codonopsis production, processing, storage, transaction, logistics, terminal and detection is received according to receiving module.
2. Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：The party
Ginseng DNA databases are established in the following manner：
(1) certified products Radix Codonopsis sample is subjected to batch extracting；
(2) the Radix Codonopsis DNA sample after extraction is subjected to hybridization reaction with DNA chip；
It (3) will be in hybridization reaction result input database；
(4) by it is a variety of without brand, different size, different sources, different batches Radix Codonopsis sample pass sequentially through step (1),
(2), (3) are detected, and form Radix Codonopsis DNA databases.
3. Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system according to claim 2, it is characterised in that：Step (1)
In, Radix Codonopsis sample is extracted by CTAB methods, and detailed process is as follows：4ml CTAB extracting solutions and 80ul sulfydryls are added in centrifuge tube
Ethyl alcohol preheats in 65 ± 5 DEG C of water-baths, takes Radix Codonopsis sample, and liquid nitrogen grinding is transferred in the centrifuge tube after preheating, envelope at powder
Mouthful, 30 ± 10 minutes are kept the temperature in 65 ± 5 DEG C of water-baths, takes out centrifuge tube, 4ml phenol: three chloromethanes is added in fast cooling to room temperature
Alkane: 25: 24: 1 mixed solution of isoamyl alcohol, mixing form mixed emulsion；12000r/min centrifuges 10min, takes supernatant, adds
Enter the chloroform of 4ml: the mixed solution of isoamyl alcohol 24: 1, in being placed at room temperature for 10-20min after mixing, 12000r/min from
Heart 10min goes supernatant, precipitation to be washed successively with absolute ethyl alcohol, 70% ethyl alcohol, TE buffer solutions and final concentration of 50 μ g/ is added
The RNase of ml keeps the temperature 1h in 37 DEG C, obtains Radix Codonopsis DNA sample.
4. Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system according to claim 1, which is characterized in that the base
Because probe includes following probe：
Probe one：TCAGTGAGTTATGCTTAACGG；
Probe two：TTCCTACCTGATGAGGTTCAG；
Probe three：AATTATGTTGAAGCCC；
Probe four：GATATATAATC；
Probe five：GATACACATTATAAC；
Probe six：GAGCGTGATTCTCAAATGAT.
5. Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：The DNA
Chip is surface plasma resonant sensor chip, and the solid phase support object is silicon chip, the attachment of solid phase support object surface
Layer of metal film, the gene probe are fixed on metallic film surface.
6. Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：It is described to chase after
The label that traces back is RFID RFID tags.
7. Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：It is described to chase after
The label that traces back is arranged in DNA chip.
8. Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：Agent,
Logistics, consumer need that proof of identity is registered and carried out on beyond the clouds, and the agent, logistics are to pair in the storage module of high in the clouds
Answer the data of ID to be surrounded by reading permission, the consumer data of the correspondence ID in the storage module of high in the clouds are surrounded by read permission with
And forbid the user read permission in addition to the manager of high in the clouds.
9. Radix Codonopsis DNA Rapid identifications Internet of Things anti-fake traceability system according to claim 1, it is characterised in that：The cloud
Hold on storage module each ID data packets to be equipped with timing routine, self-generating ID start after after a certain period of time, retrospective retrival terminal without
Method retrieves.
10. a kind of anti-fake tracing to the source of claim 1-9 any one of them Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems
Method, which is characterized in that including following：
Personnel with detectability, detect in the following ways：
(1) DNA sample for being tested Radix Codonopsis sample is extracted by CTAB methods, and DNA sample and DNA chip are subjected to hybridization reaction, obtained
Take response data；
(2) retrospect label is scanned by retrospective retrival terminal, response data is uploaded to high in the clouds and high in the clouds by DNA searching terminals
Data in DNA databases are compared, and obtain true and false result；
(3) detection site, time, result are transmitted to high in the clouds retrospect label Radix Codonopsis sample and correspond to ID data corresponding to batch
Packet；
The personnel for not having detectability, identify in the following ways：
(1) retrospect label is scanned by retrospective retrival terminal, obtains Radix Codonopsis production, processing, storage, transaction, logistics, terminal and inspection
The information of survey；
(2) high in the clouds according to historical query information analyze and analysis result is sent to retrospective retrival terminal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810432497.2A CN108315388A (en) | 2018-05-08 | 2018-05-08 | A kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810432497.2A CN108315388A (en) | 2018-05-08 | 2018-05-08 | A kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108315388A true CN108315388A (en) | 2018-07-24 |
Family
ID=62895622
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810432497.2A Withdrawn CN108315388A (en) | 2018-05-08 | 2018-05-08 | A kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108315388A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109214831A (en) * | 2018-08-09 | 2019-01-15 | 云智前沿科技发展（深圳）有限公司 | A kind of Hash fingerprint and its construction method and application based on location information and DNA information |
| CN116071091A (en) * | 2023-03-16 | 2023-05-05 | 山东丰茂源认证服务有限公司 | Pharmacy raw material traceability system based on Internet of things |
-
2018
- 2018-05-08 CN CN201810432497.2A patent/CN108315388A/en not_active Withdrawn
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109214831A (en) * | 2018-08-09 | 2019-01-15 | 云智前沿科技发展（深圳）有限公司 | A kind of Hash fingerprint and its construction method and application based on location information and DNA information |
| CN116071091A (en) * | 2023-03-16 | 2023-05-05 | 山东丰茂源认证服务有限公司 | Pharmacy raw material traceability system based on Internet of things |
| CN116071091B (en) * | 2023-03-16 | 2023-06-20 | 山东丰茂源认证服务有限公司 | Pharmacy raw material traceability system based on Internet of things |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Peveler et al. | A rapid and robust diagnostic for liver fibrosis using a multichannel polymer sensor array | |
| Qian et al. | New method of lung cancer detection by saliva test using surface‐enhanced Raman spectroscopy | |
| US20190187048A1 (en) | Spectroscopic systems and methods for the identification and quantification of pathogens | |
| CN110184389A (en) | Application of the PCR-CRISPR system of crRNA targeting in detection HBV DNA | |
| CN108898393A (en) | Chinese medicine DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| CN108315388A (en) | A kind of Radix Codonopsis DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method | |
| Hruschka et al. | Comparing hemoglobin distributions between population-based surveys matched by country and time | |
| Anne et al. | Feasibility and acceptability of an iris biometric system for unique patient identification in routine HIV services in Kenya | |
| CN109554474A (en) | A kind of method and kit of BCR-ABL fusion quantitative detection | |
| CN108629604A (en) | Anti-fake traceability system based on American Ginseng DNA and anti-fake source tracing method | |
| CN108614956A (en) | A kind of Internet of Things for the stem of noble dendrobium differentiates traceability system and differentiates source tracing method | |
| CN103698353B (en) | A kind of Nidus collocaliae authentication method | |
| Teng et al. | Pathological identification of brain tumors based on the characteristics of molecular fragments generated by laser ablation combined with a spiking neural network | |
| CN108645797A (en) | Donkey-hide gelatin DNA Rapid identification Internet of Things anti-fake traceability systems and anti-fake source tracing method | |
| Farooq et al. | Rapid identification of breast cancer subtypes using micro-FTIR and machine learning methods | |
| CN108492122A (en) | A kind of Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| CN108456718A (en) | A kind of Radix Notoginseng networking anti-fake traceability system based on DNA chip and anti-fake source tracing method | |
| CN108629388A (en) | A kind of Rhizoma Gastrodiae anti-fake traceability system and method based on surface plasma resonance technology | |
| Zhang et al. | The diagnostic value of exosomal circular RNAs in cancer patients: A systematic review and meta‐analysis | |
| CN108898394A (en) | A kind of safflower DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| CN108866158A (en) | A kind of ganoderma lucidum DNA Rapid identification Internet of Things anti-fake traceability system and anti-fake source tracing method | |
| CN108681906A (en) | A kind of radix pseudostellariae Internet of Things anti-fake traceability system and application process | |
| Liu et al. | Comparison of two rhodamine-based polystyrene solid-phase fluorescent sensors for mercury (II) determination | |
| CN114817752B (en) | Screening system and screening method for medical institution | |
| Yakhno et al. | Drop drying on the sensor: One more way for comparative analysis of liquid media |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20180724 |
|
| WW01 | Invention patent application withdrawn after publication |