CN108812297A - A kind of breeding method for shortening cabbage type rape breeding time and enhancing its lodging resistance - Google Patents
A kind of breeding method for shortening cabbage type rape breeding time and enhancing its lodging resistance Download PDFInfo
- Publication number
- CN108812297A CN108812297A CN201810726206.0A CN201810726206A CN108812297A CN 108812297 A CN108812297 A CN 108812297A CN 201810726206 A CN201810726206 A CN 201810726206A CN 108812297 A CN108812297 A CN 108812297A
- Authority
- CN
- China
- Prior art keywords
- inflorescence
- definite
- breeding
- single plant
- generation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/06—Processes for producing mutations, e.g. treatment with chemicals or with radiation
- A01H1/08—Methods for producing changes in chromosome number
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Molecular Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of shortening cabbage type rape breeding time and enhance the breeding method of its lodging resistance, breeding time and enhancing characteristic resistant to lodging can be effectively shortened using definite inflorescence, avoid the quantitative character of transformation precocity and equal complexity resistant to lodging；And by molecular marker assisted selection objective trait gene, the loss of the objective trait gene in backcross process is avoided, efficiency of selection is improved, and shortened breeding cycle and reduce workload.The definite inflorescence strain that can obtain obtaining genetic background identical as corresponding indefinite inflorescence by breeding of the invention can also have the characteristics that definite inflorescence on the basis of reservation indefinite inflorescence excellent character.
Description
Technical field
The invention belongs to rapeseed breeding technical field, it is related to a kind of shortening cabbage type rape breeding time and to enhance its resistant to lodging
The breeding method of property.
Background technique
Currently, in China High aititude rape producing region and southern double cropping of rice triple-cropping system area, breeding is precocious, resistant to lodging excellent
Rape variety, the still main target for rapeseed breeding at this stage.It is especially extra large in the Qinghai-Tibet rape producing region that frost-free period is shorter
Lift in 2950 meters or more of region, existing early maturing cabbage type rape variety can't normal mature, in production still in plantation
The turnip type rape kind that the sixties in century cultivates, yield, quality and lodging resistance are poor.In southern double cropping of rice triple-cropping system
The cultivation mode in area, " oily rice crop rotation " has very high requirement to rape breeding time.Precocity can be to avoid rape late growth stage
High temperature damage, conducive to succession crop ahead of time sow, ensure that succession crop stable and high yields (Wang Bi Khanh Hoa kingdom Chinese scholartree,
2009).In addition, the lodging resistance of rape becomes more and more important with the quickening of rape production mechanization process.Rape lodging can draw
Playing rape dry weight, yield, oil yield and harvest index reduces.It is reported that photosynthesis can be made to be affected after rape lodging,
Pest and disease damage aggravation, effective silique is reduced, so as to cause the general underproduction 15%~30%, up to 60% or more when serious, or even absolutely
It receives, oil content also lower than normal vegetable seed 10%~30%.And lodging keeps mechanized harvest difficult, larger (Liu Tang of production loss
It is emerging etc., 2007；Official city, 2014).
Breeding precocity and the method for napus lines resistant to lodging are as follows at present：There to be the precocious or stronger strain of lodging resistance
As donor parents, by composite-crossing or backcrossing, through mostly for phenotypic evaluation after transformation into the excellent strain of other characters, with
Reach the precocity and lodging resistance for improving excellent strain.
It is had the following disadvantages during traditional transformation precocity and character resistant to lodging：1, phenotypic evaluation larger workload：
Biggish segregating population is needed during traditional transformation, precocious and lodging resistance comprehensive inspection is carried out to single plant in big segregating population
It surveys more difficult；2, efficiency of selection is lower：Since above-mentioned two character is controlled by multiple genes, the major gene resistance being directed to
And minor gene is more, is effectively polymerize in traditional transformation to polygenes, difficulty is larger, and efficiency of selection is lower；3, turn simultaneously
It is big to educate precocious and character difficulty resistant to lodging；It is 4, precocious that there are contradictions with high yield.
Summary of the invention
Present invention solves the problem in that providing a kind of shortening cabbage type rape breeding time and enhancing educating for its lodging resistance
Kind method, shortens cabbage type rape breeding time using cabbage type rape definite inflorescence character and enhancing cabbage type rape is resistant to lodging
Property.
The present invention is to be achieved through the following technical solutions：
A kind of breeding method for shortening cabbage type rape breeding time and enhancing its lodging resistance, including following operation：
1) using the cabbage type rape indefinite inflorescence strain with Breeding objective as recurrent parent；
It chooses and differs the cabbage type rape definite inflorescence strain for being no more than 15 days with the recurrent parent florescence as donor parents；
2) hybridized using donor parents as male parent with recurrent parent, harvest hybridization F1Generation；
3) F will be hybridized1In generation, is returned as female parent with recurrent parent, harvest backcrossing BC1F1Generation；To BC1F1It is used for single plant
Definite inflorescence trait molecular marker carries out target gene tracking selection；
The molecular labeling includes the SSR molecule for being located at the two sides definite inflorescence gene Bnsdt1 and/or Bnsdt2
Label；
It chooses the heterozygosis single plant banding pattern for containing all SSR molecular markers and the single plant for showing as indefinite inflorescence is waited as backcrossing
Menu strain；
4) it is returned using being returned candidate single plant as female parent with recurrent parent, harvest backcrossing BC2F1Generation；And continue pair
BC2F1The single plant in generation carries out SSR molecular marker, carries out tracking selection to target gene, obtains BC2F1In generation, is returned candidate single plant；
5) it is directed to BC2F1In generation, is returned candidate single plant, then by the backcrossing of candidate single plant and recurrent parent twice, and carries out SSR
Molecular labeling carries out tracking selection to target gene, obtains the BC containing definite inflorescence gene4F1In generation, is returned candidate single plant；
6) by BC4F1In generation, carries out bagging selfing, obtains BC4F2Generation；In BC4F2Generation in select have definite inflorescence single plant for
The Candidate Strain of new varieties, definite inflorescence formalness are to form the variation silique of a likeness in form column cap, week on inflorescence top
It encloses and understands the different silique that changes.
The recurrent parent is double low high-quality Early maturity cabbage type rape strains；
The donor parents are pair low cabbage type rape strain, and have and shorten breeding time, reduce plant height, increase effectively
Branch amount, characteristic resistant to lodging.
The target gene tracking is selected as：
In per generation backcross progeny group's seedling stage, each single plant is numbered, its blade is then taken to carry out DNA extraction, to extract
DNA be template, with these single plants of the primer pair of SSR molecular marker carry out PCR amplification, and to PCR amplification carry out electrophoresis detection,
Heterozygosis single plant banding pattern in electrophoresis electrical measurement result containing all SSR molecular markers is the hybrid strain containing definite inflorescence gene.
The molecular labeling is selected as：
When using genotype to be BnSdt1BnSdt1Bnsdt2Bnsdt2 indefinite inflorescence strain as recurrent parent, use
The SSR molecular marker of the two sides Bnsdt1；
When using genotype to be BnSdt1BnSdt1BnSdt2BnSdt2 indefinite inflorescence strain as recurrent parent, use
The SSR molecular marker of the two sides Bnsdt1 and Bnsdt2；
When using genotype to be Bnsdt1Bnsdt1BnSdt2BnSdt2 indefinite inflorescence strain as recurrent parent, use
The SSR molecular marker of the two sides Bnsdt2.
The SSR molecular marker includes：SSR24, SSR40, SSR5-17 and SSR5-21, wherein SSR24 and SSR40 exist
The side of definite inflorescence gene Bnsdt1, SSR5-17 and SSR5-21 are in the other side of definite inflorescence gene Bnsdt1.
The primer of the SSR molecular marker is：
SSR24：
Forward：CTTCTTCATCTTCAGCTGTTTG；
Reverse：CTAGTGTTCTTTGCGAGTGTTA；
SSR40：
Forward：TTCCCTCCAAATCATGAAAGAG；
Reverse：GGAGTGGGTTTAAGATCTGAT；
SSR5-17：
Forward：ATGAGGTATGTAGGTCCAGT；
Reverse：CCCGTCAACTAATCTCCTTC；
SSR5-21：
Forward：GTTTTCTGGTCCTAGTAGCA；
Reverse：GCTATGGTTTGTTTGTGGTT.
The amplification system of the SSR molecular marker is：
2 μ L, 10 × Buffer (Mg of DNA profiling2+) 1 μ L, dNTPs (2.5mM each) 0.8 μ L, Taq E (5u/ μ L) 0.2 μ
0.5 5 μ L of μ L, ddH2O of L, Primer-F/Primer-R, total volume are 10 μ L；
The amplification program of SSR molecular marker is：94 DEG C of denaturation 3min；
94 DEG C of denaturation 30s, 59 DEG C of annealing 45s, 72 DEG C of extension 45s, each 0.5 DEG C of the reduction of cycle annealing temperature, 10 are followed
Ring；94 DEG C of denaturation 30s, 54 DEG C of annealing 45s, 72 DEG C of extension 45s, 20 recycle；The every cycle annealing temperature of preceding 10 circulations reduces
0.5 DEG C, after dropping to 54 DEG C, then carry out subsequent 20 circulations；
72 DEG C of extension 5min；4 DEG C of preservations.
The heterozygosis single plant banding pattern is the banding pattern not only with homozygous indefinite inflorescence but also the banding pattern with definite inflorescence.
The inflorescence gene that per generation is returned candidate single plant is following one of several：
BnSdt1Bnsdt1Bnsdt2Bnsdt2；
Bnsdt1Bnsdt1BnSdt2Bnsdt2；
BnSdt1Bnsdt1BnSdt2Bnsdt2。
Compared with prior art, the invention has the following beneficial technical effects：
The breeding method provided by the invention for shortening cabbage type rape breeding time and enhancing its lodging resistance, utilizes Wild cabbage type
On the one hand the cabbage type rape of rape definite inflorescence character and molecular marking supplementary breeding is by backcross transformation that Wild cabbage type is oily
Dish definite inflorescence channel genes have in the cabbage type rape indefinite inflorescence strain of merit, are run through definite inflorescence gene
Have the function of one because of multiple-effect, achievees the effect that while shortening breeding time and enhancing lodging resistance, avoid transformation precocity and anti-fall
The complicated quantitative character such as volt；It on the other hand is to pass through two with definite inflorescence gene close linkage during backcross transformation
Side codominant marker carries out target gene tracking selection to backcross progeny segregating population single plant, avoids the loss of target gene, mentions
High selection efficiency, and shorten breeding cycle and reduce workload.By breeding of the invention can obtain obtaining with it is corresponding
The definite inflorescence strain of the identical genetic background of indefinite inflorescence can also have on the basis of reservation indefinite inflorescence excellent character
The characteristics of definite inflorescence：Definite inflorescence character, which has, to be shortened breeding time (about 3 days), reduces plant height (about 10cm), increases effective point
Many advantages, such as branch number (about 2), (stem is substantially at upright state) resistant to lodging, which does not make significant difference yet and has
The contradiction of effect solved between precocious and high yield.
The product of the breeding method institute breeding provided by the invention shortened cabbage type rape breeding time and enhance its lodging resistance
Kind, variety comparative test (RANDOMIZED BLOCK DESIGN) is carried out with corresponding indefinite inflorescence strain, the yield of the candidate definite inflorescence strain of investigation,
Breeding time, lodging.Product ratio as a result, it has been found that：NIL-3508 after breeding is than 3508 before breeding in yield high 3.6%, fertility
Phase shorten 5 days, lodging index it is small by 0.67；NIL-3511 after breeding is than 3511 before breeding in yield high 5.1%, fertility
Phase shorten 3 days, lodging index it is small by 0.82；NIL-3521 after breeding is than 3521 before breeding in yield high 1.4%, fertility
Phase shorten 6 days, lodging index it is small by 0.5.
Detailed description of the invention
Fig. 1 is flow chart of the invention.
Fig. 2 is codominant marker SSR40 testing result in backcross progeny group single plant.
Fig. 3 is the new varieties inflorescence phenotype figure of screening；Wherein A represents the definite inflorescence of screening, and B represents nothing as a comparison
Limit inflorescence.
Specific embodiment
Below with reference to specific embodiment, the present invention is described in further detail, it is described be explanation of the invention and
It is not to limit.
According to open ended sequential of the plant bud on inflorescence, inflorescence can be divided into indefinite inflorescence and definite inflorescence.Infinitely
Inflorescence be below the rachis bloom, then gradually upwards, center constantly generates bud with inflorescence elongate axis.Limited flower
Sequence refers to first blooms on rachis top, and then other flowers open (as shown in Figure 1) successively.
Brassica napus inflorescence is generally indefinite inflorescence, due to indefinite inflorescence to sky between canopy be easy to cause plant and inside plant
Between and light resource competition, as a result lead to that infertility, hollow kernels occurs in top or mature consistency is poor, plant height is excessively high and easy
The disadvantages of lodging.Compared with indefinite inflorescence, definite inflorescence can effectively construct reasonable plant canopy structure.
In addition, definite inflorescence character can break inflorescence apical dominance, accelerate each inflorescence growth rate of development, when increasing unit
Interior quantity of blooming.And definite inflorescence character is degenerated in advance due to growing point, and inflorescence length is caused to shorten, and plant height reduces, respectively
Inflorescence is substantially at same level height, so that entire plant is kept to be in equilibrium state without tilting to a direction, so
Definite inflorescence character has stronger lodging resistance, therefore definite inflorescence character pair rapeseed breeding is of great significance.In recent years,
With the discovery of cabbage type rape definite inflorescence character mutant, correlative study is also carried out.Existing result of study shows：
Rape definite inflorescence character is the qualitative character controlled by two pairs of allogenes (respectively Bnsdt1, Bnsdt2).
The breeding method provided by the invention for shortening cabbage type rape breeding time and enhancing its lodging resistance, is based on following two
A aspect：
1, shorten cabbage type rape breeding time simultaneously using definite inflorescence character and enhance its lodging resistance
Cabbage type rape definite inflorescence character is imported the Wild cabbage type oil with merit by backcross transformation by the present invention
In dish indefinite inflorescence strain, being run through definite inflorescence gene has the function of one because of multiple-effect, reach and meanwhile shorten breeding time and
Enhance the effect of lodging resistance.
2, the efficiency of selection in Breeding Process is improved
In the present invention during backcross transformation, pass through the two sides codominant marker couple with definite inflorescence gene close linkage
Backcross progeny segregating population single plant carries out target gene tracking selection, avoids the loss of target gene, improves efficiency of selection.
Bnsdt1 and Bnsdt2 gene in rape be it is simultaneous, have several genotype in rape such as
Bnsdt1Bnsdt1Bnsdt2Bnsdt2 (definite inflorescence, small letter behalf recessive gene/capitalization S represent dominant gene),
BnSdt1BnSdt1Bnsdt2Bnsdt2 (indefinite inflorescence), BnSdt1BnSdt1BnSdt2BnSdt2 (indefinite inflorescence),
Bnsdt1Bnsdt1BnSdt2BnSdt2 (indefinite inflorescence)；
When using genotype to be BnSdt1BnSdt1Bnsdt2Bnsdt2 indefinite inflorescence strain as recurrent parent
Only with the label (the reason is that recurrent parent and donor parents in Bnsdt2 site be the same) chain with Bnsdt1；
It is just needed when using genotype to be BnSdt1BnSdt1BnSdt2BnSdt2 indefinite inflorescence strain as recurrent parent
With the label chain with Bnsdt1 and Bnsdt2；
When using genotype to be Bnsdt1Bnsdt1BnSdt2BnSdt2 indefinite inflorescence strain as recurrent parent
With the label chain with Bnsdt2；
In the case where not knowing which strain belongs to which kind of genotype, most preferably all used in these types of genotype
Bnsdt1 and Bnsdt2 chain label.
Pass through molecular marker assisted selection in this way in Breeding Process for the two the recessive gene positions Bnsdt1 and Bnsdt2
Point remains, and avoids the two gene locis or some gene loci from being substituted by dominant gene, progeny selection is not achieved and goes out
The purpose of definite inflorescence single plant.
Further, including following operation：
(1) recurrent parent selects：Cabbage type rape indefinite inflorescence excellent strain haveed the defects that on lodging and florescence.
(2) donor parents select：Cabbage type rape definite inflorescence resource selection, according to breeding objective, using existing sweet
Blue type rape definite inflorescence resource, selection differ the definite inflorescence money no more than 15 days with the indefinite inflorescence strain florescence of institute's transformation
Source is as objective trait donor material.
(3) molecular marker assisted selection：With 4 pairs and the two sides codominant marker pair of definite inflorescence character close linkage
Backcross progeny single plant carries out target gene tracking selection；Codominant marker used is SSR (simple repeated sequence) molecule
Label.
(4) economical character is identified：By the candidate cabbage type rape definite inflorescence strain of new breeding and corresponding indefinite inflorescence
Strain carries out variety comparative test (RANDOMIZED BLOCK DESIGN), investigates yield, the breeding time, lodging (lodging of candidate definite inflorescence strain
Property pass through lodging index and evaluate), choose yield than or equal to corresponding indefinite inflorescence strain, florescence shorten 3 days or more, it is anti-fall
The definite inflorescence strain that volt property is obviously improved (lodging index reduces by 0.4 or more).
The measurement of lodging index：The lodging situation of each kind of investigation will lodge according to the angle of stem and ground before mature
It is divided into 5 grades：1 grade to be that stem is substantially at upright state, i.e. stem and ground angle between 80 °~90 °, 2 grades for 45 °~
80 °, 3 grades are 30 °~45 °, and 4 grades are 0 °~30 °, and 5 grades are 0 ° (including folding falls).Lodging is calculated by the method for Qiao Chungui (1988)
Index, the smaller lodging resistance of lodging index are stronger.
The calculation formula of lodging index：Lodging index=(x1 × 1+x2 × 2+x3 × 3+x4 × 4+x5 × 5)/n；Wherein x1
~x5 distinguishes strain numbers at different levels, and 1~5 is lodging series；N is that strain number is investigated in cell.
Referring to Fig. 1, a kind of breeding side shortened cabbage type rape breeding time and enhance its lodging resistance provided by the invention
Method, including following operation：
1) using the cabbage type rape indefinite inflorescence strain with Breeding objective as recurrent parent；
It chooses and differs the cabbage type rape definite inflorescence strain for being no more than 15 days with the recurrent parent florescence as donor parents；
2) hybridized using donor parents as male parent with recurrent parent, harvest hybridization F1Generation；
3) F will be hybridized1In generation, is returned as female parent with recurrent parent, harvest backcrossing BC1F1Generation；To BC1F1It is used for single plant
Definite inflorescence trait molecular marker carries out target gene tracking selection；
The molecular labeling includes the SSR molecule for being located at the two sides definite inflorescence gene Bnsdt1 and/or Bnsdt2
Label；
It chooses the heterozygosis single plant banding pattern for containing all SSR molecular markers and the single plant for showing as indefinite inflorescence is waited as backcrossing
Menu strain；
4) it is returned using being returned candidate single plant as female parent with recurrent parent, harvest backcrossing BC2F1Generation；And continue pair
BC2F1The single plant in generation carries out SSR molecular marker, carries out tracking selection to target gene, obtains BC2F1In generation, is returned candidate single plant；
5) it is directed to BC2F1In generation, is returned candidate single plant, then by the backcrossing of candidate single plant and recurrent parent twice, and carries out SSR
Molecular labeling carries out tracking selection to target gene, obtains the BC containing definite inflorescence gene4F1In generation, is returned candidate single plant；
6) by BC4F1In generation, is returned candidate single plant and carries out bagging selfing, obtains BC4F2Generation；In BC4F2Have for selection in single plant
The single plant of definite inflorescence is the Candidate Strain of new varieties, and definite inflorescence formalness is to form a likeness in form column cap on inflorescence top
Variation silique, around understand the different silique that changes.
The recurrent parent is double low high-quality Early maturity cabbage type rape strains；
The donor parents are pair low cabbage type rape strain, and have and shorten breeding time, reduce plant height, increase effectively
Branch amount, characteristic resistant to lodging.
Further, target gene tracking is selected as：
In per generation backcross progeny group's seedling stage, each single plant is numbered, its blade is then taken to carry out DNA extraction, to extract
DNA be template, with these single plants of the primer pair of SSR molecular marker carry out PCR amplification, and to PCR amplification carry out electrophoresis detection,
Heterozygosis single plant banding pattern in electrophoresis electrical measurement result containing all SSR molecular markers is the hybrid strain containing definite inflorescence gene.
It is BnSdt1BnSdt1Bnsdt2Bnsdt2 for indefinite inflorescence recurrent parent genotype, so that it may in Breeding Process
In only need the molecular labeling chain with Bnsdt1, the detection and cost of molecular selection can be saved in this way.
The SSR molecular marker includes：SSR24, SSR40, SSR5-17 and SSR5-21, wherein SSR24 and SSR40 exist
The side of definite inflorescence gene Bnsdt1, SSR5-17 and SSR5-21 are in the other side of definite inflorescence gene Bnsdt1.
Specifically, SSR marker information is as shown in table 1, wherein SSR24 and SSR40 interlocks in definite inflorescence gene Bnsdt1
Side, SSR5-17 and SSR5-21 interlock in the other side definite inflorescence gene Bnsdt1.
1 SSR marker information of table
| Mark title | Forward | Reverse |
| SSR24 | CTTCTTCATCTTCAGCTGTTTG | CTAGTGTTCTTTGCGAGTGTTA |
| SSR40 | TTCCCTCCAAATCATGAAAGAG | GGAGTGGGTTTAAGATCTGAT |
| SSR5-17 | ATGAGGTATGTAGGTCCAGT | CCCGTCAACTAATCTCCTTC |
| SSR5-21 | GTTTTCTGGTCCTAGTAGCA | GCTATGGTTTGTTTGTGGTT |
Target gene tracks the specific steps of selection：
It in per generation backcross progeny group's seedling stage, is listed to each single plant and takes suitable blade, then carry out DNA extraction
(CTAB method), and DNA concentration is diluted to 25ng/ μ L.It is then detected with 4 pairs of codominance SSR primer pair these single plants, choosing
Taking in 4 pairs of primers all has heterozygosis single plant banding pattern (banding pattern is shown in that Fig. 3, the heterozygosis single plant banding pattern are both to have had homozygous unlimited flower
The banding pattern of sequence has the banding pattern of definite inflorescence again) and show indefinite inflorescence single plant as be returned candidate single plant (this illustrates these
Contain definite inflorescence gene in indefinite inflorescence backcross progeny single plant).
SSR amplification system is 2 μ L, 10 × Buffer (Mg of DNA dilution2+) 1 0.8 μ L of μ L, dNTPs (2.5mM each),
0.2 0.5 5 μ L of μ L, ddH2O of μ L, Primer-F/Primer-R of Taq E (5u/ μ L), total volume is 10 μ L.
SSR amplification program is：94℃,3min→94℃,30s；59 DEG C, 45s, -0.5 DEG C/cycle；72℃,45s,
10cycles；94℃,30s；54℃,45s；72 DEG C, 45s, 20cycles → 72 DEG C, 5min → 4 DEG C save.
The every cycle annealing temperature of preceding 10 circulations reduces by 0.5 DEG C, after dropping to 54 DEG C, then carries out subsequent 20 circulations；
Specific embodiment is given below.
Embodiment 1
A method of shortening cabbage type rape breeding time and enhance its lodging resistance, includes the following steps：
(1) recurrent parent indefinite inflorescence strain selects：Select 3 Early maturity cabbage type rape excellent strains 3508,3511,
3521 (it is indefinite inflorescence strain, genotype has been confirmed as BnSdt1BnSdt1Bnsdt2Bnsdt2 by genetic analysis,
It is double low high-quality Early maturity cabbage type rapes), in Qinghai high hill regions, regional (height above sea level >=2950m) is unable to normal mature and has one
Fixed lodging.
(2) donor parents definite inflorescence resource selection：According to the florescence of 3 selected indefinite inflorescence strains, the florescence is selected
(genotype Bnsdt1Bnsdt1Bnsdt2Bnsdt2 is cabbage type rape definite inflorescence strain 410 of the difference no more than 15 days
Double low cabbage type rapes) it is used as donor parents.
(3) molecular marker assisted selection：Hybridized using indefinite inflorescence as female parent with definite inflorescence resource, harvest hybridization
F1Generation；
F will be hybridized1It is returned as female parent with indefinite inflorescence parent, obtains BC1F1Generation；To BC1F1For single plant with 4 pairs with
The two sides codominant marker of definite inflorescence character close linkage carries out target gene tracking selection；Co-dominant molecular mark used
Note is SSR (simple repeated sequence) molecular labeling；SSR24 and SSR40 is in the side definite inflorescence gene Bnsdt1, SSR5-17
With SSR5-21 in the other side definite inflorescence gene Bnsdt1；
Retain the BC containing definite inflorescence gene1F1In generation, is returned candidate single plant (phenotype is indefinite inflorescence), using it as female parent
Parent is returned with indefinite inflorescence, harvest backcrossing BC2F1Generation；And continue to BC2F1The single plant in generation carries out target gene tracking choosing
It selects；Obtain BC2F1In generation, is returned candidate single plant (phenotype is indefinite inflorescence)；
By be returned twice and target gene tracking selection after obtain the BC containing definite inflorescence gene4F1Generation backcrossing is waited
Menu strain (phenotype is indefinite inflorescence)；
To each combination BC4F1In generation, is returned candidate single plant bagging selfing, obtains BC4F2Generation；In BC4F2In generation isolated plant
Select the selfing of definite inflorescence single plant bagging；Select the phenotype with definite inflorescence gene and definite inflorescence character.
(4) economical character is identified：In each combination BC4F1In generation, is returned candidate single plant bagging selfing, obtains BC4F2Generation；?
BC4F2Selection definite inflorescence single plant bagging selfing in generation isolated plant；Its definite inflorescence formalness is to be formed on inflorescence top
The variation silique of one likeness in form column cap, around understand change different silique (as shown in Figure 3).
The definite inflorescence strain for obtaining genetic background identical as corresponding indefinite inflorescence, by the candidate definite inflorescence of acquisition point
NIL-3508, NIL-3511, NIL-3521 are not named as it.
Variety comparative test is carried out with corresponding indefinite inflorescence strain to the candidate definite inflorescence strain of new breeding next year
(RANDOMIZED BLOCK DESIGN) investigates yield, breeding time, the lodging of candidate definite inflorescence strain.Product ratio as a result, it has been found that：NIL-3508
(yield is 151.6kg/ mu, and the time of infertility is 119 days, lodging index 1.31) is than 3508 in yield high 3.6%, breeding time
Shorten 5 days, lodging index it is small by 0.67；(yield is 158.2kg/ mus to NIL-3511, and the time of infertility is 122 days, and lodging index is
1.0) than 3511 yield is high 5.1%, reduction in the life period 3 days, lodging index are small by 0.82；(yield is NIL-3521
155.3kg/ mus, the time of infertility is 124 days, lodging index 1.54) than 3521 yield is high 1.4%, reduction in the life period 6
It, lodging index it is small by 0.5.
NIL-3508, NIL-3511, NIL-3521 is newly bred as in summary all to have reached shortening breeding time and enhanced anti-fall
The breeding requirement of volt.
Example given above is to realize the present invention preferably example, and the present invention is not limited to the above embodiments.This field
Technical staff's technical solution according to the present invention technical characteristic any nonessential addition, the replacement made, belong to this
The protection scope of invention.
Claims (9)
1. a kind of breeding method for shortening cabbage type rape breeding time and enhancing its lodging resistance, which is characterized in that including following
Operation：
1) using the cabbage type rape indefinite inflorescence strain with Breeding objective as recurrent parent；
It chooses and differs the cabbage type rape definite inflorescence strain for being no more than 15 days with the recurrent parent florescence as donor parents；
2) hybridized using donor parents as male parent with recurrent parent, harvest hybridization F1Generation；
3) F will be hybridized1In generation, is returned as female parent with recurrent parent, harvest backcrossing BC1F1Generation；To BC1F1For single plant with limited
Inflorescence trait molecular marker carries out target gene tracking selection；
The molecular labeling includes the SSR molecular marker for being located at the two sides definite inflorescence gene Bnsdt1 and/or Bnsdt2；
It chooses the heterozygosis single plant banding pattern for containing all SSR molecular markers and the single plant for showing as indefinite inflorescence is candidate single as backcrossing
Strain；
4) it is returned using being returned candidate single plant as female parent with recurrent parent, harvest backcrossing BC2F1Generation；And continue to BC2F1Generation
Single plant carry out SSR molecular marker screening, tracking selection is carried out to target gene, obtains BC2F1In generation, is returned candidate single plant；
5) it is directed to BC2F1In generation, is returned candidate single plant, then by the backcrossing of candidate single plant and recurrent parent twice, and carries out SSR molecule
Label, carries out tracking selection to target gene, obtains the BC containing definite inflorescence gene4F1In generation, is returned candidate single plant；
6) by BC4F1In generation, carries out bagging selfing, harvests BC4F2Generation；In BC4F2It is new product that the single plant with definite inflorescence is selected in generation
Kind Candidate Strain, definite inflorescence formalness be inflorescence top formed a likeness in form column cap variation silique, around meeting
The different silique that changes.
2. shortening cabbage type rape breeding time as described in claim 1 and enhancing the breeding method of its lodging resistance, feature
It is, the recurrent parent is double low high-quality Early maturity cabbage type rape strains；
The donor parents are double low cabbage type rape strains, and have and shorten breeding time, reduce plant height, increase effective branch
Characteristic several, resistant to lodging.
3. shortening cabbage type rape breeding time as described in claim 1 and enhancing the breeding method of its lodging resistance, feature
It is, the target gene tracking is selected as：
In per generation backcross progeny group's seedling stage, each single plant is numbered, takes its blade to carry out DNA extraction, then with the DNA of extraction
For template, PCR amplification is carried out with these single plants of the primer pair of SSR molecular marker, and electrophoresis detection, electrophoresis are carried out to PCR amplification
Heterozygosis single plant banding pattern in electrical measurement result containing all SSR molecular markers is the hybrid strain containing definite inflorescence gene.
4. the breeding method as claimed in claim 1 or 3 for shortening cabbage type rape breeding time and enhancing its lodging resistance, special
Sign is that the molecular labeling is selected as：
When using genotype to be BnSdt1BnSdt1Bnsdt2Bnsdt2 indefinite inflorescence strain as recurrent parent, using Bnsdt1
The SSR molecular marker of two sides；
When using genotype to be BnSdt1BnSdt1BnSdt2BnSdt2 indefinite inflorescence strain as recurrent parent, using Bnsdt1
With the SSR molecular marker of the two sides Bnsdt2；
When using genotype to be Bnsdt1Bnsdt1BnSdt2BnSdt2 indefinite inflorescence strain as recurrent parent, using Bnsdt2
The SSR molecular marker of two sides；
Bnsdt1 and Bnsdt2 is remained in the two recessive gene sites by molecular marker assisted selection.
5. the breeding method as claimed in claim 1 or 3 for shortening cabbage type rape breeding time and enhancing its lodging resistance, special
Sign is, when using genotype to be BnSdt1BnSdt1Bnsdt2Bnsdt2 indefinite inflorescence strain as recurrent parent, uses
The SSR molecular marker of the two sides Bnsdt1 includes：SSR24, SSR40, SSR5-17 and SSR5-21, wherein SSR24 and SSR40 is having
The side of inflorescence gene Bnsdt1 is limited, SSR5-17 and SSR5-21 are in the other side of definite inflorescence gene Bnsdt1.
6. shortening cabbage type rape breeding time as claimed in claim 5 and enhancing the breeding method of its lodging resistance, feature
It is, the primer of SSR molecular marker is：
SSR24：
Forward：CTTCTTCATCTTCAGCTGTTTG；
Reverse：CTAGTGTTCTTTGCGAGTGTTA；
SSR40：
Forward：TTCCCTCCAAATCATGAAAGAG；
Reverse：GGAGTGGGTTTAAGATCTGAT；
SSR5-17：
Forward：ATGAGGTATGTAGGTCCAGT；
Reverse：CCCGTCAACTAATCTCCTTC；
SSR5-21：
Forward：GTTTTCTGGTCCTAGTAGCA；
Reverse：GCTATGGTTTGTTTGTGGTT.
7. shortening cabbage type rape breeding time as claimed in claim 5 and enhancing the breeding method of its lodging resistance, feature
It is, the amplification system of SSR molecular marker is：
2 μ L, 10 × Buffer (Mg of DNA profiling2+) 1 μ L, dNTPs (2.5mM each) 0.8 μ L, Taq E (5u/ μ L) 0.2 μ L,
0.5 5 μ L of μ L, ddH2O of Primer-F/Primer-R, total volume are 10 μ L；
The amplification program of SSR molecular marker is：94 DEG C of denaturation 3min；
94 DEG C of denaturation 30s, 59 DEG C of annealing 45s, 72 DEG C of extension 45s, each 0.5 DEG C of the reduction of cycle annealing temperature, 10 recycle；94
DEG C denaturation 30s, 54 DEG C of annealing 45s, 72 DEG C of extension 45s, 20 recycle；The every cycle annealing temperature of preceding 10 circulations reduces by 0.5 DEG C,
After dropping to 54 DEG C, then carry out subsequent 20 circulations；
72 DEG C of extension 5min；4 DEG C of preservations.
8. the breeding method as claimed in claim 1 or 3 for shortening cabbage type rape breeding time and enhancing its lodging resistance, special
Sign is that the heterozygosis single plant banding pattern is the banding pattern not only with homozygous indefinite inflorescence but also the banding pattern with definite inflorescence.
9. shortening cabbage type rape breeding time as described in claim 1 and enhancing the breeding method of its lodging resistance, feature
It is, the inflorescence gene that per generation is returned candidate single plant is following one of several：
BnSdt1Bnsdt1Bnsdt2Bnsdt2；
Bnsdt1Bnsdt1BnSdt2Bnsdt2；
BnSdt1Bnsdt1BnSdt2Bnsdt2。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810726206.0A CN108812297B (en) | 2018-07-04 | 2018-07-04 | Breeding method for shortening growth period of cabbage type rape and enhancing lodging resistance of cabbage type rape |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810726206.0A CN108812297B (en) | 2018-07-04 | 2018-07-04 | Breeding method for shortening growth period of cabbage type rape and enhancing lodging resistance of cabbage type rape |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108812297A true CN108812297A (en) | 2018-11-16 |
| CN108812297B CN108812297B (en) | 2021-12-17 |
Family
ID=64135350
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810726206.0A Active CN108812297B (en) | 2018-07-04 | 2018-07-04 | Breeding method for shortening growth period of cabbage type rape and enhancing lodging resistance of cabbage type rape |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108812297B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109402295A (en) * | 2018-12-26 | 2019-03-01 | 江西省农业科学院作物研究所 | Method for accelerating backcross breeding process of brassica napus by using orange flower color molecular markers |
| CN111269998A (en) * | 2020-01-14 | 2020-06-12 | 青海大学 | Molecular marker linked with cabbage type rape limited inflorescence gene Bnsdt2 and application thereof |
| CN111334599A (en) * | 2020-03-03 | 2020-06-26 | 青海大学 | Breeding method for quickly creating cabbage type spring rape early flowering resource |
| CN111543315A (en) * | 2020-06-30 | 2020-08-18 | 江西省农业科学院作物研究所 | Breeding method of rape early-maturing variety |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110018113A (en) * | 2009-08-17 | 2011-02-23 | 이관호 | Lunaria koreana l. var. cheongyuchae as a new variety plant and a method for breeding the same |
| CN111269998A (en) * | 2020-01-14 | 2020-06-12 | 青海大学 | Molecular marker linked with cabbage type rape limited inflorescence gene Bnsdt2 and application thereof |
-
2018
- 2018-07-04 CN CN201810726206.0A patent/CN108812297B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20110018113A (en) * | 2009-08-17 | 2011-02-23 | 이관호 | Lunaria koreana l. var. cheongyuchae as a new variety plant and a method for breeding the same |
| CN111269998A (en) * | 2020-01-14 | 2020-06-12 | 青海大学 | Molecular marker linked with cabbage type rape limited inflorescence gene Bnsdt2 and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| KAIXIANG LI ET AL.: "Fine mapping of the Brassica napus Bnsdt1 gene associated with determinate growth habit", 《THEOR APPL GENET》 * |
| 李开祥 等: "无限花序植物中有限花序性状的研究进展", 《分子植物育种》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109402295A (en) * | 2018-12-26 | 2019-03-01 | 江西省农业科学院作物研究所 | Method for accelerating backcross breeding process of brassica napus by using orange flower color molecular markers |
| CN109402295B (en) * | 2018-12-26 | 2021-06-11 | 江西省农业科学院作物研究所 | Method for accelerating backcross breeding process of brassica napus by using orange flower color molecular markers |
| CN111269998A (en) * | 2020-01-14 | 2020-06-12 | 青海大学 | Molecular marker linked with cabbage type rape limited inflorescence gene Bnsdt2 and application thereof |
| CN111334599A (en) * | 2020-03-03 | 2020-06-26 | 青海大学 | Breeding method for quickly creating cabbage type spring rape early flowering resource |
| CN111334599B (en) * | 2020-03-03 | 2022-05-10 | 青海大学 | Breeding method for quickly creating cabbage type spring rape early flowering resource |
| CN111543315A (en) * | 2020-06-30 | 2020-08-18 | 江西省农业科学院作物研究所 | Breeding method of rape early-maturing variety |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108812297B (en) | 2021-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108812297A (en) | A kind of breeding method for shortening cabbage type rape breeding time and enhancing its lodging resistance | |
| CN107347632B (en) | Breeding method of cabbage type rape radish cytoplasmic sterility restoring line and application of cabbage type rape radish cytoplasmic sterility restoring line in cabbage type rape breeding | |
| CN107197773B (en) | A kind of selection of north glutinous sorghum sterile line and holding system | |
| CN111793710B (en) | SNP marker linked with cauliflower ball-bottom flower stalk branch angle, method and application | |
| CN104054570A (en) | Breeding method of hybrid rice two-line sterile line with leaves carrying white midribs | |
| CN104313155A (en) | Floral character associated molecular marker screening method of amenone form chrysanthemum and application of method | |
| CN102960237B (en) | Method for obtaining, breeding and storing peanut interspecies hybridization variety, and identifying molecular cytology | |
| CN110463599A (en) | A kind of Direct-seeding Rice selection | |
| CN108703067B (en) | Rapid breeding method of ornamental rice variety in growth period | |
| CN114350655B (en) | Exogenous radish fragment specific marker and preparation method and application thereof | |
| CN109136400A (en) | The QTLs and its localization method of radish fleshy root correlated traits | |
| CN107347625B (en) | Strong application of the female self-mating system LC-03 in pumpkin breeding | |
| Andarini et al. | Genetic relationship of pigmented rice (Oryza sativa L.) collected from Eastern Indonesia based on morpho-agronomical traits and SSR markers | |
| CN110607382B (en) | SNP molecular marker of single ring weight major gene from Xinluzao 24 | |
| CN110692511A (en) | Method for improving crucifer crop characters according to genome size | |
| CN106399498A (en) | Molecular marker assisted selection method for cauliflower flower ball pedicel length | |
| CN113462813B (en) | Site linked with pear peel red character, molecular marker and application thereof | |
| CN113481320B (en) | Site linked with pear peel red character, molecular marker and application thereof | |
| CN107251833B (en) | A kind of breeding method improveing cotton prematurity | |
| CN113273460B (en) | Lodging-resistant conventional japonica rice breeding method | |
| CN112673954B (en) | High-yield breeding method of sesame with limited growth habit | |
| CN110999779B (en) | Method for synthesizing clubroot-resistant brassica napus by using polymerization breeding and biotechnology | |
| CN107787827A (en) | A kind of spicy green pepper new variety selective breeding technology of precocious lower temperature resistance | |
| CN107058601B (en) | SNP (Single nucleotide polymorphism) marker for identifying low stone cell content of pear pulp based on high-resolution dissolution curve and application of SNP marker | |
| CN106893729B (en) | Recombinant nucleic acid fragment RecCR033207 and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Du Dezhi Inventor after: Li Kaixiang Inventor after: Zhao Zhi Inventor after: Yao Yanmei Inventor after: Xu Liang Inventor after: Li Jun Inventor before: Du Dezhi Inventor before: Li Kaixiang Inventor before: Zhao Zhi Inventor before: Yao Yanmei Inventor before: Xu Liang Inventor before: Li Jun |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |