CN110999779B - Method for synthesizing clubroot-resistant brassica napus by using polymerization breeding and biotechnology - Google Patents

Method for synthesizing clubroot-resistant brassica napus by using polymerization breeding and biotechnology Download PDF

Info

Publication number
CN110999779B
CN110999779B CN201911285541.2A CN201911285541A CN110999779B CN 110999779 B CN110999779 B CN 110999779B CN 201911285541 A CN201911285541 A CN 201911285541A CN 110999779 B CN110999779 B CN 110999779B
Authority
CN
China
Prior art keywords
clubroot
resistant
cabbage
brassica napus
resistance
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911285541.2A
Other languages
Chinese (zh)
Other versions
CN110999779A (en
Inventor
黄镇
于澄宇
徐爱遐
石益基
郑琳
王凯
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Northwest A&F University
Original Assignee
Northwest A&F University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Northwest A&F University filed Critical Northwest A&F University
Priority to CN201911285541.2A priority Critical patent/CN110999779B/en
Publication of CN110999779A publication Critical patent/CN110999779A/en
Application granted granted Critical
Publication of CN110999779B publication Critical patent/CN110999779B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention belongs to the technical field of rape germplasm improvement, and discloses a method for synthesizing clubroot-resistant brassica napus by using pyramiding breeding and biotechnology, wherein distant hybridization is used for taking a disease-resistant progeny plant line of a clubroot-resistant Chinese cabbage variety Wendingchui bud and clubroot-resistant medium-blossoming cabbage as a source of clubroot-resistant genes; taking double 11 in susceptible brassica napus varieties as recurrent parents, taking true hybrids obtained by distant hybridization as female parents for backcross, screening plants containing resistance of Chinese cabbage and cabbage mustard by using a molecular marker IP13-2 and a molecular marker KASP1 for resisting clubroot in the cabbage mustard, carrying out background selection on progeny plants by using an SSR marker covering a whole genome, and selecting resistant plants with the highest similarity with the recurrent parents. The molecular marker is used for assisting in selection to accelerate the breeding process of the clubroot-resistant brassica napus strain; the polymerization of a plurality of clubroot-resistant genes improves the resistance of the cabbage type rape to the clubroot and accelerates the breeding process.

Description

Method for synthesizing clubroot-resistant brassica napus by using polymerization breeding and biotechnology
Technical Field
The invention belongs to the technical field of rape breeding, and discloses a method for synthesizing clubroot-resistant brassica napus by using pyramiding breeding and biotechnology.
Background
Currently, the closest prior art: as early as the late 19 th century, clubroot started to occur widely in Australia in North America, and until the beginning of the 20 th century, clubroot occurred widely in almost all continents and was distributed in most of China. It causes a 10% -15% reduction in yield of cruciferous crops worldwide every year, and thus becomes one of the major factors that restrict the production of cruciferous crops. Clubroot is a soil-borne disease caused by plasmodiophora brassicae, and is one of the main destructive diseases of cruciferous crops which are widely cultivated. The plant root is mainly damaged, the tumor is formed at the plant root, the tumor can obstruct the absorption of nutrient elements and water of the plant, the normal growth of the plant is seriously influenced, and the field yield of crops is reduced. Once the plant is infected with the plasmodiophora brassicae, the soil carries bacteria for a long time, and the plant is not suitable for cultivating cruciferous crops any more.
At present, the traditional chemical method is mainly adopted at home to prevent and treat the clubroot, but the problem of spreading the clubroot of the rape can not be solved fundamentally, and meanwhile, the environmental pollution is brought, and the sustainable development of agriculture is not facilitated. The breeding of disease-resistant varieties is considered to be the most safe, economic and effective measure for preventing and treating clubroot. In recent years, many units transform brassica napus anti-clubroot germplasm by using a backcross transformation method, but the traditional backcross transformation method only depends on visual inspection and simple phenotype selection, does not carry out accurate identification at a molecular level, has very slow breeding speed, is easy to lose resistance genes, and rarely synthesizes the brassica napus germplasm with the anti-clubroot disease.
The cabbage type rape has the largest planting area in three types of rape cultivation and plays an important role in rape production, so that the research on the clubroot resistance of the cabbage type rape is developed, a new clubroot resistance cabbage type rape strain is cultured, and the method has extremely important strategic significance for improving the clubroot resistance of the rape. The clubroot of Brassicaceae has a plurality of physiological races, in China, the pathogeny of clubroot of Brassica napus at least has physiological races of No. 2, no. 4, no. 7 and the like, wherein the existence range of the No. 4 race is the widest. Because the pathogenic genes corresponding to different physiological races are different, after the anti-clubroot variety in a certain area is planted in another area, the original anti-clubroot variety is changed into a clubroot-susceptible variety due to the change of the physiological races, which brings great difficulty to the prevention and treatment of the clubroot. In addition, because the existing cruciferae materials have single resistance and gradually degrade in resistance after being planted for many years, the varieties which aggregate a plurality of resistance genes and resist a plurality of physiological races of plasmodiophora brassicae are urgently needed to be cultivated.
China is not the origin center of cabbage type rape, the cabbage type rape is only transferred from Europe to China for hundreds of years, the germplasm resources are rare, the genetic background is narrow, the present rape varieties resisting clubroot disease in China are very few, the resistance source is single, but the closely related species of cabbage and cabbage have clubroot disease resisting materials, therefore, the resistance gene of clubroot disease in the species is necessary to be introduced into the cabbage type rape, and the cabbage type rape new variety resisting multiple physiological races is bred, thereby relieving the spreading of the clubroot disease of the cabbage type rape in China.
In summary, the problems of the prior art are as follows:
(1) The germplasm resources for resisting the clubroot of the cabbage type rape are rare, and the requirements of the breeding for resisting the clubroot of the cabbage type rape are difficult to meet.
(2) The existing cabbage type rape material has a single clubroot resistance source, only resists a few physiological races, and has the phenomenon of resistance decline.
(3) The traditional cabbage type rape clubroot resistant material breeding method is slow.
The difficulty of solving the technical problems is as follows: at present, the method for breeding new brassica napus varieties capable of resisting clubroot by screening germplasm capable of resisting clubroot from brassica napus is obviously infeasible, so that disease-resistant genes must be mined from closely related species. At present, most researchers search resistance sources from Chinese cabbages, but the resistance genes are single in source and easily disappear, so that the source channel of the resistance genes needs to be widened, and the resistance genes from the cabbages are necessary to be obtained so as to enhance the durability of the disease resistance of the cabbage type rape.
The traditional backcross transformation method is mainly selected according to field phenotypes, has large workload, is easy to select wrongly, lacks accurate identification of molecular level and has slow effect. If the traditional backcross transformation method is combined with the molecular marking technology, the accuracy of selecting offspring individuals can be greatly improved, the offspring individuals are less prone to walking, the breeding process is accelerated, and the breeding method is simple, easy to operate and low in cost for most of the current domestic research units.
The significance of solving the technical problems is as follows: the invention provides a new way for breeding the brassica napus plasmodiophora resistance germplasm, which is beneficial to widening the plasmodiophora resistance source of the brassica napus, and the synthesized germplasm containing a plurality of resistance sites always has more durable disease resistance. The wide application of the method can greatly accelerate the breeding process of the clubroot germplasm of the brassica napus, and play a good role in inhibiting the spread of the clubroot at present.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a method for synthesizing clubroot-resistant brassica napus by using pyramiding breeding and biotechnology.
The invention is realized by the method for synthesizing the clubroot-resistant brassica napus by using the polymerization breeding and the biotechnology, and the method for synthesizing the clubroot-resistant brassica napus by using the polymerization breeding and the biotechnology uses a distant hybridization method and takes the clubroot-resistant brassica napus variety Wedingchun bud and the clubroot-resistant brassica juncea as the source of resistance genes of clubroot, wherein the Chinese cabbage variety Wedingchun bud is resistant to clubroot P4 and P7 physiological races, and the clubroot-resistant brassica juncea is resistant to P4 and P7 physiological races, which are all available in the market.
Taking Zhongshuang 11 as recurrent parent, taking true hybrid obtained by distant hybridization as female parent, carrying out backcross, screening plants containing Chinese cabbage and cabbage mustard resistance by using a molecular marker IP13-2 related to the clubroot resistance in Wendingchun bud and a molecular marker KASP1 for resisting clubroot in cabbage mustard, and carrying out backcross by using the Zhongshuang 11 and the molecular marker to obtain BC 2 The separated group is inoculated by utilizing P4 physiological microspecies, and simultaneously, a disease-resistant plant is screened by utilizing a molecular marker IP13-2 related to clubroot resistance in the Wendingchun bud and a molecular marker KASP1 for resisting clubroot in cabbage mustard.
Further, the sequence of the molecular marker IP13-2 is SEQ ID NO:1; the sequence of the molecular marker KASP1 is SEQ ID NO:2.
further, the method for synthesizing the clubroot-resistant brassica napus by using the pyramiding breeding and biotechnology comprises the following steps of:
firstly, hybridizing a double 11 in a clubroot-sensitive rape variety serving as a receptor (serving as a female parent) with a Chinese cabbage variety Wendingchun bud, harvesting seeds, performing resistance identification on an F1 generation by using a P4 physiological race, performing true and false hybrid identification by using cytology and molecular markers, selecting a true hybrid resisting the P4 physiological race as the female parent, hybridizing with Chinese cabbage, and selecting seeds for embryo rescue after pollinating for 15 days;
secondly, identifying true and false hybrids by using cytology and molecular marker hybrid progeny, and selecting true hybrids; taking the Zhongshuang 11 as a recurrent parent, taking a true hybrid obtained by distant hybridization as a female parent, and carrying out backcross; screening disease-resistant plants by using a molecular marker IP13-2 related to clubroot resistance in the Wen Ding Chun bud and a molecular marker KASP1 for resisting clubroot in cabbage mustard;
thirdly, carrying out background selection on the obtained disease-resistant plants by using 100 SSR markers distributed in the whole genome of the brassica napus, screening resistant individuals most similar to the genetic background of Zhongshuang 11, continuing backcrossing with the Zhongshuang 11, and repeating BC 2 Breeding process of generation till BC 5 Selfing the selected resistant plants to obtain BC 5 F 1 Inoculating the group by using P4 physiological race, screening disease-resistant plants, and detecting whether the separated group has resistance locus of cabbage and cabbage mustard by using molecular markers IP13-2 and KASP 1;
fourthly, selecting the obtained plants with resistance to the Chinese cabbage and the cabbage by utilizing SSR marker backgrounds to obtain individuals with the highest similarity with the Chinese cabbage and the cabbage, and continuously selfing for 3 generations until BC 5 F 4 . To BC 5 F 4 The seeds are respectively inoculated and identified by P4 and P7 physiological races, and resistance sites are detected by IP13-2 and KASP1, finally obtaining the cabbage type rape line with a plurality of resistance genes and resistance to a plurality of physiological races.
Further, the specific method for the first embryo rescue is as follows: culturing immature seeds by using a B5 liquid culture medium containing 2% of sucrose, transferring the embryos onto a B5 solid culture medium containing 2% of sucrose when cotyledons grow after the young embryos appear, and transferring the embryos into soil at the 3-4 leaf stage.
Another object of the present invention is to provide an application of the method for synthesizing clubroot-resistant Brassica napus by using pyramiding breeding and biotechnology in rape breeding.
In summary, the advantages and positive effects of the invention are as follows: the invention utilizes the clubroot-resistant resources in Chinese cabbage and cabbage mustard and utilizes a polymerization breeding method to cultivate the cabbage type rape which has a plurality of clubroot-resistant genes and can resist a plurality of clubroot physiological races.
Compared with the prior art, the invention has the following advantages:
(1) Clubroot resistance resources in brassica napus are deficient, so that the traditional method for screening resistance materials in the brassica napus is not practical, and the related species of the brassica napus, namely the brassica napus and the brassica oleracea, have the resistance materials. The invention breeds the clubroot-resistant brassica napus by distant hybridization of the resistance genes of the Chinese cabbage and the cabbage, which provides a good idea for the breeding of clubroot-resistant germplasm of the brassica napus.
(2) Multiple clubroot-resistant genes are polymerized, and the clubroot resistance of the brassica napus is improved. The resistance genes published in the world at present mainly come from Chinese cabbage, are generally single genes or major genes, when the resistance genes are transferred into the rape, the resistance is often weak in durability, in order to improve the resistance time of the rape, the resistance genes of the Chinese cabbage and the cabbage are simultaneously introduced into the rape, and because the materials resist two main physiological races of China, the rape strain bred by distant hybridization has a plurality of resistance genes, resists a plurality of physiological races, prolongs the resistance time of the rape variety and expands the suitable range of the rape variety.
(3) Accelerating the process of cultivating the clubroot-resistant material of the cabbage type rape. The distant hybridization breeding of new germplasm is a long process, and needs more than 10 years of time to form stable strains, particularly in the aggregate breeding of three different species, the selection of the progeny target traits is extremely difficult.
Drawings
FIG. 1 is a flow chart of a method for synthesizing clubroot-resistant Brassica napus by using pyramiding breeding and biotechnology according to an embodiment of the present invention.
FIG. 2 is a flow chart of the implementation of the method for synthesizing clubroot-resistant Brassica napus by using pyramiding breeding and biotechnology according to the embodiment of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Aiming at the problems in the prior art, the invention provides a method for synthesizing clubroot-resistant brassica napus by utilizing pyramiding breeding and biotechnology, and the invention is described in detail below by combining the attached drawings.
As shown in FIG. 1, the method for synthesizing clubroot-resistant Brassica napus by using pyramiding breeding and biotechnology provided by the embodiment of the present invention comprises the following steps:
s101: taking double 11 in a susceptible cabbage type rape variety as a receptor, hybridizing the double 11 with a Wendingchun bud of a cabbage variety, selecting a true hybrid resisting a P4 physiological race as a female parent, hybridizing the true hybrid with a Chinese flowering cabbage, and obtaining a hybrid progeny by utilizing an embryo rescue technology;
s102: identifying true and false hybrids by utilizing cytology and molecular marker hybrid progeny, and selecting the true hybrids;
s103: screening disease-resistant plants by using a molecular marker IP13-2 related to clubroot resistance in the Wen Ding Chun bud and a molecular marker KASP1 for resisting clubroot in cabbage mustard;
s104: 100 pairs of SSR markers distributed in the whole genome of the cabbage type rape are utilized to carry out the treatment on the obtained disease-resistant plantsBackground selection, screening resistant individuals most similar to the Zhongshuang 11 genetic background, continuing backcrossing with the Zhongshuang 11, and repeating BC 2 Breeding process of generation till BC 5 ；
S105: selecting the obtained plants with resistance to both Chinese cabbage and cabbage by using SSR marker background, obtaining individuals with highest similarity to Zhongshuang 11, and continuously selfing until BC 5 F 4 And carrying out disease resistance identification on the progeny plants to obtain the cabbage type rape strain with a plurality of polymerized resistance genes.
The technical scheme of the invention is further described in the following with reference to the attached drawings.
The invention uses distant hybridization method, uses anti-clubroot Chinese cabbage variety Wendingchun bud and anti-clubroot middle flowering cabbage as the resistance gene source of clubroot, wherein the Chinese cabbage variety Wendingchun bud is anti-clubroot P4 and P7 physiological races, and the middle flowering cabbage is anti-clubroot P4 and P7 physiological races.
As shown in FIG. 2, the method for synthesizing clubroot-resistant Brassica napus by using pyramiding breeding and biotechnology provided by the embodiment of the present invention specifically comprises the following steps:
firstly, double 11 in the rape variety of the clubroot-affected country is taken as a receptor. Hybridizing the female parent of Zhongshuang No. 11 with the Wedingchun bud of the Chinese cabbage variety, harvesting the seeds, and then, performing hybridization on the F 1 The generation utilizes P4 physiological race as resistance identification, simultaneously utilizes cytology and molecular marker to identify true and false hybrid, selects true hybrid resisting P4 physiological race as female parent, makes hybridization with Chinese cabbage, pollinates for 15 days, selects seed to save embryo. The specific method for embryo rescue is as follows: culturing immature seeds by using a B5 liquid culture medium containing 2% of sucrose, transferring the embryos onto a B5 solid culture medium containing 2% of sucrose when cotyledons grow after the young embryos appear, and transferring the embryos into soil at the 3-4 leaf stage.
And secondly, identifying true and false hybrids by using cytology and molecular marker hybrid progeny, and selecting the true hybrids. Taking Zhongshuang 11 as recurrent parent, taking true hybrid obtained by distant hybridization as female parent, carrying out backcross, and carrying out backcross at BC 1 Continuously adopting embryo rescue technology to obtain progeny plants (picking a large number of embryos), obtaining more progeny plants, and reserving all the plants (preventing embryo rescue)Loss of resistance gene), using the molecular marker associated with clubroot resistance in wendingchun buds (IP 13-2) SEQ ID NO:1 (5 'ttggttgatgctgggagacat 3';5'agatttgagggcagacat 3') and a clubroot-resistant molecular marker in cabbage mustard SEQ ID NO:2 (KASP 1) (FAM: 5 'gaaggtgaccaagtttcatgctcgctcgattcgtttgtcgagaagaagcg 3'; HEX:5 'gaaggtcggaagtcaacggattgctccgattcgtgtcgagagaagaagcc 3'; COM:5 'cgccggaaagggatcgacg3') to select plants resistant to cabbage and cabbage mustard, and to which Bc is backcrossed with Zhongshuang 11 to obtain BC 2 The separated group is inoculated by utilizing P4 physiological microspecies, and simultaneously, disease-resistant plants are screened by utilizing a molecular marker IP13-2 related to the clubroot resistance in the Wendingchun bud and a molecular marker KASP1 for resisting the clubroot in the cabbage mustard.
Thirdly, 100 SSR markers distributed in the whole genome of the brassica napus are used for carrying out background selection on the obtained disease-resistant plants, resistant individuals (3-5 plants) most similar to the genetic background of the Zhongshuang 11 are screened, backcross is continuously carried out on the resistant individuals and the Zhongshuang 11, and BC is repeated 2 Breeding process of generation, up to BC 5 Selfing the selected resistant plants to obtain BC 5 F 1 And inoculating the group by using the P4 physiological race, screening disease-resistant plants, and detecting whether the separated group has resistance loci of the Chinese cabbage and the cabbage mustard by using molecular markers IP13-2 and KASP 1.
Fourthly, selecting the obtained plants with resistance to the Chinese cabbage and the cabbage by utilizing SSR marker backgrounds to obtain individuals with the highest similarity with the Chinese cabbage and the cabbage, and continuously selfing for 3 generations until BC 5 F 4 . To BC 5 F 3 The seeds are respectively inoculated and identified by P4 and P7 physiological races, and resistance sites are detected by IP13-2 and KASP1, finally obtaining the cabbage type rape line with a plurality of resistance genes and resistance to a plurality of physiological races.
The above description is intended to be illustrative of the preferred embodiment of the present invention and should not be taken as limiting the invention, but rather, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention.
Figure BDA0002317873290000081
Sequence listing
<110> northwest agriculture and forestry science and technology university
<120> method for synthesizing clubroot-resistant brassica napus by using pyramiding breeding and biotechnology
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 36
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttggttgatg ctggagatag atttgagggc agacat 36
<210> 2
<211> 103
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gaaggtgacc aagttcatgc tgctcgattc gttcgagaag cggaaggtcg gagtcaacgg 60
attgctcgat tcgttcgaga agcccgccgg aaagggatcg acg 103

Claims (4)

1. A method for synthesizing clubroot-resistant brassica napus by using pyramiding breeding and biotechnology is characterized in that a distant hybridization method is used, and clubroot-resistant brassica napus varieties of Wendingchun buds and clubroot-resistant brassica napus are taken as resistance gene sources of clubroot diseases, wherein the Wendingchun buds of the brassica napus varieties are resistant to clubroot diseases P4 and P7 physiological races, and the Wendingchun buds of the brassica napus varieties are resistant to P4 and P7 physiological races; taking Zhongshuang 11 as a recurrent parent, taking a true hybrid obtained by distant hybridization as a female parent, carrying out backcross, screening plants containing Chinese cabbage and cabbage mustard resistant by utilizing a molecular marker IP13-2 related to the clubroot disease resistance in the Wendingchun bud and a molecular marker KASP1 resistant to the clubroot disease in the cabbage mustard, carrying out backcross on the Zhongshuang 11 and the molecular marker to obtain seeds of BC 2, inoculating the segregating population by utilizing a P4 physiological race, and screening disease-resistant plants by utilizing the molecular marker IP13-2 related to the clubroot disease resistance in the Wendingchun bud and the molecular marker KASP1 resistant to the clubroot disease in the cabbage mustard;
the sequence of the molecular marker IP13-2 is SEQ ID NO:1; the sequence of the molecular marker KASP1 is SEQID NO:2.
2. the method for synthesizing clubroot resistant brassica napus by pyramiding breeding and biotechnology according to claim 1, wherein the method for synthesizing clubroot resistant brassica napus by pyramiding breeding and biotechnology comprises the steps of:
the first step, double 11 in the clubroot-sensitive rape variety is taken as a receptor (as a female parent) to be hybridized with a Chinese cabbage Wendingchun bud, after the seeds are harvested, P4 physiological races are used for resistance identification for F1 generation, cytology and molecular markers are used for true and false hybrid identification, true hybrids resisting the P4 physiological races are selected as the female parent and hybridized with Chinese cabbage mustard, and after 15 days of pollination, the seeds are selected for embryo rescue;
secondly, identifying true and false hybrids by using cytology and molecular marker hybrid progeny, and selecting true hybrids; taking the Zhongshuang 11 as a recurrent parent, taking a true hybrid obtained by distant hybridization as a female parent, and carrying out backcross; screening disease-resistant plants by using a molecular marker IP13-2 related to clubroot resistance in the Wen Ding Chun bud and a molecular marker KASP1 for resisting clubroot in cabbage mustard;
thirdly, carrying out background selection on the obtained disease-resistant plants by using 100 SSR markers distributed in the whole genome of the brassica napus, screening resistant individuals most similar to the genetic background of the Zhongshuang 11, continuing backcrossing with the Zhongshuang 11, repeating the breeding process of the BC 2 generation until BC 5 is reached, selfing the selected resistant plants to obtain BC 5F 1, inoculating the group by using P4 physiological race, screening the disease-resistant plants, and simultaneously detecting whether the segregation group has a resistance locus of the cabbage and the cabbage mustard by using molecular markers IP13-2 and KASP 1;
fourthly, selecting the obtained plants with resistance to Chinese cabbage and cabbage by using SSR marker background to obtain individuals with the highest similarity to the Chinese cabbage and cabbage 11, and continuously selfing until BC 5F 4; and (3) inoculating and identifying the BC 5F 4 seeds by using P4 and P7 physiological races respectively, and detecting resistance sites by using IP13-2 and KASP1 to finally obtain the cabbage type rape line with a plurality of resistance genes and resistance to a plurality of physiological races.
3. The method for synthesizing brassica napus resistant to clubroot disease by using pyramiding breeding and biotechnology according to claim 2, wherein the specific method of the first step embryo rescue is as follows: culturing immature seeds by using a B5 liquid culture medium containing 2% of sucrose, transferring the embryos onto a B5 solid culture medium containing 2% of sucrose when cotyledons grow after the young embryos appear, and transferring the embryos into soil at the 3-4 leaf stage.
4. Use of a method of polymerising and biotechnologically synthesising clubroot resistant brassica napus as claimed in any one of claims 1 to 3 in oilseed rape breeding.
CN201911285541.2A 2019-12-13 2019-12-13 Method for synthesizing clubroot-resistant brassica napus by using polymerization breeding and biotechnology Active CN110999779B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911285541.2A CN110999779B (en) 2019-12-13 2019-12-13 Method for synthesizing clubroot-resistant brassica napus by using polymerization breeding and biotechnology

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911285541.2A CN110999779B (en) 2019-12-13 2019-12-13 Method for synthesizing clubroot-resistant brassica napus by using polymerization breeding and biotechnology

Publications (2)

Publication Number Publication Date
CN110999779A CN110999779A (en) 2020-04-14
CN110999779B true CN110999779B (en) 2023-01-20

Family

ID=70114014

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911285541.2A Active CN110999779B (en) 2019-12-13 2019-12-13 Method for synthesizing clubroot-resistant brassica napus by using polymerization breeding and biotechnology

Country Status (1)

Country Link
CN (1) CN110999779B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114568294A (en) * 2022-01-25 2022-06-03 华中农业大学 Method for breeding clubroot-resistant variety based on brassica napus Ogu-CMS restorer line

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106035059A (en) * 2016-05-26 2016-10-26 西北农林科技大学 Method for artificially synthesizing novel anti-clubroot brassica napus material
CN110305980A (en) * 2019-07-23 2019-10-08 华中农业大学 A kind of selection of anti-clubroot high oleic acid rape and its application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0217406D0 (en) * 2002-07-26 2002-09-04 Syngenta Participations Ag Disease resistant brassicas

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106035059A (en) * 2016-05-26 2016-10-26 西北农林科技大学 Method for artificially synthesizing novel anti-clubroot brassica napus material
CN110305980A (en) * 2019-07-23 2019-10-08 华中农业大学 A kind of selection of anti-clubroot high oleic acid rape and its application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
人工合成白花甘蓝型油菜抗根肿病特性遗传研究;余青青;《中国优秀硕博学位论文全文数据库（硕士） 农业科技辑》;20090215;第D047-295页 *
抗根肿病甘蓝型油菜新种质放入创制及抗性评价;罗延青 等;《西南农业学报》;20190430;第32卷(第4期);第699-705页 *

Also Published As

Publication number Publication date
CN110999779A (en) 2020-04-14

Similar Documents

Publication Publication Date Title
Liu et al. Screening of clubroot-resistant varieties and transfer of clubroot resistance genes to Brassica napus using distant hybridization
CN102395678B (en) Major qtl of maize stalk rot resistance, molecular markers linked with the same and uses thereof
Zhou Improvement of plant waterlogging tolerance
CN111011131B (en) Breeding method combining rapid development technology, molecular marker technology and conventional breeding of wheat
US20190191645A1 (en) Method for cultivating perennial rice using asexual propagation characteristic of oryza longistaminata
CN109924120B (en) Method for improving rice blast resistance and bacterial leaf blight resistance of rice
CN110305980B (en) Breeding method and application of anti-clubroot high-oleic-acid rape
CN105794631A (en) Building method of durum wheat-elytrigia elongatum 7E scab-resistant alien-disomic line
CN104313155A (en) Floral character associated molecular marker screening method of amenone form chrysanthemum and application of method
CN110607382B (en) SNP molecular marker of single ring weight major gene from Xinluzao 24
CN110999779B (en) Method for synthesizing clubroot-resistant brassica napus by using polymerization breeding and biotechnology
CN113016603B (en) Molecular breeding method of primary high-quality long-grain broad-spectrum rice blast-resistant normal recovery line
CN111699969B (en) Breeding method of flooding-resistant rice
CN105483248A (en) Fiber strength related molecular mark from gossypium barbadense and application thereof
CN105734057B (en) With the SSR marker and its application of muskmelon downy mildew resistance main effect QTL linkage
CN105331689B (en) Wheat-elytrigia elongata powdery mildew resistant translocation line breeding method and molecular marker thereof
CN108901831B (en) Breeding method of indica rice restorer line with strong rice blast resistance and strong superiority
CN108048599B (en) Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application
CN111374041A (en) Method for selecting rice blast resistant rice material with molecular marker assistance
CN111073991A (en) Rice blast resistance gene Pi67(t), codominant molecular marker closely linked with same and application
CN113179947B (en) Breeding method of high-yield disease-resistant strong gluten wheat in middle and lower Yangtze river regions
CN105821135B (en) Molecular labeling and application with muskmelon downy mildew resistance gene close linkage
CN113273460B (en) Lodging-resistant conventional japonica rice breeding method
CN112889664B (en) Method for cultivating broad-spectrum and durable resistant rice breeding material by polymerizing complementary rice blast resistant genes
US10750701B2 (en) Vernalization independent lisianthus plants

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant