CN115011723B - Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding - Google Patents

Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding Download PDF

Info

Publication number
CN115011723B
CN115011723B CN202210685255.0A CN202210685255A CN115011723B CN 115011723 B CN115011723 B CN 115011723B CN 202210685255 A CN202210685255 A CN 202210685255A CN 115011723 B CN115011723 B CN 115011723B
Authority
CN
China
Prior art keywords
red
pear
peel
character
molecular marker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210685255.0A
Other languages
Chinese (zh)
Other versions
CN115011723A (en
Inventor
欧春青
姜淑苓
王斐
张艳杰
马力
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Fruit Tree Institute of CAAS
Original Assignee
Fruit Tree Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fruit Tree Institute of CAAS filed Critical Fruit Tree Institute of CAAS
Priority to CN202211449874.6A priority Critical patent/CN115820913B/en
Priority to CN202210685255.0A priority patent/CN115011723B/en
Publication of CN115011723A publication Critical patent/CN115011723A/en
Application granted granted Critical
Publication of CN115011723B publication Critical patent/CN115011723B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
    • Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
    • Y02P60/87—Re-use of by-products of food processing for fodder production

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Botany (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Mycology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention relates to a locus linked with a pear peel red character, a molecular marker and application thereof. The nucleotide sequence of the site includes the nucleotide sequence of the site located at base 26527817 of Chr5 of the 'medium short No. 1' pear reference genome, geneBank accession No.: SMOL00000000. The base sequence of the site is ATAACTAGCAAAAATAAGACACGAAATGTTAAATACT or A. The locus and the molecular marker developed based on the locus can be used for pear peel red/green character auxiliary selective breeding, green peel single plants are quickly eliminated in the seedling stage of hybrid seedlings, the subsequent hybrid seedling maintenance and identification evaluation cost is saved, the red peel pear breeding efficiency is obviously improved, and the method has the advantages of wide applicable varieties, high red plant detection rate, low error rate, high phenotype and banding pattern consistency rate and the like.

Description

Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding
Technical Field
The invention belongs to the field of pear molecular genetic breeding, and particularly relates to a locus linked with a pear peel red character, a molecular marker and application thereof.
Background
The pear (Pyrus L.) is an important Rosaceae (Rosaceae) fruit tree, is one of three fruits in China, and shows that the cultivation area of the pear in China is 87 ten thousand hectares and the yield is 1610 ten thousand tons in 2020 according to the data of a food and agriculture organization statistical database (FAOSTAT) in the United nations, which respectively accounts for 67 percent and 70 percent of the total area and the yield in the world, and plays an important role in the fruit tree industry. In recent years, red pears are more and more favored by consumers due to their attractive appearance and rich nutritional value. However, in actual production, a few red pears can be cultivated in China, and particularly, the pear varieties mainly cultivated in China are oriental pears and lack red varieties with excellent quality and stable coloring, so that red-peel pears are always important breeding targets of pear breeders in China and even all over the world.
At present, crossbreeding is the most common breeding mode in pear breeding. As the pears are perennial fruit trees, the trait inheritance mechanism is complex, the optimization rate of hybrid progeny is low, the seedlings usually need to spend 3-5 years or even longer in the juvenile period to blossom and bear fruits, a large amount of land, manpower and material resources are needed in the breeding process, and the breeding cost is high.
The markers developed by the former people mostly need to adopt a fluorescent quantitative PCR or common PCR plus polyacrylamide gel electrophoresis mode to distinguish the phenotypes of different samples to be tested, and the markers have the defects of high cost, complicated experimental procedures and the like. Therefore, the development of molecular markers which can successfully distinguish the phenotypes of different samples by using common PCR and agarose gel electrophoresis can greatly reduce the experiment cost and improve the breeding efficiency.
The important premise of applying the molecular marker assisted selective breeding technology to pear breeding is to develop molecular markers closely linked with important characters of pears. The red peel is taken as an important appearance quality character of the pear fruit, the character inheritance mechanism is complex, the formation mechanism of the red character of different red pear varieties is different, the existing molecular marker has the problem of low accuracy, and a wider and effective marker locus needs to be developed to be applied to pear breeding work.
Many sites exist in the chromosome of pear, but not all the sites are suitable for being used as molecular markers, and not all the molecular markers can be used for auxiliary selection of red/green characters of pear peel, so that the technical difficulty to be solved urgently is how to screen out the suitable molecular markers, and the accuracy and the screening efficiency can be further improved, and the error rate can be reduced.
Disclosure of Invention
In view of the problems in the prior art, the invention provides the locus and the molecular marker linked with the red character of the pear peel and the application thereof, the locus and the molecular marker can be used for the auxiliary selective breeding of the red/green character of the pear peel, individual green peel plants are quickly eliminated in the seedling stage of hybrid seedlings, the maintenance, identification and evaluation costs of subsequent hybrid seedlings are saved, the breeding efficiency of the red peel pears is obviously improved, and the locus and the molecular marker have the advantages of wide applicable varieties, high accuracy, high red plant detection rate, low error rate, high phenotype and banding pattern consistency rate and the like.
The technical scheme for solving the technical problems is as follows:
a site linked to the rind red trait, the nucleotide sequence of the site comprising a nucleotide sequence of a site located at 26527817 bases of Chr5 of the 'medium short No. 1' pear reference genome, geneBank accession no: SMOL00000000.
The invention has the beneficial effects that: the mark can be used for pear peel red/green character auxiliary selective breeding, green peel single plants are quickly eliminated in the seedling stage of hybrid seedlings, the subsequent hybrid seedling maintenance and identification evaluation cost is saved, the red peel pear breeding efficiency is obviously improved, and the mark has the advantages of wide applicable varieties, high accuracy, high red plant detection rate, low error rate, high phenotype and banding pattern consistency rate and the like.
Further, the base sequence at the base is ATAACTAGCAAAAATAAGACACGAATGTTAAATACT or A.
The invention provides application of the locus in pear peel red/green character auxiliary selective breeding.
The invention has the beneficial effects that: based on the loci, a marker primer and the like can be developed, the method can be used for pear peel red/green character auxiliary selective breeding, green peel single plants are quickly eliminated in the seedling stage of hybrid seedlings, the subsequent hybrid seedling maintenance and identification and evaluation cost is saved, the red peel pear breeding efficiency is obviously improved, and the method has the advantages of wide applicable varieties, high accuracy, high red plant detection rate, low error rate, high phenotype and banding pattern consistency rate and the like.
The invention provides a molecular marker linked with the pear peel red character, and the locus is positioned inside a molecular marker amplification product.
Further, the upstream primer sequence of the molecular marker comprises a sequence shown by SEQ ID NO. 1, and the downstream primer sequence of the molecular marker comprises a sequence shown by SEQ ID NO. 2.
Preferably, the sequence of the upstream primer of the molecular marker is the sequence shown by SEQ ID NO. 1, and the sequence of the downstream primer of the molecular marker is the sequence shown by SEQ ID NO. 2.
The invention also provides application of the molecular marker in pear peel red/green character auxiliary selective breeding.
The invention provides a primer for amplifying the molecular marker.
Further, the primer includes a sequence shown by SEQ ID NO. 1 and/or a sequence shown by SEQ ID NO. 2. Preferably, the upstream primer is a sequence shown in SEQ ID NO. 1, and the downstream primer is a sequence shown in SEQ ID NO. 2.
Adopt above-mentioned technical scheme's beneficial effect: the primers can realize the pear peel red/green character auxiliary selective breeding, quickly eliminate green peel single plants in the seedling stage of hybrid seedlings, save the subsequent hybrid seedling maintenance and identification evaluation cost, obviously improve the red peel pear breeding efficiency, and have the advantages of wide applicable varieties, high accuracy, high red plant detection rate, low error rate, high phenotype and banding pattern consistency and the like.
The invention provides application of the primer in pear peel red/green character auxiliary selective breeding.
The invention provides a pear peel color auxiliary selective breeding kit which comprises the primers.
Adopt above-mentioned technical scheme's beneficial effect: the kit can realize the red/green character auxiliary selective breeding of pear peel, quickly eliminates a green peel single plant in the seedling stage of hybrid seedlings, saves the subsequent maintenance and identification and evaluation cost of the hybrid seedlings, obviously improves the breeding efficiency of the red peel pears, and has the advantages of wide applicable varieties, high accuracy, high red plant detection rate, low error rate, high phenotype and banding pattern consistency and the like.
Further, the kit further comprises: one or more of enzyme, deionized water, positive control and negative control are used for PCR amplification.
The invention provides application of the kit in pear peel red/green character auxiliary selective breeding.
The invention provides a method for auxiliary selective breeding of pear peel red/green characters, which comprises the following steps: extracting DNA of hybrid seedlings or pear varieties to be selected and bred, and performing PCR amplification by adopting the primers. Or extracting DNA of hybrid seedlings or pear varieties to be selectively bred, and performing PCR amplification by adopting the kit.
Further, the method comprises the following steps: extracting DNA of hybrid seedlings or pear varieties to be selected and bred, and carrying out PCR amplification by adopting a primer pair, wherein the primer pair comprises a sequence shown as SEQ ID NO. 1 and a sequence shown as SEQ ID NO. 2.
Adopt above-mentioned technical scheme's beneficial effect: the method of PCR amplification combined with agarose electrophoresis is adopted, the experiment operation is simple, different sample phenotypes can be successfully distinguished without complex and expensive instruments, the experiment cost is greatly reduced, and the breeding efficiency is improved. The primer has the advantage of high accuracy, can realize the auxiliary selective breeding of the pear peel red/green character, quickly eliminates a single green peel plant in the seedling stage of hybrid seedlings, saves the subsequent maintenance and identification and evaluation cost of the hybrid seedlings, obviously improves the breeding efficiency of the red peel pears, and has the advantages of wide applicable varieties, high accuracy, high red plant detection rate, low error rate, high phenotype and banding consistency rate and the like.
Further, the reaction conditions for PCR amplification include: 3min at 94 ℃;95 ℃ for 10s,54 ℃ for 30s,72 ℃ for 30s, and 35 cycles; 5min at 72 ℃.
Adopt above-mentioned technical scheme's beneficial effect: the amplification conditions are favorable for obtaining clear and definite banding and analyzing and judging results.
The marker provided by the invention is suitable for pear peel red/green character auxiliary selective breeding of hybrid progeny among different pear varieties. For example: the hybrid progeny between green peel varieties such as apple pear ' x ' auguste red ', ' auguste red x red crisp ', pear, nanguo, early crisp, huasu, huajin, huaxing, yellow crown, beijing white, anli pear, floral cover, gold, arrowroot pear, dangshan crisp, snow green, wenzi green, zhongdwarf No. 4, junyu green, jade green, faint scent, cuiguan, zhongli pear No. 1, golden flower No. 4 and the like and red peel varieties such as auguste red, korla fragrant pear, zhongdwarf No. 1, yulu fragrant, red crisp, brocade fragrant, dwarf fragrant, zhongdwarf No. 1, zhongdwarf No. 2, zhongdwarf No. 5 and the like, and the hybrid progeny between the red peel varieties and the like.
The 'August' is a new early-maturing crisp flesh red pear variety bred by 'Zaoba pear' x 'early crisp' hybridization, the fruit flavor is sweet and sour, the peel is easily red in large area and is deeply loved by consumers and breeders, the 'August' is one of excellent parents for breeding the new red skin pear variety, and the application is wide.
Drawings
Fig. 1 shows the location of the pericarp red trait in the genome by the composite interval mapping method, the ordinate represents the LOD value, the abscissa represents the distribution of the mapping Block on the chromosome, and the gray horizontal line represents the LOD threshold (7.916) corresponding to 0.99 confidence level after 1000 times of PT test.
FIG. 2 is a band diagram of B717-Del3SCAR Marker in red-peel pear and green-peel pear in example 1, 2, 3, 4 are red-peel pear band patterns, 5, 6 are green-peel pear band patterns, and M is DNA Marker.
FIG. 3 is a graph showing the amplification results of B717-Del3SCAR Marker in the progeny of 150 hybrid combinations of apple pear ` X ` August ` in example 2 (the numbers above the bands correspond to samples No. 1-150 respectively (no clear band is detected for the first time and a clear band is obtained for the second time of re-amplification for samples No. 18, 20, 21, 71 and 111 due to operation reasons), and M is DNA Marker.
FIG. 4 is a graph showing the results of amplification in the 185 progeny of the B717-Del3SCAR marker ` August ` X ` Red crisp ` hybrid combination in example 3 (the numbers above the bands correspond to samples Nos. 1 to 185, respectively, and no clear band is detected in the 49, 61, 70, 153, and 154 samples for the first time, and a clear band is obtained in the second amplification); m is DNA Marker.
FIG. 5 shows the amplification of the B717-In1 Marker In the progeny of the ` August Red X Red crispy ` 185 strain In example 3, M being DNA Marker; part of the bands were amplified twice to obtain clear bands.
FIG. 6 shows the amplification of the B717-Del2 Marker in the progeny of strain ` August Red X Red crispy ` 185 in example 3, M being DNA Marker; part of the bands were amplified twice to obtain clear bands.
FIG. 7 is a graph showing the amplification results of the B717-Del3SCAR marker in 47 varieties of pear in example 4; m is DNA Marker.
FIG. 8 shows the result of the amplification of the B717-Del2 SCAR marker in 47 pear varieties in example 4; m is DNA Marker.
Detailed Description
The principles and features of this invention are described below in conjunction with the following drawings, which are set forth by way of illustration only and are not intended to limit the scope of the invention.
The invention provides an InDel locus linked with a pear peel red character, a molecular marker based on the locus and application of the molecular marker.
The InDel site linked with the red character of pear pericarp provided by the invention is positioned at 26527817 base of Chr5 of a 'Zhongdwarf No. 1' pear reference genome (GeneBank accession number: SMOL 00000000), the base sequence of the InDel site is 5 'ATAACTAGCAAAAATAAGACACGAATGTTAAATACT-3' shown as SEQ ID NO:3, and the variation sequence is A.
The variation range of the variation site is larger, and the difference is 36bp, so that the amplified fragments can be easily distinguished through simple agarose electrophoresis. The locus is located in the area (shown in figure 1) near the LOD peak value in the chromosome positioning result of the red peel character, the obtained area closely linked with the red character is closer to the peak value, the more reliable the linkage relation is, the more accurate the selected marker is, and the method can be used for auxiliary selective breeding of the red/green character of the pear peel.
The invention provides a SCAR molecular marker developed based on the InDel site, which is marked as B717-Del3, and the InDel site is positioned inside an amplification product of the SCAR molecular marker.
The B717-Del3SCAR molecular marker disclosed by the invention is applied to pear peel red character auxiliary selective breeding. The 2 fragments amplified by the marker have larger length difference and are easy to distinguish.
The primer pair of the B717-Del3SCAR molecular marker comprises:
upstream primer (forward primer) sequence: 5 'and-CGCTGTGGTACGTTACAAAATT-3', as shown in SEQ ID NO: 1;
downstream primer (reverse primer) sequence: 5 'TTTGACGACGATCGCGTACAT-3' as shown in SEQ ID NO: 2.
The primer pair is applied to pear peel red character breeding. The length difference of 2 fragments amplified by adopting the marker is large, and the identification is easy.
The molecular marker is used for identifying 2 hybrid combination groups of 'apple pear' x 'August' and 'August' x 'red crisp', the B717-Del3SCAR marker can be used for selecting single plants with red pericarp in a test group, and the selection efficiency can reach 100% and 98.25%. The B717-Del3SCAR marker provided by the invention can accurately distinguish red-peel varieties from green-peel varieties, can be applied to early selection of red-peel pear breeding taking the varieties as parents, can obviously improve the efficiency of the red-peel pear breeding, and has a good application prospect. The invention has the advantages of wide applicable varieties, high accuracy, high red plant detection rate, low error rate, high phenotype and banding pattern consistency rate and the like.
In the examples, 2 XTAQQ PCR Mix (containing dye) was purchased from Beijing Tianenz Gene technology, inc. as a ready-to-use PCR kit 3.0 (CAT #: 90805-10).
The primer sequences were synthesized by Zhongmeitai and Biotechnology (Beijing) Inc.
The experimental materials not specifically described in the present invention can be commercially available or prepared by a method conventional in the art. The methods of the present invention are conventional in the art and not specifically described.
Further description is provided below by way of specific examples.
Example 1
The method for identifying the pear peel red character by using a B717-Del3 molecular marker primer pair comprises the following steps:
(1) Collecting young leaves of hybrid pear plants (or different pear varieties) and extracting DNA.
(2) The extracted DNA was PCR amplified using B717-Del3 molecular marker primer set, 20. Mu.L reaction system was used for PCR amplification, the composition of the reaction system components and the PCR reaction procedure are shown in tables 1 and 2, and the primer set for amplified molecular marker is shown in Table 3.
TABLE 1 PCR reaction System
Figure BDA0003694400070000081
TABLE 2 PCR reaction procedure
Figure BDA0003694400070000082
TABLE 3 B717-Del3SCAR marker primer sequences
Figure BDA0003694400070000091
(3) Performing 3% agarose gel electrophoresis on the PCR product, performing band statistics on the electrophoresis result, wherein the band types of the red-skin and green-skin single plants in the label are shown in figure 2, and if the band shapes are 151bp and 115bp double bands or 115bp single bands, the red-skin single plants are indicated; if the band shape is 151bp single band, the green skin single plant is indicated.
By using the method, the green pericarp single plant can be quickly eliminated in the seedling stage of the hybrid seedling, the subsequent maintenance and identification and evaluation cost of the hybrid seedling is saved, and the breeding efficiency of the red-peel pear is obviously improved.
Example 2
PCR amplification is carried out In the filial generation of 'apple pear X August red' 150 strain by adopting a B717-Del3 marker, a B717-In1 marker and a B717-Del2 marker respectively.
Scheme 1: PCR amplification was performed in the progeny of the ` apple pear X August Red ` 150 strain using the B717-Del3 marker, using the same procedure as in example 1.
Scheme 2: the B717-In1 marker is adopted to carry out PCR amplification In 150 filial generations of apple pear and Augush red, and the operation steps are the same as example 1 except that the primers are different. B717-In1 labeled primers were:
upstream primer (forward primer) sequence: 5 'AAGCAGCAAAAACTGAGTCACT-3', as shown in SEQ ID NO: 4; downstream primer (reverse primer) sequence: 5 'and TGCCTTTACAGTCCATTTG-doped 3' as shown in SEQ ID NO: 5.
The judging method comprises the following steps: according to the PCR amplification result, if the band is 138bp and 172bp double bands or 172bp single band, the red skin single plant is shown; if the band shape is 138bp single band, the green skin single strain is indicated.
Scheme 3: PCR amplification was performed on the progeny of the 150 strains of apple pear X August red using the B717-Del2 marker, and the procedure was the same as in example 1 except that the primers were different. B717-Del2 labeled primers were:
upstream primer (forward primer) sequence: TCCTCCTTGGACTCTCTGTGG (SEQ ID NO: 6); downstream primer (reverse primer) sequence: CGCAGAACCATCAGCAAAA (SEQ ID NO: 7).
The judging method comprises the following steps: as a result of PCR amplification, if the band is 196bp and 133bp double bands or 133bp single band, the red skin single plant is shown; if the band shape is 196bp single band, the green skin single plant is indicated.
Scheme 4: the combined detection of the 150 plant offspring of 'apple pear X August red' is carried out by adopting a B717-In1 marker and a B717-Del2 marker, namely, the detection of each sample is firstly carried out by adopting the B717-In1 marker and then the detection of the B717-Del2 marker. The detection method using B717-In1 label was the same as In scheme 2. The detection method using B717-Del2 label was the same as in scheme 3.
The judging method comprises the following steps: if the amplification result of any one of the labeled primer pairs indicates that the individual is a red-skinned individual, the individual can be preliminarily considered as having a red phenotype. Otherwise, the individual can be initially identified as green phenotype.
The experimental results are as follows:
as shown In Table 4 and FIG. 3, the detection rate of the red plant marked by B717-Del3 In the offspring of the 'apple pear X August red' 150 plant is 100%, which is consistent with the combined detection result of B717-In1+ B717-Del2, and the detection rate of the red plant marked by B717-Del3 is obviously higher than the detection results of B717-In1 and B717-Del2 alone.
The total error rate of the B717-Del3 marker In the offspring of 150 strains of apple pear x August red is 2%, the combined detection result is consistent with the combined detection result of the B717-In1 and the B717-Del2, and the total error is obviously lower than the independent detection results of the B717-In1 and the B717-Del2, which shows that the error rate can be obviously reduced by adopting the B717-Del3 marker compared with the B717-In1 and the B717-Del 2.
The B717-Del3 marker can quickly eliminate the green rind single plant in the seedling stage of the hybrid seedling, save the maintenance and identification and evaluation cost of the subsequent hybrid seedling, and obviously improve the breeding efficiency of the red-rind pear.
TABLE 4 amplification In the progeny of the ` apple pear X August Red ` 150 strain using the B717-Del3, B717-In1, B717-Del2 markers, respectively
Figure BDA0003694400070000101
Figure BDA0003694400070000111
Example 3
PCR amplification was performed using the B717-Del3 marker, the B717-In1 marker, the B717-Del2 marker In the progeny of the ` August Red X Red crispy ` 185 strain.
Scheme 1: PCR amplification was performed in the progeny of the ` August Red X Red crispy ` 185 strain using the B717-Del3 marker using the same procedure as in scheme 1 of example 2.
Scheme 2: the PCR amplification is carried out In the 'August red X red crispy' 185 strain progeny by adopting the B717-In1 marker, and the operation steps, the sequence of the B717-In1 marker primer and the judgment method are the same as the scheme 2 of the example 2.
Scheme 3: the PCR amplification is carried out in the filial generation of 'August red X red crispy' 185 strain by adopting the B717-Del2 marker, and the operation steps, the sequence of the primer of the B717-Del2 marker and the judgment method are the same as the scheme 3 of the example 2.
Scheme 4: the combined detection of the 'August red X red crispy' 185 strain generations is carried out by adopting a B717-In1 mark and a B717-Del2 mark, namely, each sample is firstly detected by adopting the B717-In1 mark and then detected by adopting the B717-Del2 mark. The procedure, the sequence and determination method of the B717-In 1-labeled primer, and the sequence and determination method of the B717-Del 2-labeled primer were the same as In scheme 4 of example 2.
The experimental results are as follows:
as shown In Table 5 and FIGS. 4 to 6, the B717-Del3 marker is used for identification In the filial generation of the 185 strain of August red X red crispy, the detection rate of the red strain is 98.25 percent, which is higher than the detection results of the B717-In1+ B717-Del2 combination and the B717-In1 and B717-Del2 separately; the total error rate of the identification In the 'August red X red crispy' 185 filial generation by marking B717-Del3 is 10.27 percent, which is lower than the detection results of B717-In1+ B717-Del2 combination and B717-In1 and B717-Del2 alone.
TABLE 5 amplification of the progeny of strain ` August Red X Red crispy ` 185 with the B717-Del3 marker, the B717-In1 marker, the B717-Del2 marker
Figure BDA0003694400070000121
Example 4
PCR amplification was performed on 47 pear varieties using the B717-Del3 marker and the B717-Del2 marker, respectively.
Scheme 1: PCR was performed on 47 varieties of pear using the B717-Del3 marker, using the same procedure as in example 1.
Scheme 2: the PCR amplification was carried out in 47 varieties of pear using the B717-Del2 marker, and the procedure, the sequence of the B717-Del2 marker primer and the method of determination were the same as in scheme 3 of example 2.
The experimental results are as follows:
as shown in Table 6 and FIGS. 7 to 8, the coincidence rate of the phenotype and the banding pattern of 47 different pear varieties is 74.47% when the pear varieties are verified by the B717-Del3 marker, which is obviously higher than that of the B717-Del2 marker.
The B717-Del3 marker can be used for selecting pear varieties with band types consistent with the peel phenotypes of the varieties, the varieties are used as parents (one of the parents is red phenotype) for hybridization, the SCAR marker can be used for identifying the peel colors of filial generations of hybridized seedlings at an early stage, green peel single plants are quickly eliminated at a seedling stage, the maintenance and identification evaluation costs of subsequent hybridized seedlings are saved, and the breeding efficiency of red-peel pears is remarkably improved.
TABLE 6 amplification in 47 pear varieties using B717-Del3 marker, B717-Del2 marker
Figure BDA0003694400070000122
Figure BDA0003694400070000131
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> research institute for fruit trees of Chinese academy of agricultural sciences
<120> locus linked with pear pericarp red character, molecular marker and application thereof
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cgctgtggta cgtctacaaa tt 22
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tttgacgatc gcgtaccat 19
<210> 3
<211> 37
<212> DNA
<213> Pear (pear)
<400> 3
ataactagca aaaataagac acgaaatgtt aaatact 37
<210> 4
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
aagcagcaaa aactgagtca ct 22
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tgcctttaca gtcccatttg 20
<210> 6
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tcctccttgg actctctgtg g 21
<210> 7
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cgcagaacca tatcagcaaa a 21

Claims (9)

1. The application of the molecular marker linked with the rind red character in selective breeding assisted by the rind red/green character is characterized in that the inside of the amplified product of the molecular marker contains a locus linked with the rind red character; the site is located at base 26527817 of Chr5 of the 'Zhongdwarf No. 1' pear reference genome, geneBank accession number of the reference genome: SMOL00000000.
2. The use according to claim 1, wherein the base sequence at the base is ATAACTAGCAAAAAAATAAGACAGGAATGTTAAATACT or A.
3. The use of claim 1 or 2, wherein the upstream primer sequence of the molecular marker is the sequence shown in SEQ ID NO. 1, and the downstream primer sequence of the molecular marker is the sequence shown in SEQ ID NO. 2.
4. The application of the primer in the pear peel red/green character auxiliary selective breeding is characterized in that the primer is a primer for amplifying a molecular marker linked with the pear peel red character; the interior of the molecular marker amplification product contains a locus linked with the rind red character of the pear; the site is located at base 26527817 of Chr5 of the 'Zhongdwarf No. 1' pear reference genome, geneBank accession number of the reference genome: SMOL00000000.
5. The use according to claim 4, wherein the base sequence at the base is ATAACTAGCAAAAAAATAAGACAGGAATGTTAAATACT or A.
6. The use of claim 4 or 5, wherein the primers comprise an upstream primer and a downstream primer, the upstream primer has a sequence shown as SEQ ID NO. 1, and the downstream primer has a sequence shown as SEQ ID NO. 2.
7. The application of the kit in pear peel red/green character auxiliary selective breeding is characterized in that the kit comprises a primer; the primer is used for amplifying a molecular marker linked with the red character of the pear peel; the interior of the molecular marker amplification product contains a locus linked with the rind red character of the pear; the site is located at base 26527817 of Chr5 of the 'Zhongdwarf No. 1' pear reference genome, geneBank accession number of the reference genome: SMOL00000000.
8. The use according to claim 7, wherein the base sequence at the base is ATAACTAGCAAAAATAAGACACGAATGTTAAATACT or A.
9. The use of claim 7 or 8, wherein the primers comprise an upstream primer and a downstream primer, the sequence of the upstream primer is represented by SEQ ID NO. 1, and the sequence of the downstream primer is represented by SEQ ID NO. 2.
CN202210685255.0A 2022-06-14 2022-06-14 Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding Active CN115011723B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202211449874.6A CN115820913B (en) 2022-06-14 2022-06-14 Pear peel red/green character assisted selective breeding method
CN202210685255.0A CN115011723B (en) 2022-06-14 2022-06-14 Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210685255.0A CN115011723B (en) 2022-06-14 2022-06-14 Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN202211449874.6A Division CN115820913B (en) 2022-06-14 2022-06-14 Pear peel red/green character assisted selective breeding method

Publications (2)

Publication Number Publication Date
CN115011723A CN115011723A (en) 2022-09-06
CN115011723B true CN115011723B (en) 2022-12-09

Family

ID=83075453

Family Applications (2)

Application Number Title Priority Date Filing Date
CN202211449874.6A Active CN115820913B (en) 2022-06-14 2022-06-14 Pear peel red/green character assisted selective breeding method
CN202210685255.0A Active CN115011723B (en) 2022-06-14 2022-06-14 Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding

Family Applications Before (1)

Application Number Title Priority Date Filing Date
CN202211449874.6A Active CN115820913B (en) 2022-06-14 2022-06-14 Pear peel red/green character assisted selective breeding method

Country Status (1)

Country Link
CN (2) CN115820913B (en)

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105543383B (en) * 2016-01-29 2019-06-14 中国农业科学院郑州果树研究所 A kind of and the red skin of pears/shagreen linkage of characters site InDel and molecular labeling and application based on the site
CN105506151B (en) * 2016-01-29 2019-04-19 中国农业科学院郑州果树研究所 A kind of and the chain molecular labeling site of the operatic circle skin color trait and its application
CN105838800B (en) * 2016-05-04 2019-05-31 中国农业科学院郑州果树研究所 A kind of and the operatic circle skin color trait chain molecular labeling and its application
CN106929594A (en) * 2017-04-28 2017-07-07 中国农业科学院郑州果树研究所 The molecular labeling of the complete red bud mutation character site of the operatic circle skin and its primer and application
CN114517242A (en) * 2021-08-25 2022-05-20 中国农业科学院果树研究所 Primer combination for amplifying molecular marker linked with pear peel red character
CN113481320B (en) * 2021-08-25 2022-06-03 中国农业科学院果树研究所 Site linked with pear peel red character, molecular marker and application thereof

Also Published As

Publication number Publication date
CN115820913A (en) 2023-03-21
CN115011723A (en) 2022-09-06
CN115820913B (en) 2023-12-15

Similar Documents

Publication Publication Date Title
CN107201404B (en) Molecular biological identification method for sex of asparagus hermaphrodite plants and application thereof
CN109762921B (en) SNP (Single nucleotide polymorphism) marker for detecting color of cucumber pulp and application thereof
CN105543222B (en) The molecular labeling InDeL_33 of soybean 100-grain weight main effect QTL and its application
CN111088388B (en) InDel marker and primer pair for identifying flesh red/non-red character of peach fruit and application of InDel marker and primer pair
CN105506151B (en) A kind of and the chain molecular labeling site of the operatic circle skin color trait and its application
CN103160584B (en) Method and special primer for screening or auxiliary screening of wheat with high pre-harvest sprouting resistance
CN113462813B (en) Site linked with pear peel red character, molecular marker and application thereof
CN113481320B (en) Site linked with pear peel red character, molecular marker and application thereof
CN110463599A (en) A kind of Direct-seeding Rice selection
CN108377901B (en) Continuous multi-generation bud mutation seed selection and method for continuously improving apple red character by combining with crossbreeding
CN105543383A (en) InDel site interlocked with red-peel/green-peel properties of pears as well as molecular marker based on site and application of molecular marker
Andarini et al. Genetic relationship of pigmented rice (Oryza sativa L.) collected from Eastern Indonesia based on morpho-agronomical traits and SSR markers
CN115011723B (en) Application of molecular marker linked with pear peel red character in pear peel red/green character auxiliary selective breeding
CN101491212A (en) Marker-assisted selection quick incubation method of rice strain containing amylase of middle content
CN108048599B (en) Molecular marker closely linked with rape lateral root number major QTL site RtA07-2 and application
CN109811077A (en) With the KASP label of wheat dwarf stem gene close linkage and its application
CN115044656A (en) Identification of interspecific hybridization F of red ginger flowers and white ginger flowers by utilizing SSR markers 1 Method for authenticity of hybrids
CN114262749A (en) Molecular marker primer pair, kit and detection method for loquat pulp color and application
CN108308018A (en) Phosphorus efficiency kind is cultivated using soybean root dry mass near isogenic lines（System）Method
CN110184380B (en) Identification of rice chalkiness high-temperature insensitive major QTL and application thereof in rice breeding
CN109329044B (en) Method for cultivating cherry tomato inbred line with high soluble solid content, high gloss and TYLCV resistance
CN107988416B (en) Molecular identification method and primer for identifying Suzhou cyan
CN111004857A (en) Molecular marker primer of major QTL (quantitative trait locus) site of soybean branch number and application of molecular marker primer
CN106893729B (en) Recombinant nucleic acid fragment RecCR033207 and detection method thereof
CN114525361B (en) cDNA molecular marker for distinguishing purple skin and yellow skin onion and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant