CN113462813B - Site linked with pear peel red character, molecular marker and application thereof - Google Patents
Site linked with pear peel red character, molecular marker and application thereof Download PDFInfo
- Publication number
- CN113462813B CN113462813B CN202110982710.9A CN202110982710A CN113462813B CN 113462813 B CN113462813 B CN 113462813B CN 202110982710 A CN202110982710 A CN 202110982710A CN 113462813 B CN113462813 B CN 113462813B
- Authority
- CN
- China
- Prior art keywords
- pear
- red
- sequence
- peel
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
- A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Botany (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Developmental Biology & Embryology (AREA)
- Environmental Sciences (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to a locus linked with a pear peel red character, a molecular marker and application thereof. The nucleotide sequence of the site includes the nucleotide sequence of the site located at base 26394198 of Chr5 of the 'medium short No. 1' pear reference genome, GeneBank accession No.: SMOL 00000000. The nucleotide sequence of this site was AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG or A. The locus and the molecular marker developed based on the locus can be used for pear peel red/green character auxiliary selective breeding, green peel single plants are quickly eliminated in the seedling stage of hybrid seedlings, the maintenance and identification and evaluation costs of subsequent hybrid seedlings are saved, and the red peel pear breeding efficiency is remarkably improved.
Description
Technical Field
The invention belongs to the field of pear molecular genetic breeding, and particularly relates to a locus linked with a pear peel red character, a molecular marker and application thereof.
Background
The pear (Pyrus L.) is an important Rosaceae (Rosaceae) fruit tree, is one of three fruits in China, and shows that the cultivation area of the pear in 2019 in China is 95 ten thousand hectares and the yield is 1700 ten thousand tons according to the data of a food and agriculture organization statistical database (FAOSTAT) in the United nations, which respectively accounts for 69 percent and 71 percent of the total yield and the area in the world and occupies an important position in the fruit tree industry. In recent years, red pears are more and more favored by consumers due to their attractive appearance and rich nutritional value. However, in actual production, a few red pears can be cultivated in China, and particularly, the pear varieties mainly cultivated in China are oriental pears and lack red varieties with excellent quality and stable coloring, so that the red-peel pears are always important breeding targets of pear breeding workers in China and even all over the world.
At present, crossbreeding is the most common breeding mode in pear breeding. As the pears are perennial fruit trees, the trait inheritance mechanism is complex, the optimization rate of hybrid progeny is low, the seedlings usually need to spend 3-5 years or even longer in the juvenile period to blossom and bear fruits, a large amount of land, manpower and material resource costs are needed in the breeding process, and the breeding cost is high.
The important premise of applying the molecular marker assisted selective breeding technology to pear breeding is to develop molecular markers closely linked with important characters of pears. The red pericarp is taken as an important appearance quality character of the pear fruit, and related molecular markers are developed and applied, but the character genetic mechanism is complex, the formation mechanism of the red character of different red pear varieties is different, and the existing molecular markers have the problem of low accuracy, so that more extensive and effective marker sites need to be developed to be applied to pear breeding work. Meanwhile, most of the markers developed by the predecessors need to adopt a fluorescent quantitative PCR or common PRC (polymerase chain reaction) polyacrylamide gel electrophoresis mode to distinguish the phenotypes of different samples to be tested, and the markers have the defects of high cost, complicated experimental procedures and the like. Therefore, the development of molecular markers which can successfully distinguish the phenotypes of different samples by using common PCR and agarose gel electrophoresis can greatly reduce the experiment cost and improve the breeding efficiency.
Disclosure of Invention
In view of the problems in the prior art, the invention provides the locus and the molecular marker linked with the red character of the pear peel and the application thereof, the locus and the molecular marker can be used for the auxiliary selective breeding of the red/green character of the pear peel, the single green peel plant is quickly eliminated in the seedling stage of the hybrid seedling, the maintenance, identification and evaluation costs of the subsequent hybrid seedling are saved, the breeding efficiency of the red peel pear is obviously improved, and the method has the advantage of high accuracy.
The technical scheme for solving the technical problems is as follows:
a site linked to the rind red trait, the nucleotide sequence of the site comprising a nucleotide sequence of a site located at 26394198 bases of Chr5 of the 'medium short No. 1' pear reference genome, GeneBank accession No.: SMOL 00000000.
The invention has the beneficial effects that: the mark can be used for pear peel red/green character auxiliary selective breeding, green peel single plants are quickly eliminated in the seedling stage of hybrid seedlings, the subsequent hybrid seedling maintenance and identification and evaluation cost is saved, the red peel pear breeding efficiency is obviously improved, and the method has the advantages of high accuracy and the like.
Further, the nucleotide sequence at nucleotide position was AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG or A.
The invention provides application of the locus in pear peel red/green character auxiliary selective breeding.
The invention has the beneficial effects that: based on the loci, a marker primer and the like can be developed, the method can be used for pear peel red/green character auxiliary selective breeding, green peel single plants are quickly eliminated in the seedling stage of hybrid seedlings, the subsequent hybrid seedling maintenance and identification and evaluation cost is saved, the red peel pear breeding efficiency is obviously improved, and the method has the advantages of high accuracy and the like.
The invention provides a molecular marker linked with the red character of pear peel, and the locus is positioned in the amplified product of the molecular marker.
Further, the upstream primer sequence of the molecular marker comprises a sequence shown by SEQ ID NO. 1, and the downstream primer sequence of the molecular marker comprises a sequence shown by SEQ ID NO. 2.
Preferably, the sequence of the upstream primer of the molecular marker is the sequence shown in SEQ ID NO. 1, and the sequence of the downstream primer of the molecular marker is the sequence shown in SEQ ID NO. 2.
The invention also provides application of the molecular marker in pear peel red/green character auxiliary selective breeding.
The invention provides a primer for amplifying the molecular marker.
Further, the primer includes a sequence shown by SEQ ID NO. 1 and/or a sequence shown by SEQ ID NO. 2. Preferably, the upstream primer is a sequence shown in SEQ ID NO. 1, and the downstream primer is a sequence shown in SEQ ID NO. 2.
The beneficial effects of adopting the above technical scheme are as follows: by adopting the primers, the pear peel red/green character auxiliary selective breeding can be realized, a green peel single plant is quickly eliminated in the seedling stage of hybrid seedlings, the subsequent hybrid seedling maintenance and identification and evaluation cost is saved, the red peel pear breeding efficiency is obviously improved, and the like.
The invention provides application of the primer in pear peel red/green character auxiliary selective breeding.
The invention provides a pear peel color auxiliary selective breeding kit, which comprises the primers.
Adopt above-mentioned technical scheme's beneficial effect: by adopting the kit, the auxiliary selective breeding of the pear peel red/green character can be realized, the green peel single plant is quickly eliminated in the seedling stage of the hybrid seedling, the subsequent maintenance and identification and evaluation cost of the hybrid seedling is saved, the red peel pear breeding efficiency is obviously improved, and the like.
Further, the kit further comprises: one or more of enzyme, deionized water, positive control and negative control are used for PCR amplification.
The invention provides application of the kit in pear peel red/green character auxiliary selective breeding.
The invention provides a method for auxiliary selective breeding of pear peel red/green characters, which comprises the following steps: and extracting DNA of the hybrid seedling to be selected and bred, and carrying out PCR amplification by adopting the primer.
Further, the method comprises the following steps: extracting DNA of hybrid seedlings to be selected and bred, and carrying out PCR amplification by adopting a primer pair, wherein the primer pair comprises a sequence shown by SEQ ID NO. 1 and a sequence shown by SEQ ID NO. 2.
Adopt above-mentioned technical scheme's beneficial effect: the method of PCR amplification combined with agarose electrophoresis is adopted, the experiment operation is simple, different sample phenotypes can be successfully distinguished without complex and expensive instruments, the experiment cost is greatly reduced, and the breeding efficiency is improved. The primer has the advantage of high accuracy, can realize the auxiliary selective breeding of the pear peel red/green character, quickly eliminates the green peel single plant in the seedling stage of the hybrid seedling, saves the subsequent maintenance and identification and evaluation cost of the hybrid seedling, and obviously improves the breeding efficiency of the red peel pear.
Further, the reaction conditions for PCR amplification include: 3min at 94 ℃; at 95 ℃ for 10s, at 56 ℃ for 30s, at 72 ℃ for 30s, for 35 cycles; 5min at 72 ℃.
Adopt above-mentioned technical scheme's beneficial effect: the amplification conditions are favorable for obtaining clear and definite banding, and the analysis and judgment of the result are favorable.
Further, the hybrid seedling is an 'apple pear' x 'August' hybrid seedling.
Adopt above-mentioned technical scheme's beneficial effect: 'August' is a new early-maturing crisp flesh red pear variety bred by 'Zaoba pear' x 'early crisp' hybridization, the fruit flavor is sweet and sour, the peel is easily red in large area and is deeply loved by consumers and breeders, and the new early-maturing crisp flesh red pear variety is one of excellent parents for breeding the new red skin pear variety.
The invention provides a locus combination linked with the red character of pear pericarp, which comprises a locus 1, wherein the locus 1 is the same as the locus.
Further, a locus combination linked with the pear peel red character comprises a locus 1 and a locus 2, wherein the locus 1 is the same as the locus; the nucleotide sequence at position 2 includes the nucleotide sequence at the position 26306039 bases of Chr5 of the 'medium short No. 1' pear reference genome, GeneBank accession No.: SMOL00000000, and the base sequence at the base is T or TAACAAATTTTACTACCAAAGGATTCCATTTTAGC.
Adopt the beneficial effect of above-mentioned scheme: the combined use of the locus combination can be applied to the pear peel red character auxiliary selective breeding, and the accuracy rate and breeding efficiency of selection are further improved.
The invention provides a molecular marker combination linked with the red character of pear peel, which comprises a B717-Del2 molecular marker and a B717-In1 molecular marker, wherein the site 1 is positioned inside an amplification product of the B717-Del2 molecular marker, and the site 2 is positioned inside an amplification product of the B717-In1 molecular marker.
Further, the upstream primer sequence for amplifying the B717-Del2 molecular marker comprises a sequence shown as SEQ ID NO. 1, and the downstream primer sequence for amplifying the B717-Del2 molecular marker comprises a sequence shown as SEQ ID NO. 2; the upstream primer sequence for amplifying the B717-In1 molecular marker comprises a sequence shown In SEQ ID NO. 4, and the downstream primer sequence for amplifying the B717-In1 molecular marker comprises a sequence shown In SEQ ID NO. 5.
Preferably, the sequence of the upstream primer for amplifying the B717-Del2 molecular marker is the sequence shown in SEQ ID NO. 1, and the sequence of the downstream primer for amplifying the B717-Del2 molecular marker is the sequence shown in SEQ ID NO. 2; the sequence of the upstream primer for amplifying the B717-In1 molecular marker is shown as SEQ ID NO. 4, and the sequence of the downstream primer for amplifying the B717-In1 molecular marker is shown as SEQ ID NO. 5.
The beneficial effect who adopts the above scheme: the molecular marker combination can be applied to pear peel red character auxiliary selective breeding, and the selection accuracy and breeding efficiency are further improved.
The invention provides a primer combination for amplifying the molecular marker combination.
Further, the primer combination comprises a primer pair 1 and a primer pair 2; the upstream primer sequence of the primer pair 1 comprises a sequence shown as SEQ ID NO. 1, and the downstream primer sequence of the primer pair 1 comprises a sequence shown as SEQ ID NO. 2; the upstream primer sequence of the primer pair 2 comprises a sequence shown by SEQ ID NO. 4, and the downstream primer sequence of the primer pair 2 comprises a sequence shown by SEQ ID NO. 5.
Preferably, the sequence of the upstream primer of the primer pair 1 is shown as SEQ ID NO. 1, and the sequence of the downstream primer of the primer pair 1 is shown as SEQ ID NO. 2; the sequence of the upstream primer of the primer pair 2 is shown as SEQ ID NO. 4, and the sequence of the downstream primer of the primer pair 2 is shown as SEQ ID NO. 5.
The beneficial effect who adopts the above scheme: the primer combination can be applied to pear peel red character auxiliary selective breeding by adopting combined use, and the accuracy rate of selection and the breeding efficiency are further improved.
The invention provides a pear peel color auxiliary selective breeding kit, which comprises the primer combination.
Further, the kit also comprises one or a combination of more of an enzyme for PCR amplification, deionized water, a positive control and a negative control.
The beneficial effect of adopting the above scheme is as follows: the kit can be applied to pear peel red character auxiliary selective breeding, and the accuracy rate of selection and the breeding efficiency are further improved.
The invention provides application of the locus combination, the molecular marker combination, the primer combination and/or the kit in pear peel red/green character auxiliary selective breeding.
The invention provides a method for auxiliary selective breeding of pear peel red/green characters, which comprises the following steps: and extracting DNA of the hybrid seedling to be selected and bred, and performing PCR amplification by adopting the primer combination.
The beneficial effect who adopts the above scheme: the method can be applied to the pear peel red character auxiliary selective breeding, and the accuracy rate of selection and the breeding efficiency are further improved.
Further, the method comprises the following steps: extracting DNA of hybrid seedlings to be selected and bred, and respectively carrying out PCR amplification by adopting a primer pair 1 and a primer pair 2, wherein the primer pair 1 comprises a sequence shown by SEQ ID NO. 1 and a sequence shown by SEQ ID NO. 2, and the primer pair 2 comprises a sequence shown by SEQ ID NO. 4 and a sequence shown by SEQ ID NO. 5.
Adopt above-mentioned technical scheme's beneficial effect: the primer pair has the advantage of high accuracy, can realize the auxiliary selective breeding of the pear peel red/green character, quickly eliminates the green peel single plant in the seedling stage of the hybrid seedling, saves the subsequent maintenance and identification and evaluation cost of the hybrid seedling, and obviously improves the breeding efficiency of the red peel pear.
Further, the reaction conditions for PCR amplification include: 3min at 94 ℃; at 95 ℃ for 10s, at 56 ℃ for 30s, at 72 ℃ for 30s, for 35 cycles; 5min at 72 ℃.
Adopt above-mentioned technical scheme's beneficial effect: the amplification conditions are favorable for obtaining clear and definite banding, and the analysis and judgment of the result are favorable.
Further, the hybrid seedling is an 'apple pear' x 'August' hybrid seedling.
Adopt above-mentioned technical scheme's beneficial effect: 'August' is a new early-maturing crisp flesh red pear variety bred by 'Zaoba pear' x 'early crisp' hybridization, the fruit flavor is sweet and sour, the peel is easily red in large area and is deeply loved by consumers and breeders, and the new early-maturing crisp flesh red pear variety is one of excellent parents for breeding the new red skin pear variety.
Drawings
FIG. 1 shows the mapping of the red pericarp trait in the genome in a complex interval mapping method, with the ordinate representing the LOD value, the abscissa representing the distribution of mapping blocks on the chromosome, and the gray horizontal line representing the LOD threshold corresponding to 0.99 confidence level when tested 1000 times with PT (7.916).
FIG. 2 is a band diagram of B717-Del2 SCAR markers in red-peel pear and green-peel pear, wherein 1, 3, 4 and 5 are green-peel pear bands, 2, 6, 7 and 8 are red-peel pear bands, and M is Marker.
FIG. 3 is a graph showing the results of amplification of B717-Del2 SCAR marker in progeny of the ` apple pear ` X ` August ` hybrid combination 150; and M is Marker.
FIG. 4 is a band diagram of B717-In1 SCAR markers In red-peel pear and green-peel pear, 1 is green-peel pear band type, 2 is red-peel pear band type, and M is Marker.
Detailed Description
The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.
The invention provides an InDel locus linked with a pear peel red character, a molecular marker based on the locus and application of the molecular marker.
The InDel site linked with the rind red character of the pear peel is positioned at 26394198 bases of Chr5 of a 'Zhongdwarf No. 1' pear reference genome (GeneBank accession number: SMOL00000000), the base sequence of the InDel site is 5'-AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG-3' as shown in SEQ ID NO:3, and the variant sequence is A.
The variation range of the variation site is larger, and the phase difference is 63bp, so that the amplified fragments can be easily distinguished through simple agarose electrophoresis. The locus is located in the region near the LOD peak in the chromosome localization result of the red skin trait (as shown in figure 1), and the obtained region closely linked with the red trait, the closer the region is to the peak, the more reliable the linkage relationship is, and the more accurate the selected marker is.
The invention provides an SCAR molecular marker developed based on the InDel site, which is marked as B717-Del2, wherein the InDel site is positioned inside an amplification product of the SCAR molecular marker.
The B717-Del2 SCAR molecular marker disclosed by the invention is applied to pear peel red character auxiliary selective breeding. The 2 fragments amplified by the marker have larger length difference and are easy to distinguish.
The primer pair of the B717-Del2 SCAR molecular marker is as follows:
upstream primer (forward primer) sequence: 5'-TCCTCCTTGGACTCTCTGTGG-3', as shown in SEQ ID NO: 1;
downstream primer (reverse primer) sequence: 5'-CGCAGAACCATATCAGCAAAA-3', as shown in SEQ ID NO: 2.
The primer pair is applied to pear peel red character breeding. The 2 fragments amplified by the marker have larger length difference and are easy to distinguish.
The molecular marker is used for identifying the 'apple pear' x 'August red' hybrid combination group, the SCAR marker can select the single plant with red peel in the test group, the selection efficiency is 98.85%, the SCAR marker can be applied to early selection of red-peel pear breeding, the efficiency of red-peel pear breeding can be obviously improved, and the application prospect is good.
The invention provides an InDel locus combination linked with the red character of pear peel, which comprises a locus 1 and a locus 2. Site 1 and site 2 can be used in combination for selection of individuals with red pericarp in the test population.
The description for site 1 is the same as for the above-mentioned site. That is, site 1 is located at 26394198 bases of Chr5 of the 'Zhongkui No. 1' pear reference genome (GeneBank accession number: SMOL00000000), and the base sequence at this site is 5'-AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG-3' and the variant sequence is A as shown in SEQ ID NO: 3.
The variation range of the two variation sites is larger, so that the amplified fragments can be easily distinguished by simple agarose electrophoresis. Both loci are located in the region near the LOD peak in the chromosome localization result of the red skin trait (as shown in FIG. 1), and the obtained region closely linked with the red trait, the closer the region is to the peak, the more reliable the linkage relationship is, and the more accurate the selected marker is. The screening accuracy and the screening efficiency of the red-peel pear breeding can be further improved by the combined use of the two sites.
The invention provides SCAR molecular marker combinations developed based on the InDel sites, which are marked as B717-Del2 and B717-In1, wherein the InDel sites are respectively positioned inside the amplification products of the SCAR molecular marker combinations, namely, the site 1 is positioned inside the B717-Del2 molecular marker amplification products, and the site 2 is positioned inside the B717-In1 molecular marker amplification products. The molecular marker combination can be applied to pear peel red character auxiliary selective breeding, and the selection accuracy and breeding efficiency are further improved.
The invention provides a primer combination for amplifying the molecular marker. The primer combination comprises a primer pair 1 and a primer pair 2;
the primer pair 1 of the B717-Del2 SCAR molecular marker of the invention is as follows:
upstream primer (forward primer) sequence: 5'-TCCTCCTTGGACTCTCTGTGG-3', as shown in SEQ ID NO: 1;
downstream primer (reverse primer) sequence: 5'-CGCAGAACCATATCAGCAAAA-3', as shown in SEQ ID NO: 2.
The primer pair 2 of the B717-In1 SCAR molecular marker of the invention is as follows:
upstream primer (forward primer) sequence: 5'-AAGCAGCAAAAACTGAGTCACT-3', as shown in SEQ ID NO. 4;
downstream primer (reverse primer) sequence: 5'-TGCCTTTACAGTCCCATTTG-3', as shown in SEQ ID NO: 5.
The primer pair can be applied to pear peel red character breeding. The difference of the lengths of 2 fragments amplified by adopting the primer pair is large, and the fragments are easy to distinguish. The primer pair can be applied to pear peel red character auxiliary selective breeding by combined use, and the selection accuracy and breeding efficiency are further improved.
SCAR marker primer sequence
Performing PCR amplification on the primer pair 1, and if the band is a double band of 196bp and 133bp, indicating that the single red-skin plant is obtained; if the band is 196bp single band, it is indicated as green skin single strain.
Performing PCR amplification on the 2 by using a primer pair, and if the band is a 138bp and 172bp double band, indicating that the single red-skin plant is obtained; if the band shape is 138bp single band, the green skin single strain is indicated.
When the primer pair 1 and the primer pair 2 are respectively used for PCR amplification, if the amplification result of any one marked primer pair indicates that the single plant is a red skin single plant, the single plant can be preliminarily considered to be red phenotype. Otherwise, the individual can be initially identified as green phenotype.
The molecular marker combination is used for identifying the 'apple pear' x 'August red' hybrid combination group, the SCAR marker can select individual plants with red pericarp in a test group, the selection efficiency is 100%, the molecular marker can be applied to early selection of red-peel pear breeding, the efficiency of red-peel pear breeding can be obviously improved, and the application prospect is good.
Further description is provided below by way of specific examples.
Example 1
The B717-Del2 molecular marker primer pair is used for identifying the red character of pear peel as follows.
1. Collecting 'apple pear' x 'August red' hybrid combination 150 single young leaves of young sprout, respectively extracting DNA.
2. The extracted DNA was PCR-amplified using the B717-Del2 molecular marker primer set, and 20. mu.L of the reaction system was used for PCR amplification, the composition and PCR reaction program of the reaction system are shown in tables 1 and 2, and the molecular marker primer set for amplification is shown in Table 3. 2 XTaq PCR Mix (containing dye) was derived from Ready-to-use PCR kit 3.0(CAT #:90805-10) produced by Beijing Tianenzze Gene technology Co., Ltd, and the primer sequence was synthesized by Zhongmeitai and Biotechnology (Beijing) Co., Ltd.
TABLE 1 PCR reaction System
TABLE 2 PCR reaction procedure
TABLE 3 SCAR marker primer sequences
3. Performing 3% agarose gel electrophoresis on the PCR product, performing band statistics on the electrophoresis result, marking the band types of the red-skin and green-skin single plants as shown in figure 2, and indicating the red-skin single plants if the band types are double bands of 196bp and 133 bp; if the band is 196bp single band, it is indicated as green skin single strain.
4. Selecting 150 single plants with the results of the tested hybridization combinations, wherein the red phenotype is 87 plants and the green phenotype is 63 plants according to the color condition of the pericarp.
The method is adopted to carry out PCR amplification on DNA of 150 single plants with results by primer pair hybridization combination, 89 red-peel single plants are obtained according to the PCR amplification result (wherein 3 plants are green phenotype and 86 plants are red phenotype according to the fruit peel color condition), and 96.63% (86/89) of the PCR amplification result of the red-peel single plants is consistent with the red phenotype; there were 61 green individuals according to the PCR amplification (of which 1 was red phenotype and 60 was green phenotype according to the pericarp color). The results show that 98.85% of the red phenotypes of the combinations can be identified by using the markers (according to the fruit peel color, 87 red phenotypes are shown in the amplification results, and 86 red phenotypes are shown in the amplification results), the electrophoresis results are shown in FIG. 3, samples No. 1-150 are respectively arranged from left to right and from top to bottom, and the data of amplification of the primer sequences marked by B717-Del2 are shown in Table 4.
TABLE 4
By utilizing the steps, the green rind single plant can be quickly eliminated in the seedling stage of the hybrid seedling, the subsequent maintenance and identification and evaluation cost of the hybrid seedling is saved, and the breeding efficiency of the red rind pear is obviously improved.
Example 2
The red character of pear peel is identified by combining the primer 1 pair labeled by the B717-Del2 molecule and the primer 2 labeled by the B717-In1 molecule, and the method is as follows.
1. PCR amplification was performed on 150 individuals of the ` apple pear ` X ` August red ` hybridization combination using primer 1 labeled with B717-Del2, and the method, the sample number order, the judgment criteria, and the like were the same as in example 1.
2. PCR amplification is carried out on 150 single strains of the 'apple pear' × 'August red' hybridization combination by using a B717-In1 molecular labeled primer 2 (the sequence number of a sample is the same as that of the sample In the example 1), and the upstream primer sequence 5'-AAGCAGCAAAAACTGAGTCACT-3' of the primer pair 2 is shown as SEQ ID NO. 4; the downstream primer sequence 5'-TGCCTTTACAGTCCCATTTG-3' of primer pair 2 is shown as SEQ ID NO. 5.
The reaction system and amplification method using PCR amplification were the same as in example 1. As shown in FIG. 4, the band of 138bp and 172bp indicates a red skin single strain, and the band of 138bp indicates a green skin single strain (since the electrophoretic patterns of all samples No. 1-150 are not shown due to limited space).
3. The results of PCR amplification using the B717-Del2 molecular labeled primer pair 1 and the B717-In1 molecular labeled primer pair 2 are shown In Table 5.
TABLE 5
Judging standard, if the amplification result of any one of the labeled primer pairs shows that the individual is a red skin individual, the individual can be preliminarily considered to be red phenotype.
Selecting 150 single plants with the results of the tested hybridization combinations, wherein the red phenotype is 87 plants and the green phenotype is 63 plants according to the color condition of the pericarp.
The red character of the pear peel is identified by jointly using the primer 1 pair marked by the B717-Del2 molecule and the primer 2 pair marked by the B717-In1 molecule, and 90 red-peel individuals are obtained according to the PCR amplification result (wherein 3 individuals are green phenotypes and 87 individuals are red phenotypes according to the fruit peel color condition), and 96.67% (87/90) of the PCR amplification result of the red-peel individuals is consistent with the red phenotype; according to the PCR amplification result, 60 green individuals exist (wherein, the 60 individuals are green phenotypes according to the color of the pericarp). The results show that the 87 red phenotypes in the combination can be completely identified by using the marker combination. Therefore, it can be seen that the identification of the rind red trait by the combination of two markers allows the identification of a 100% red phenotype for the combination.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> research institute of fruit trees of Chinese academy of agricultural sciences
<120> site linked with pear peel red character, molecular marker and application thereof
<130> HF21A1062
<141> 2021-08-25
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tcctccttgg actctctgtg g 21
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cgcagaacca tatcagcaaa a 21
<210> 3
<211> 64
<212> DNA
<213> Pear (pear)
<400> 3
aaagcctagt gcaccttttt taaatctgtt tctatttcag tatctttgtt atgctggaaa 60
atgg 64
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aagcagcaaa aactgagtca ct 22
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 35
<212> DNA
<213> Pear (pear)
<400> 6
taacaaattt tactaccaaa ggattccatt ttagc 35
Claims (3)
1. The application of the primer in pear peel red/green character auxiliary selective breeding; the method is characterized in that the primer is used for amplifying a molecular marker, and the sequence of the primer comprises a sequence shown as SEQ ID NO. 1 and a sequence shown as SEQ ID NO. 2; the site linked with the pear peel red character is positioned inside the molecular marker amplification product; the nucleotide sequence of the site includes the nucleotide sequence of the site located at 26394198 bases of Chr5 of the reference genome of short No. 1 of the 'medium' pear, the base sequence at base is AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG or a, GeneBank accession No.: SMOL 00000000; the product obtained after PCR amplification by using the primers is indicated as a red skin single plant if the band is a double band of 196bp and 133bp, and indicated as a green skin single plant if the band is a single band of 196 bp.
2. The application of the pear peel color auxiliary selective breeding kit in pear peel red/green character auxiliary selective breeding; the kit is characterized in that the pear peel color auxiliary selective breeding kit comprises primers; the primer is used for amplifying a molecular marker, and the sequence of the primer comprises a sequence shown as SEQ ID NO. 1 and a sequence shown as SEQ ID NO. 2; the site linked with the pear peel red character is positioned inside the molecular marker amplification product; the nucleotide sequence of the site includes the nucleotide sequence of the site located at 26394198 bases of Chr5 of the reference genome of short No. 1 of the 'medium' pear, the base sequence at base is AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG or a, GeneBank accession No.: SMOL 00000000; the product obtained after PCR amplification by using the primers is indicated as a red skin single plant if the band is a double band of 196bp and 133bp, and indicated as a green skin single plant if the band is a single band of 196 bp.
3. A method for auxiliary selective breeding of pear peel red/green characters is characterized by comprising the following steps: extracting DNA of hybrid seedlings to be selected and bred, and performing PCR amplification by using primers; the primer is used for amplifying a molecular marker, and the sequence of the primer comprises a sequence shown as SEQ ID NO. 1 and a sequence shown as SEQ ID NO. 2; the site linked with the pear peel red character is positioned inside the molecular marker amplification product; the nucleotide sequence of the site includes the nucleotide sequence of the site located at 26394198 bases of Chr5 of the reference genome of short No. 1 of the 'medium' pear, the base sequence at base is AAAGCCTAGTGCACCTTTTTTAAATCTGTTTCTATTTCAGTATCTTTGTTATGCTGGAAAATGG or a, GeneBank accession No.: SMOL 00000000; the PCR amplified product is indicated as a red skin single plant if the band is 196bp and 133bp double bands, and is indicated as a green skin single plant if the band is 196bp single band.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110982710.9A CN113462813B (en) | 2021-08-25 | 2021-08-25 | Site linked with pear peel red character, molecular marker and application thereof |
| CN202210384032.0A CN114517242A (en) | 2021-08-25 | 2021-08-25 | Primer combination for amplifying molecular marker linked with pear peel red character |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110982710.9A CN113462813B (en) | 2021-08-25 | 2021-08-25 | Site linked with pear peel red character, molecular marker and application thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210384032.0A Division CN114517242A (en) | 2021-08-25 | 2021-08-25 | Primer combination for amplifying molecular marker linked with pear peel red character |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113462813A CN113462813A (en) | 2021-10-01 |
| CN113462813B true CN113462813B (en) | 2022-05-06 |
Family
ID=77867956
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110982710.9A Active CN113462813B (en) | 2021-08-25 | 2021-08-25 | Site linked with pear peel red character, molecular marker and application thereof |
| CN202210384032.0A Pending CN114517242A (en) | 2021-08-25 | 2021-08-25 | Primer combination for amplifying molecular marker linked with pear peel red character |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210384032.0A Pending CN114517242A (en) | 2021-08-25 | 2021-08-25 | Primer combination for amplifying molecular marker linked with pear peel red character |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN113462813B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115011723B (en) * | 2022-06-14 | 2022-12-09 | 中国农业科学院果树研究所 | Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506151A (en) * | 2016-01-29 | 2016-04-20 | 中国农业科学院郑州果树研究所 | Molecular marker locus linked with pear peel color character and application thereof |
| CN105543383A (en) * | 2016-01-29 | 2016-05-04 | 中国农业科学院郑州果树研究所 | InDel site interlocked with red-peel/green-peel properties of pears as well as molecular marker based on site and application of molecular marker |
-
2021
- 2021-08-25 CN CN202110982710.9A patent/CN113462813B/en active Active
- 2021-08-25 CN CN202210384032.0A patent/CN114517242A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105506151A (en) * | 2016-01-29 | 2016-04-20 | 中国农业科学院郑州果树研究所 | Molecular marker locus linked with pear peel color character and application thereof |
| CN105543383A (en) * | 2016-01-29 | 2016-05-04 | 中国农业科学院郑州果树研究所 | InDel site interlocked with red-peel/green-peel properties of pears as well as molecular marker based on site and application of molecular marker |
Non-Patent Citations (1)
| Title |
|---|
| Accession NO: SMOL01000004.1 Pyrus ussuriensis x Pyrus communis cultivar Zhongai 1 isolate S2 chromosome 5, whole genome shotgun sequence;Wang F等;《genbank》;20191009;第1页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113462813A (en) | 2021-10-01 |
| CN114517242A (en) | 2022-05-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106755481B (en) | SSR molecular marker VI for identifying progeny plants of Gala apples and application thereof | |
| CN109762921B (en) | SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof | |
| CN109207622B (en) | Molecular marker linked with capsicum green-staying gene and application thereof | |
| CN105543222B (en) | The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application | |
| CN113462813B (en) | Site linked with pear peel red character, molecular marker and application thereof | |
| CN113481320B (en) | Site linked with pear peel red character, molecular marker and application thereof | |
| CN110804675B (en) | Microsatellite DNA marker fingerprint spectrum of non-heading Chinese cabbage and application thereof | |
| CN102599047A (en) | Method by adopting molecular marker-assisted backcross to improve gibberellic disease expansion resistance of wheat | |
| CN108977573B (en) | Method for identifying purity of seven-star radish hybrid by using SSR molecular marker | |
| Andarini et al. | Genetic relationship of pigmented rice (Oryza sativa L.) collected from Eastern Indonesia based on morpho-agronomical traits and SSR markers | |
| CN104762298B (en) | A kind of rice seedling resistant gene of salt qST11 and its molecule labelling method | |
| CN108048599B (en) | Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application | |
| CN107338246B (en) | Specific sequence of tomato fruit dry juice character and its molecular marker and identification method | |
| CN106434906B (en) | A kind of and cauliflower bouquet hair floral formation chain SNP site and its detection method and primer sets | |
| CN115011723B (en) | Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding | |
| CN111004857B (en) | Molecular marker primer of soybean branch number major QTL locus and application thereof | |
| CN107988416B (en) | Molecular identification method and primer for identifying Suzhou cyan | |
| CN109628636B (en) | SSR molecular marker for identifying hybrid of Xinjiang grape and Kyoho grape and application thereof | |
| CN114525361B (en) | cDNA molecular marker for distinguishing purple skin and yellow skin onion and application thereof | |
| CN114634991B (en) | InDel marker for identifying high-variety coconuts and application thereof | |
| CN115838790B (en) | Molecular marker for sex identification of actinidia arguta and application of specific primer pair M4 | |
| CN118291666B (en) | Breeding method of low gelatinization temperature, silk seedling type aromatic rice variety | |
| CN116694811B (en) | Molecular marker closely linked with wheat seedling stage seed root number QTL and application thereof | |
| CN114990251B (en) | Molecular marker closely linked with rape methylselenocysteine content trait QTL and application thereof | |
| CN116334269B (en) | Molecular marker for sex identification of actinidia arguta and specific primer pair M3 thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |