CN108377901B

CN108377901B - Continuous multi-generation bud mutation seed selection and method for continuously improving apple red character by combining with crossbreeding

Info

Publication number: CN108377901B
Application number: CN201810252860.2A
Authority: CN
Inventors: 陈学森; 姜生辉; 毛志泉; 姜远茂; 王志刚; 张宗营; 王楠; 徐海峰; 王意程
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2017-02-21
Filing date: 2017-02-21
Publication date: 2021-11-02
Anticipated expiration: 2037-02-21
Also published as: CN106613921B; CN108377901A; CN106613921A

Abstract

The invention discloses a method for continuously improving red characters of apples by continuous multi-generation bud mutation seed selection and combination of the seed selection and crossbreeding. The method provided by the invention comprises the following steps: continuously carrying out multiple-generation bud mutation seed selection on the apple variety C0, wherein the first generation bud mutation seed selection takes the apple variety CO as a starting variety, each later generation bud mutation seed selection takes a variety obtained by the previous generation bud mutation seed selection as a starting variety, and each generation bud mutation seed selection selects a target variety from branches or plants grown from buds meeting the following characters: (a) red bud change occurs; (b) the anthocyanin content of the peel of the apple growing on the branch or plant developed by the bud is more than 2 times of that of the original variety; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant grown by the bud is less than one half of that of the starting variety. The invention has important significance for continuously improving the red character of the apple.

Description

Continuous multi-generation bud mutation seed selection and method for continuously improving apple red character by combining with crossbreeding

The application is a divisional application with the application number of 201710092300.0, the application date of 2017, 2 and 21 months, and the invention and creation name of a method for continuously improving the red character of the apple by continuous multi-generation bud mutation and combination of the continuous multi-generation bud mutation and crossbreeding.

Technical Field

The invention relates to a method for continuously improving red characters of apples by continuous multi-generation bud mutation seed selection and combination of the seed selection and crossbreeding.

Background

The homology of medicine and food is the development direction, and people can learn the common knowledge about nutrition and health eating. The apple fruits contain more free polyphenol or flavonoid which is easily absorbed by human bodies, and have better effects on oxidation resistance, prevention of cardiovascular and cerebrovascular diseases, tumor resistance and the like, so that the apple is taken as a main consumption fruit in one day, doctors are far away from the apple, and the apple is greatly recommended as the main consumption fruit in a plurality of countries in the world. The red skin and red flesh traits of apple fruits develop mainly from anthocyanin, which is the main component of flavonoids. Therefore, the new apple variety with high anthocyanin (or flavonoid) content, good appearance quality and high health care value is further bred, and the method has important significance for promoting the development of the apple industry and improving the human health.

The functional apple breeding with red pulp and high flavonoid content is effective integration and balance of multiple quality characters (genes), and three measures are adopted for perfecting a new variety breeding scheme and improving the breeding efficiency in a subject group: on the basis of the research on the genetic variation of characters such as the total phenol content of the first hybrid generation fruits of the Xinjiang red-pulp apples and the apple varieties, an apple breeding method (patent number ZL 201310205419.6) of 'three-selection two-early one promotion' is provided and implemented, and the breeding efficiency is obviously improved; secondly, performing multi-parent hybridization and repeated backcross on apple varieties with complex genetic backgrounds, such as 'Gala', 'American eight', 'Hanfu' and 'Fushi' and Xinjiang red apples (M.Sieversii f.niedzwetzwetzkyana) to carry out quality breeding, wherein 40 backcross first-generation and second-generation segregating groups are constructed at present, 4 ten thousand seedlings of hybrid seedlings are planted, and 2 breeding technical inventions of a fruit tree multi-seed source breeding method (patent application No. 201510428448.8) and an easily-colored apple variety breeding method (patent application No. 201510890141.X) are reported; thirdly, the progeny strains with basically stable characters are taken as test materials in time to evaluate the quality characters and research the development mechanism, and a plurality of important progresses are obtained. At present, an efficient apple breeding technical system organically combining conventional hybridization and biotechnology is created, a batch of new varieties and excellent germplasm are created, and a matched efficient cultivation technical system of the new apple varieties is developed. Authorizing and declaring the remaining 10 patents of the invention, and breeding 16 new varieties (lines); related research papers 120 are published, with the rest of SCI papers 20, whose results are generally at the leading level of international peer research.

Disclosure of Invention

The invention aims to provide a method for continuously improving the red character of an apple by continuously multi-generation bud mutation seed selection and combination of the seed selection and crossbreeding.

The invention firstly protects an apple breeding method (method A), which comprises the following steps: carrying out continuous multi-generation bud mutation seed selection on the apple variety C0, wherein the first generation bud mutation seed selection takes the apple variety CO as a starting variety, each later generation bud mutation seed selection takes a variety obtained by the previous generation bud mutation seed selection as a starting variety, and each generation bud mutation seed selection selects a target variety from branches or plants grown from buds which all meet the following three characters: (a) red bud change occurs; (b) the anthocyanin content of the peel of the apple growing on the branch or plant developed by the bud is more than 2 times of that of the original variety; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant with the developed bud is less than one half of the starting variety;

the specific DNA molecule is (I), (II) or (III) as follows:

(I) a DNA molecule shown in a sequence 1 in a sequence table;

(II) carrying out insertion and/or deletion and/or substitution of one or more nucleotides on the DNA molecule shown in the sequence 1 of the sequence table to obtain a DNA molecule;

(III) a DNA molecule having a homology of 90% or more with the DNA molecule represented by the sequence 1 of the sequence listing.

The generations are more than 2 generations, and can be 2 generations, 3 generations, 4 generations, 5 generations, 6 generations and the like.

The apple variety obtained by the breeding method meets the following indexes (d1) and/or (d 2): (d1) the coloring speed is higher than that of apple variety C0; (d2) the color index is greater than apple variety C0.

The apple variety obtained by the breeding method meets the following indexes (d3) and/or (d 4): (d3) the coloring speed is "coloring within 5 days after bag removal"; (d4) the coloring index is 80% or more.

The apple variety obtained by the breeding method meets the following indexes (d5) and/or (d 6): (d5) the coloring speed is "coloring within 4 days after bag removal"; (d6) more than 80% of the epidermis of the mature fruit is ruby red.

The apple variety obtained by the breeding method meets the following indexes (d7) and/or (d 8): (d7) the coloring speed is "coloring within 5 days after bag removal"; (d8) the coloring index is 90% or more.

The apple variety obtained by the breeding method meets the following indexes (d9) and/or (d 10): (d9) the coloring speed is "coloring within 4 days after bag removal"; (d20) more than 90% of the epidermis of the mature fruit is ruby red.

The apple variety C0 can be red Fuji apple or Gala apple.

The invention also provides an apple breeding method (method B), which comprises the following steps: carrying out continuous multi-generation bud mutation seed selection on the apple variety C0, wherein the first generation bud mutation seed selection takes the apple variety CO as a starting variety, each later generation bud mutation seed selection takes a variety obtained by the previous generation bud mutation seed selection as a starting variety, and each generation bud mutation seed selection selects a target variety from branches or plants grown from buds which fully meet the following four characters: (a) red bud change occurs; (b) the anthocyanin content of the peel of the apple growing on the branch or plant developed by the bud is more than 2 times of that of the original variety; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant with the developed bud is less than one half of the starting variety; (d) the internode length of the branch growing on the branch or plant growing after the bud grows is less than 2 cm;

the specific DNA molecule is (I), (II) or (III) as follows:

(I) a DNA molecule shown in a sequence 1 in a sequence table;

The apple variety obtained by the breeding method meets the following indexes (e1) and/or (e2) and/or (e 3): (e1) the coloring speed is higher than that of apple variety C0; (e2) the color index is greater than apple variety C0; (e3) the internode length of the branch is less than 2 cm.

The apple variety obtained by the breeding method meets the following indexes (e4) and/or (e5) and/or (e 6): (e4) the coloring speed is "coloring within 5 days after bag removal"; (e5) the coloring index is more than 80 percent; (e6) the internode length of the branch is less than 2 cm.

The apple variety obtained by the breeding method meets the following indexes (e7) and/or (e8) and/or (e 9): (e7) the coloring speed is "coloring within 5 days after bag removal"; (e8) more than 80% of the epidermis of the mature fruit is dark red; (e9) the internode length of the branch is less than 2 cm.

The apple variety obtained by the breeding method meets the following indexes (e10) and/or (e11) and/or (e 12): (e10) the coloring speed is "coloring within 5 days after bag removal"; (e11) the coloring index is more than 90%; (e12) the internode length of the branch is less than 2 cm.

The apple variety obtained by the breeding method meets the following indexes (e13) and/or (e14) and/or (e 15): (e13) the coloring speed is "coloring within 5 days after bag removal"; (e14) more than 90% of the mature fruit epidermis is thick red; (e15) the internode length of the branch is less than 2 cm.

The apple variety C0 can be red Fuji apple or Gala apple.

The invention also provides an apple breeding method (method C), which comprises the following steps:

(1) hybridizing the apple variety A and the apple variety B to obtain hybrid seeds; the apple variety A is apple (Malus domestica) CSR6R 6-666; the apple variety B is obtained by any one of the methods;

(2) sowing and raising seedlings of the hybrid seeds obtained in the step (1) to obtain seedlings;

(3) transplanting the seedling obtained in the step (2) to a field, bagging the fruit after the fruit grows out, and screening to obtain a target plant.

The method for hybridizing the apple variety A and the apple variety B comprises the following steps: pollen of the apple variety A is taken, and pollination is carried out on the emasculated apple variety B.

In the step (2), before the sowing, the hybrid seeds are subjected to 1-3 ℃ stratification treatment to break dormancy. The time of the layering treatment may be 60 days.

In the step (2), the conditions for seedling cultivation are as follows: at 25 deg.C, irradiating with light for 12 hr per day at an intensity of 3000lx, and irrigating the nutrient solution once every 7-10 days from seed germination.

In the step (2), the conditions for seedling cultivation are specifically as follows: sowing the hybrid seeds in nutrition pots (3-5 seeds are sown in each nutrition pot) filled with seedling raising substrates, culturing until the height of seedlings is 8-15cm and the root necks are lignified (generally, sowing for 2-3 months), and then transplanting the seedlings into a new nutrition pot (1 plant is transplanted in each nutrition pot) filled with the seedling raising substrates for culturing; the culture conditions are as follows: at 25 ℃, the illumination is carried out for 12 hours every day (the illumination intensity is 3000lx), the nutrient solution (the macroelement mother solution of the MS basic culture medium is diluted to 10 times of volume by water to obtain the nutrient solution) is poured once every 7 to 10 days from the beginning of seed germination, and 40 to 50ml of the nutrient solution is poured in each nutrition pot every time.

In the step (3), the method for performing cultivation management in the field comprises the following steps: 6000kg of organic fertilizer is applied to each mu of field where seedlings are planned to be planted, watering and settling are carried out, and 6000kg of organic fertilizer is applied to each mu of field after seedlings are planted in the field, and watering is carried out in time. The organic fertilizer can be fully decomposed dairy manure.

In the method, in the 4 th year of transplanting, the trunk of the seedling is girdled at the position 20cm away from the ground, the girdling width is 0.5-1.0cm, and the trunk reaches the xylem.

In the method, in the 5 th year of transplanting, the following operations are carried out in the full-bloom stage of the seedlings: only the central flower remained in 5 flowers of each inflorescence, and all others were thinned out.

In the method, the target plant is obtained in 5 th year of transplanting.

The target plant is a plant with full red pulp.

The target plant is an apple plant satisfying the following (f1) and/or (f2) and/or (f3) and/or (f 4): (f1) the flesh is completely red; (f2) high flavonoid content in pulp; (f3) the pulp has high anthocyanin content; (f4) the pulp has high oxidation resistance. The high flavonoid content in the pulp means that the flavonoid content in the pulp per kilogram of fresh weight is more than 5000 mg. The high anthocyanin content in the pulp refers to the anthocyanin content in the pulp of more than 200mg per kilogram of fresh weight. The high antioxidant capacity of the pulp means that the antioxidant capacity (also called antioxidant content) in the pulp per kilogram fresh weight is more than 3 mu mol.

The invention also protects the application of the apple (Malus domestica) CSR6R6-666 in apple breeding. In the application, apple CSR6R6-666 is used as one of parents. In the application, apple CSR6R6-666 is used as a male parent. The breeding aim is to obtain plants with full red pulp.

'CSR 6R 6-666', also called apple (Malus domestica) CSR6R6-666, has been deposited in China general microbiological culture Collection center (CGMCC, address: Beijing City Zhongyang district Xilu No.1 Beijing Hospital, institute of microbiology, China academy of sciences) in 2017 at 17.2.M..

The invention enhances the work of bud mutation and seed selection, establishes an efficient breeding technical system with complementary advantages of cross breeding and bud mutation and organic combination of conventional technology and biotechnology, and has important significance for continuously improving the red character of the apple.

Drawings

FIG. 1 shows the results of anthocyanin detection in pericarp of Fuji red, variety A and variety B.

FIG. 2 shows the results of detecting the methylation level of specific DNA molecules in pericarp of Fuji red, variety A and variety B.

FIG. 3 is a photograph of variety A.

FIG. 4 is a photograph of variety B

FIG. 5 is a photograph of a dice variety,

FIG. 6 is a photograph of Gala.

FIG. 7 is a photograph of the cultivar.

Fig. 8 is a photograph of 'function No. 1' of a new apple line.

Fig. 9 is a photograph of 'function No. 2' of a new apple line.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The coloring index means: the area of the red area of the epidermis of the mature apple fruit accounts for the proportion of the total area of the epidermis.

The structural formula of rutin is as follows:

the structural formula of Trolox is as follows:

80% acetone solution: 4 parts by volume of acetone are mixed with 1 part by volume of water.

1% hydrochloric acid methanol solution: 97.2ml of methanol were mixed with 2.8ml of concentrated hydrochloric acid. Concentrated hydrochloric acid is commercially available 12mol/L hydrochloric acid.

The preparation method of the 0.5% methanol hydrochloride solution comprises the following steps: 0.5 part by volume of 35% concentrated hydrochloric acid was mixed with 99.5 parts by volume of methanol.

References to 'red fushi' apples and 'gala' apples: chen schason, Xinpegang, etc., marshal and Jinshuai in the breeding of new apple varieties, proceedings of Shandong university of agriculture, 1994, 25 (2): 236-248.

Example 1 establishment of a method for continuous improvement of apple Red skin trait by continuous Multi-Generation sprout Change seed selection

First, red bud change of apple

Investigation finds that the red bud mutation of the apple has the following three characteristics:

(1) recapitulation of apple red bud mutation

Research finds that the red bud mutation of the apple can repeatedly occur in different areas and different years at home and abroad, and shows the recapitulation of the bud mutation. The method provides scientific basis for continuously improving the red skin character of the apples by effectively utilizing the bud mutation seed selection technology.

(2) Pleiotropic property of apple red bud

The investigation on a plurality of apple red bud varieties shows that although the apple red bud varieties are red bud varieties, different bud varieties (lines) have obvious differences in coloring types (red strips or red slices), coloring speeds, light sensitivity and the like. The method provides scientific basis for effectively utilizing the bud mutation seed selection technology to breed characteristic diversified varieties and meeting diversified requirements of consumers and cultivators;

(3) stability of apple red bud

The stability of a plurality of apple red bud mutation varieties after grafting and propagation is investigated, and the result shows that the apple red bud mutation has good genetic stability and consistency. The method provides scientific basis for large-area popularization and application of the apple red bud mutation variety.

Second, mechanism of bud mutation

Through a great deal of research by the inventor, the red bud mutation of the apple is epigenetic inheritance caused by the difference of the methylation level of specific DNA molecules. The specific DNA molecule is shown as a sequence 1 in a sequence table.

Through detection, the genomes of the 'red Fuji' apple and the 'Gala' apple have specific DNA molecules shown in a sequence 1 of a sequence table.

Establishment of method for continuously improving red skin character of apple through continuous multi-generation bud mutation seed selection

The following method is established: carrying out continuous multi-generation bud mutation seed selection on the apple variety C0, wherein the first generation bud mutation seed selection takes the apple variety CO as a starting variety, each later generation bud mutation seed selection takes a variety obtained by the previous generation bud mutation seed selection as a starting variety, and each generation bud mutation seed selection selects a target variety from branches or plants grown from buds which all meet the following three characters: (a) red bud change occurs; (b) the anthocyanin content of the peel of the apple growing on the branch or plant developed by the bud is more than 2 times of that of the original variety; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant grown by the bud is less than one half of that of the starting variety. The above pericarp refers to pericarp of mature apple.

The method for detecting the anthocyanin content of the pericarp comprises the following steps:

taking 0.5g of peel, grinding with liquid nitrogen, adding 5ml of 1% hydrochloric acid methanol solution precooled at 4 ℃, standing at 4 ℃ in a dark place, and extracting for 24 hours.

And secondly, after the step I is finished, taking the extracting solution, dividing the extracting solution into two parts, wherein each part is 1ml, 4ml of KCl buffer solution is added into one part, 4ml of NaAC buffer solution is added into the other part, the mixture is uniformly mixed and then stands and extracted for 15min in a dark place at 4 ℃, and then the mixture is centrifuged for 10min at 8000r/min, and supernatant is collected.

KCl buffer (pH 1, 0.025M): 1.86g of KCl was dissolved in 980ml of distilled water, adjusted to pH1.0 with concentrated hydrochloric acid, transferred to a 1L volumetric flask, and made to volume with distilled water.

NaAC buffer (pH 4.5, 0.4M): 54.43g NaAC with 960ml distilled water dissolved, with concentrated hydrochloric acid pH4.5, transfer to 1L volumetric flask, with distilled water to constant volume.

Taking the supernatant obtained in the step two, and respectively measuring the light absorption values under 510nm and 700 nm.

Anthocyanin content (mg/g) ═ Δ a 5 × 0.005 × 1000 × 449.2/(26900 × 0.5);

△A＝(A_510nm-A_700nm)_{at pH1.0}-(A_510nm-A_700nm)_{At pH4.5}。

In the expression "mg/g", mg refers to the mass of anthocyanin, and g refers to the fresh weight of pericarp.

The method for detecting the methylation level of the specific DNA molecules of the pericarp comprises the following steps:

extracting the genomic DNA of the pericarp by using a QIAGEN plant genomic DNA extraction kit.

Secondly, obtaining genome DNA in the step one, and carrying out sulfite conversion by adopting an EZ DNA Methylation-Gold kit to obtain sulfite treated DNA.

Taking the DNA treated by the sulfite obtained in the step two as a template, and carrying out PCR amplification in two systems.

PCR amplification System I: 10 XEx Taq Buffer 2.5. mu.l, dNTP mix 2. mu.l, primer F12. mu.l, primer R12. mu.l, TaKaRa Ex Taq HS 0.5. mu.l, template 4. mu.l, ddH₂O 12μl。

Reaction procedure of PCR amplification System I: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 51 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute for 40 cycles in total; extension at 72 ℃ for 10 min.

And (3) a PCR amplification system II: 10 XEx Taq Buffer 2.5. mu.l, dNTP mix 2. mu.l, primer F22. mu.l, primer R22. mu.l, TaKaRa Ex Taq HS 0.5. mu.l, template 4. mu.l, ddH₂O 12μl。

Reaction procedure of PCR amplification System II: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 54 ℃ for 30 seconds, and extension at 72 ℃ for 1 minute for 40 cycles in total; extension at 72 ℃ for 10 min.

Primer F1: 5'-TAGGTTTGAAGAATTAATTAGGGAT-3', respectively;

primer R1: GGGAAATTTTGGTTTTTATATGGTTTAG-3'.

Primer F2: TTTTATTTTTTATATATATTATGTTATT-3';

primer R2: GGATTATGTTATTAGATGGT-3'.

And fourthly, sequencing the amplification products of the two systems obtained in the third step, and outputting methylation level data by utilizing CyMATE software (Hetzl et al, 2007).

Methylation level of a specific DNA molecule ═ (methylation level data for system i + methylation level data for system ii) ÷ 2.

Example 2 continuous improvement of apple red skin character by continuous multi-generation bud mutation breeding using the method established in example 1

The method for detecting the anthocyanin content of the pericarp and the method for detecting the methylation level of the specific DNA molecules of the pericarp in the embodiment are the same as the embodiment 1.

Breeding of red bud-changed new variety of red Fuji apple

1. And (3) first generation bud mutation seed selection:

taking red Fuji as a starting variety, and taking a branch or a plant which is grown by buds meeting the following three characters as a primary selection object: (a) red bud change occurs; (b) the anthocyanin content of the pericarp of the apple growing on the branch or plant with the developed bud is more than 2 times of that of Fuji; (c) the methylation level of the specific DNA molecules of the apple pericarp growing on the branch or plant where the bud develops is less than half of red Fuji. The above pericarp refers to pericarp of mature apple.

And (4) performing check and decision on the primary selection object to obtain a certain variety as a variety A.

2. And (3) second generation bud mutation seed selection:

taking the variety A as a starting variety, and taking a branch or a plant which is grown by buds meeting the following three characters as a primary selection object: (a) red bud change occurs; (b) the anthocyanin content of the pericarp of the apple growing on the branch or plant with the bud development is more than 2 times of that of the variety A; (c) the methylation level of the specific DNA molecules of the apple pericarp growing on the branch or plant grown by the bud is less than one half of that of the variety A. The above pericarp refers to pericarp of mature apple.

And (4) performing check and decision on the primary selection object to obtain a certain variety as a variety B.

The results of anthocyanin detection in pericarp of Fuji, variety A and variety B are shown in FIG. 1. The anthocyanin content of the pericarp of the variety A is more than 2 times of that of Fuji, and the anthocyanin content of the pericarp of the variety B is more than 2 times of that of the variety A.

The results of the detection of the methylation level of specific DNA molecules in the pericarp of Fuji, variety A and variety B are shown in FIG. 2. The methylation level of the specific DNA molecules of the pericarp of the variety A is less than one half of that of Fuji, and the methylation level of the specific DNA molecules of the pericarp of the variety B is less than one half of that of the variety A.

Red fuji pericarp color trait: the coloring speed is slow (10-15 days after bag removal), the color index is 25-35% (mature fruit skin, 25-35% showing light red, the remainder showing yellow or green). Flesh color property of red fuji: milky white pulp.

The color of the peel of variety A: the coloring speed is high (6-9 days after bag removal), and the coloring index is 75-85% (mature fruit epidermis, 75-85% shows bright red). The photograph of breed nail is shown in FIG. 3. Flesh color property of variety a: milky white pulp.

The color of the peel of variety B: the coloring speed is high (coloring is carried out 3-4 days after bag removal), and the coloring index is more than 90% (mature fruit epidermis, more than 90% is ruby red). The photograph of breed B is shown in FIG. 4. Flesh color property of variety b: milky white pulp.

Second, red Fuji apple red, short branch double bud changing high quality short branch type new variety breeding

1. And (3) first generation bud mutation seed selection:

taking red Fuji as a starting variety, and taking a branch or a plant which is grown by buds meeting the following four characters as a primary selection object: (a) red bud change occurs; (b) the anthocyanin content of the pericarp of the apple growing on the branch or plant with the developed bud is more than 2 times of that of Fuji; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant with the developed bud is less than one half of red Fuji; (d) the internode length of the branch grown on the shoot or plant grown by the bud is less than 2 cm. The above pericarp refers to pericarp of mature apple.

And (4) performing check and decision on the primary selection object to obtain a certain variety as variety C.

2. And (3) second generation bud mutation seed selection:

taking the variety C as a starting variety, and taking the branch or plant which is grown by the bud and meets the following four characters as a primary selection object: (a) red bud change occurs; (b) the anthocyanin content of the pericarp of the apple growing on the branch or plant with the bud development is more than 2 times of that of the variety C; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant with the developed bud is less than one half of the variety C; (d) the internode length of the branch grown on the shoot or plant grown by the bud is less than 2 cm. The above pericarp refers to pericarp of mature apple.

And (4) performing check and decision on the primary selection object to obtain a certain variety as a variety T.

The color of the peel of variety c: the coloring speed is high (7-10 days after bag removal), and the coloring index is 75-85% (mature fruit epidermis, 75-85% shows bright red). Pulp color property of variety c: milky white pulp. Short shoot trait of variety c: the internode length is less than 2 cm.

The fruit peel color property of the variety D: the coloring speed is high (the coloring is carried out 3-5 days after the bag is removed), and the coloring index is more than 90 percent (the color of the mature fruit epidermis is more than 90 percent of dark red). The photograph of the variety D is shown in FIG. 5. Flesh color property of variety dices: milky white pulp. Short shoot character of variety D: the internode length is less than 2 cm.

Breeding of red bud variety of three-and-one Gala apple

1. And (3) first generation bud mutation seed selection:

taking Gala as a starting variety, and taking a branch or a plant which is grown by a bud and meets the following three characters as a primary selection object: (a) red bud change occurs; (b) the anthocyanin content of the peel of the apple growing on the branch or plant with the bud is more than 2 times of Gala; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant where the bud grows is less than one half of Gala. The above pericarp refers to pericarp of mature apple.

And (4) performing check and decision on the primary selection object to obtain a certain variety as a variety E.

2. And (3) second generation bud mutation seed selection:

taking the variety E as a starting variety, and taking the branch or plant which is grown by the bud and meets the following three characters as a primary selection object: (a) red bud change occurs; (b) the anthocyanin content of the peel of the apple growing on the branch or plant with the developed bud is more than 2 times of that of the variety E; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant where the bud develops is less than one half of the variety E. The above pericarp refers to pericarp of mature apple.

And after the primary selection object is subjected to check and decision, obtaining a certain variety as the variety.

Gala pericarp color property: the coloring speed is slow (8-12 days after bag removal), the color index is 25-35% (mature fruit skin, 25-35% showing light red, the remainder showing yellow or green). Gala pulp color property: milky white pulp. The picture of Gala is shown in FIG. 6.

The fruit peel color property of variety E: the coloring speed is high (5-8 days after bag removal), and the coloring index is 75-85% (mature fruit epidermis, 75-85% shows bright red). Pulp color property of variety E: milky white pulp.

The color of the peel of the variety Heji: the coloring speed is high (the coloring is carried out 3-5 days after the bag is removed), and the coloring index is more than 90 percent (the color of the mature fruit epidermis is more than 90 percent of dark red). The photograph of the variety is shown in FIG. 7. The color of the flesh of the variety Ji is as follows: milky white pulp.

Example 3 obtaining and identification of an excellent germplasm of apple' CSR6R6-666

The method for identifying the apple plant as R1R1 genotype, R6R6 genotype or R6R1 genotype is as follows: taking apples from apple plants to be detected, extracting genome DNA of apple pulp, carrying out PCR amplification by using the genome DNA as a template and adopting a primer pair consisting of F3 and R3, and then judging the genotype according to the following standard: if the PCR amplification product is a strip and is 497bp, the apple plant to be detected is R6R6 genotype; if the PCR amplification product is a strip and 386bp, the apple plant to be detected is R1R1 genotype; if the PCR amplification product is two bands which are 497bp and 386bp respectively, the apple plant to be detected is R6R1 genotype.

F3：5’-GGTGGTCAAAGATGTGTGTTGT-3’；

R3：5’-TTTGCCTGCTACCCACTTCA-3’。

Through detection, the 'red Fuji' apple and the 'Gala' apple are both R1R1 genotypes.

Acquisition of one or' CSR6R6-666

Xinjiang red-fleshed apples are used as parents to be hybridized with white-fleshed apple varieties such as 'red Fuji'. According to Mendel's law of inheritance, Xinjiang red apples (R6R1 genotype) are crossed with white apple cultivars such as ' Red Fuji ' (R1R1 genotype), and the progeny population should have a red phenotype (R6R1 genotype) and a white phenotype (R1R1 genotype) of 1: 1. However, in hybridization F₁Individuals of the R6R6 genotype were found in the progeny population.

An individual of the R6R6 genotype was named ` CSR6R6-666 `.

'CSR 6R 6-666' has the following phenotype: the stem, leaf, flower, pericarp and pulp and their development stages are all purple red.

Deposit of di-' CSR6R6-666

Deposit of III, ` CSR6R6-777 `

'CSR 6R 6-777' is another individual strain of R6R6 genotype which is bred in the early stage of the laboratory where the inventor is located.

'CSR 6R 6-777', also called apple (Malus domestica) CSR6R6-777, has been deposited in China general microbiological culture Collection center (CGMCC, address: West Lu No.1 Hospital, Shih No. 3, institute of microbiology, China academy of sciences) of China general microbiological culture Collection management Committee in 12 months and 08 years 2016, and has been deposited with a registration number of CGMCC No. 12468.

Content analysis of flavonoid component

Respectively taking 'CSR 6R 6-666' and 'CSR 6R 6-777' as plants to be detected.

1. Taking apples on the plant to be detected, and taking apple pulp.

2. And (3) taking the pulp obtained in the step (1), and grinding the pulp in liquid nitrogen to obtain powder.

3. Weighing 2g of the powder obtained in the step 2, adding 5mL of 0.5% hydrochloric acid methanol solution, standing and extracting at 4 ℃ for 2h, then centrifuging at 8000rpm for 20min, and respectively collecting the supernatant and the residue.

4. And (3) adding 5mL of 0.5% hydrochloric acid methanol solution into the residue obtained in the step (3), standing and extracting at 4 ℃ for 1h, then centrifuging at 8000rpm for 20min, and collecting the supernatant.

5. And (4) mixing the supernatant obtained in the step (3) and the supernatant obtained in the step (4) to obtain a mixed solution.

6. Taking the mixed solution obtained in the step 5, carrying out rotary evaporation at 37 ℃ to remove methanol, dissolving the residue with 2-3ml of methanol, then centrifuging at 8000rpm for 20min, and collecting the supernatant.

7. And (4) taking the supernatant obtained in the step 6, diluting the supernatant to 5ml with methanol, filtering the supernatant with a 0.45-micron filter membrane, and collecting the filtrate.

8. And (4) carrying out HPLC-MS analysis on the filtrate obtained in the step 7.

Liquid chromatography conditions:

adopting WATERS ACQUITY UPLC chromatograph with BEH C18 column (100mm × 2.1mm) and filler particle diameter of 1.7 μm; the column temperature is 45 ℃; the sample injection volume is 1 mu L;

the mobile phase is a mixed solution of the solution A and the solution B, and the flow rate is 0.3 mL/min; the liquid A is acetonitrile, and the liquid B is an aqueous solution containing 0.2 percent (volume fraction) of formic acid; 0-0.1min, the volume fraction of the liquid A in the mobile phase is 5%; the volume fraction of the liquid A in the mobile phase is linearly increased from 5% to 20% in 0.1-20 min; the volume fraction of the liquid A in the mobile phase is linearly increased from 20% to 80% within 20-22 min; for 22-22.1min, the volume fraction of the liquid A in the mobile phase is linearly reduced from 80% to 5%; and (4) for 22.1-25min, wherein the volume fraction of the liquid A in the mobile phase is 5%.

Mass spectrum conditions:

the mass spectrometer was WATERS MALDI SYNAPT Q-TOF MS, ESI ionization source, electrospray ionization positive ion acquisition mode (ESI +); the scanning range is 100-1500 m/z; the capillary voltage is 3.5kV, and the taper hole voltage is 30V; the source temperature is 100 ℃, and the desolventizing temperature is 300 ℃; the flow rate of the desolventizing agent is 500L/h.

The contents of 9 specific flavonol materials are shown in Table 1. The detection methods of 9 specific substances in the table 1 belong to flavonoid components and content detection methods, and are disclosed in references (Chen schson, Zhang Jing, Liu Da Liang, and the like. genetic variation of the first generation of red-pulp apple hybrid in Xinjiang and evaluation of the excellent functional apple plants [ J ]. Chinese agricultural science, 2014,47(11): 2193-2204.).

TABLE 1

The results show that the 'CSR 6R 6-666' and the 'CSR 6R 6-777' both have strong flavonoid synthesis capacity, the pulp is rich in flavonoids, and the pulp contains special flavonol components, so that the apple variety is excellent in germplasm for cultivating functional apple varieties. 'CSR 6R 6-666' is superior to 'CSR 6R 6-777'.

Example 4 organic combination of bud mutation selection and crossbreeding to breed 'functional No. 1' functional apple new line

Functional apple new strain

1. Backcrossing (in the heaven, the Shandong tobacco station City, the mu-M-Yang region)

In 4 months of 2011, pollen of 'CSR 6R 6-666' is taken, pollination is carried out on the castrated variety B, and BC is harvested₁Hybridizing seeds, mixing BC₁Cleaning hybrid seeds, and placing the cleaned hybrid seeds in a fresh-keeping chamber layer of a refrigerator at 1-3 DEG CThe product is processed for about 60d (in order to release the seed dormancy by satisfying the cold requirement).

2. Seedling in greenhouse (in Shandong Taian)

12 months 2011, the BC obtained in the step 1₁Sowing the hybrid seeds in nutrition pots (3-5 seeds are sown in each nutrition pot) filled with seedling raising substrates, culturing until the height of seedlings is 8-15cm and the root necks are lignified (generally, sowing for 2-3 months), and then transplanting the seedlings into a new nutrition pot (1 plant is transplanted in each nutrition pot) filled with the seedling raising substrates for culturing; the culture conditions in this step were: at 25 ℃, the illumination is carried out for 12 hours every day (the illumination intensity is 3000lx), the nutrient solution (the macroelement mother solution of the MS basic culture medium is diluted to 10 times of volume by water to obtain the nutrient solution) is poured once every 7 to 10 days from the beginning of seed germination, and 40 to 50ml of the nutrient solution is poured in each nutrition pot every time.

3. Planting of hybrid seedlings (in Shandong Guangxian)

In 2 months 2012, 6000kg of organic fertilizer (fully decomposed cow dung adopted in the embodiment) is applied to each mu of the field selection garden (field) where seedlings are planned to be planted, and the field selection garden is watered and settled; and 4, in 2012, planting 3600 seedlings obtained in the step 2 in a seed selection garden, and in 4, applying 6000kg of organic fertilizer (fully decomposed cow dung in the embodiment) to each mu of the seed selection garden where the seedlings are planted in 2012 and watering in time.

4. Hybrid seedling girdling treatment

And in 2015, in 5 months, performing girdling on the trunk of each seedling at a position 20cm away from the ground, wherein the girdling width is 0.5-1.0cm and the trunk reaches the xylem. The purpose of this operation is to promote accumulation of nutrients and flower bud differentiation, to shorten the childhood period and to bring forward the fruiting.

5. Flower and fruit management

Thinning flowers in 2016 (4-5 months) at full-bloom stage of each seedling (5 flowers of each inflorescence only retain the central flower, and all others are thinned). And (5) carrying out conventional management without bagging young fruits.

6. Acquisition of new functional apple strain' function No.1

In 2016, month 9, a new functional apple line 'function 1' was selected from the backcross progeny population (see figure 8). The 'function No. 1' pulp is all red, and the peel is all red.

Secondly, analyzing the content of flavonoid, the content of anthocyanin and the antioxidant capacity

The material to be tested: apples grown on 'function number 1', 'apples grown on CSR6R 6-666', and apples grown on 'CSR 6R 6-777'.

1. Measurement of flavonoid content in pulp

(1) Grinding 1g pulp with liquid nitrogen, adding 10ml of 4 deg.C pre-cooled 65% (volume percentage content) ethanol water solution, mixing, standing at 4 deg.C in dark place for extraction for 4h, centrifuging 12000g for 20min, and collecting supernatant.

(2) Taking a test tube, adding 0.5mL of the supernatant obtained in the step (1), and then sequentially adding 1mL of NaNO with the concentration of 5g/100mL₂Aqueous solution, 1ml 10g/100ml AL (NO)₃)₃Mixing the water solution and 4mL of 2M NaOH water solution, standing for 15min, centrifuging at 8000rpm for 10min, collecting supernatant, and measuring light absorption value at 510 nm.

Rutin (rutin, Sigma chemical, ST, Louiis, USA) is used as a standard sample to make a standard curve.

2. Measurement of anthocyanin content in pulp

(1) Grinding 0.5g pulp with liquid nitrogen, adding 5ml 1% hydrochloric acid methanol solution precooled at 4 deg.C, and standing and extracting at 4 deg.C in dark place for 24 hr.

(2) And (2) dividing the extracting solution obtained in the step (1) into 2 parts, each part is 1ml, adding 4ml of KCl buffer solution into the first part, adding 4ml of NaAC buffer solution into the second part, uniformly mixing, standing and extracting for 15min at 4 ℃ in a dark place, then centrifuging for 10min at 8000r/min, and collecting supernatant.

(3) And (3) taking the supernatant obtained in the step (2), and respectively measuring the light absorption values at 510nm and 700 nm.

Anthocyanin content (mg/g) ═ Δ a 5 × 0.005 × 1000 × 449.2/(26900 × 0.5);

△A＝(A_510nm-A_700nm)_{at pH1.0}-(A_510nm-A_700nm)_{At pH4.5}。

In "mg/g", mg means the mass of anthocyanin and g means the fresh weight of pulp.

3. Determination of antioxidant Capacity of pulp

(1) Taking pulp, and grinding with liquid nitrogen to obtain powder.

(2) Weighing 10g of the powder obtained in the step (1), adding 50mL of 80% acetone solution, standing and extracting at 4 ℃ for 2h, centrifuging at 8000rpm for 10min, and collecting the supernatant.

(3) And (3) adding 50mL of 80% acetone solution into the residue obtained in the step (2), standing and extracting at 4 ℃ for 1h, centrifuging at 8000rpm for 10min, and collecting the supernatant.

(4) And (3) combining the supernatant obtained in the step (2) and the supernatant obtained in the step (3) to obtain a mixed solution.

(5) And (4) taking the mixed solution obtained in the step (4), carrying out rotary evaporation at 40 ℃ to remove acetone, centrifuging the residual part at 5000rpm, taking the supernatant, and carrying out constant volume treatment to 20mL by using deionized water to obtain a sample to be detected.

(6)10 parts by volume of acetate buffer, 1 part by volume of 20mM FeCl₃·6H₂The aqueous O solution and 1 part by volume of TPTZ solution were mixed and subjected to a water bath at 37 ℃ for 5 min.

Acetate buffer (ph3.6, 300 mM): 16.8 g glacial acetic acid and 0.8 g sodium hydroxide were made up with water to give a 1l solution.

TPTZ solution: an aqueous solution containing 10mM 2,4, 6-tripyridyltriazine and 40mM hydrochloric acid.

(7) And (4) after the step (6) is finished, mixing 4mL of solution with 30 mu L of sample to be detected, standing and reacting for 120min at 37 ℃, and then measuring the absorbance at 593 nm. And (5) taking Trolox as a standard sample to make a standard curve.

The results are shown in Table 2.

Example 5 organic combination of bud mutation selection and crossbreeding to breed 'functional No. 2' functional apple new line

The procedure of example 4 was followed except that cultivar B was replaced with cultivar I.

In 2016, month 7, a new functional apple line 'function No. 2' was selected from the backcross progeny population (see figure 9). The fruit flesh and the fruit peel of 'function No. 2' are all red.

The results are shown in Table 2.

TABLE 2

Sequence listing

<110> Shandong university of agriculture

<120> method for continuously improving red character of apple by continuous multi-generation bud mutation seed selection and combination of seed selection and crossbreeding

<130> GNCYX180711

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 841

<212> DNA

<213> Malus domestica

<400> 1

taggcttgaa gaatcaatta gggatttaca aaatgattaa agggattttg ggtgtttgct 60

gttgccattt ttgaacacaa catcagttcc actactcttt cattttccct caatttctga 120

gcaaccaaac aagtagcatt attgacaaca tactgagctc ctcgtgtcaa ccattcttga 180

aagaatccta ataaagattt ataggcaaat tatgccctag aaaaaattta ataaaaagga 240

ccctgaacac gtaggaaccg gcccgtttgt aacagactga gataggtccg gttctatttc 300

ttaaaaaccc aacacccgct acgttccatt tataaacggg tcggtctggt ccctccaact 360

ttgagcccgg ctcgacttgt gcccactcct aaactaaacc atataaaaac caagatttcc 420

ctttcatctt tcacacatat cacgttactt tccaacaaca attcaacaat cacaacaaat 480

aatcaaccat caagatcata tatcacgtca ctaataaaga caaccttcat aagggttgcc 540

gtagttctct acttgaaatc caattgtcta gcattgtaac cctaagttac agacacaaac 600

ataaacttga gcaacttcta tgcataagaa tctagggttt tggactaact caacagaacc 660

taacaagaaa taatattctg gaccgcttaa cggaatccaa cgaagacaag gtttcggacc 720

actcaacgga acaaataagg aagggatata aaccattcaa cgaaatccat ctttagaata 780

cgcatagtcc cccaatacgg attaaccaag tgagaacata cgccatctga tagcgtggtc 840

c 841

Claims

1. A breeding method of apple comprises a step A and a step B;

the step A comprises the following steps:

carrying out continuous multi-generation bud mutation seed selection on the apple variety C0, wherein the first generation bud mutation seed selection takes the apple variety C0 as a starting variety, each later generation bud mutation seed selection takes a variety obtained by the previous generation bud mutation seed selection as a starting variety, and each generation bud mutation seed selection selects a target variety from branches or plants developed by buds which all meet the following three characters: (a) red bud change occurs; (b) the anthocyanin content of the peel of the apple growing on the branch or plant developed by the bud is more than 2 times of that of the original variety; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant with the developed bud is less than one half of the starting variety;

(ii) the methylation level of the specific DNA molecule ═ (methylation level of amplification product a + methylation level of amplification product b) ÷ 2; the amplification product A is an amplification product obtained by amplification by using a primer F1 and a primer R1 and using the genomic DNA of the apple peel as a template; the amplification product B is an amplification product obtained by amplification by using a primer F2 and a primer R2 and taking the genome DNA of the apple peel as a template;

primer F1: TAGGTTTGAAGAATTAATTAGGGAT, respectively;

primer R1: GGGAAATTTTGGTTTTTATATGGTTTAG, respectively;

primer F2: TTTTATTTTTTATATATATTATGTTATT, respectively;

primer R2: GGATTATGTTATTAGATGGT, respectively;

the step B comprises the following steps:

(1) hybridizing the apple variety A and the apple variety B to obtain hybrid seeds; the apple variety A is apple (Malus domestica) CSR6R 6-666; apple (Malus domestica) CSR6R6-666 with preservation number of CGMCC NO. 13783; the apple variety B is the apple variety obtained in the step A;

2. A method of breeding apples according to claim 1, wherein: the apple variety obtained in the step A meets the following indexes (a) and/or (b): (a) the coloring speed is higher than that of apple variety C0; (b) the color index is greater than apple variety C0.

3. The method of claim 1, wherein: and in the 4 th year of transplanting, performing girdling on the trunk of the seedling at a position 20cm away from the ground, wherein the girdling width is 0.5-1.0cm and the trunk reaches the xylem.

4. The method of claim 1, wherein: and 5, transplanting, and performing the following operations in the full-bloom stage of the seedlings: only the central flower remained in 5 flowers of each inflorescence, and all others were thinned out.

5. The method of any of claims 1 to 4, wherein: and D, the target plant in the step B is a plant with full red pulp.

6. The method of any of claims 1 to 4, wherein: the target plants of the step B are apple plants satisfying the following conditions (f1) and/or (f2) and/or (f3) and/or (f 4): (f1) the flesh is completely red; (f2) high flavonoid content in pulp; (f3) the pulp has high anthocyanin content; (f4) the pulp has high oxidation resistance.

7. A breeding method of apple comprises a third step and a fourth step;

the step C comprises the following steps:

carrying out continuous multi-generation bud mutation seed selection on the apple variety C0, wherein the first generation bud mutation seed selection takes the apple variety C0 as a starting variety, each later generation bud mutation seed selection takes a variety obtained by the previous generation bud mutation seed selection as a starting variety, and each generation bud mutation seed selection selects a target variety from branches or plants developed by buds which all meet the following four characters: (a) red bud change occurs; (b) the anthocyanin content of the peel of the apple growing on the branch or plant developed by the bud is more than 2 times of that of the original variety; (c) the methylation level of the specific DNA molecules of the apple peel growing on the branch or plant with the developed bud is less than one half of the starting variety; (d) the internode length of the branch growing on the branch or plant growing after the bud grows is less than 2 cm;

primer F1: TAGGTTTGAAGAATTAATTAGGGAT, respectively;

primer R1: GGGAAATTTTGGTTTTTATATGGTTTAG, respectively;

primer F2: TTTTATTTTTTATATATATTATGTTATT, respectively;

primer R2: GGATTATGTTATTAGATGGT, respectively;

the step D comprises the following steps:

(1) hybridizing the apple variety A and the apple variety B to obtain hybrid seeds; the apple variety A is apple (Malus domestica) CSR6R 6-666; apple (Malus domestica) CSR6R6-666 with preservation number of CGMCC NO. 13783; the apple variety B is the apple variety obtained in the step C;

8. The method of claim 7, wherein: the apple variety obtained in the step C meets the following indexes (a) and/or (b) and/or (c): (a) the coloring speed is higher than that of apple variety C0; (b) the color index is greater than apple variety C0; (c) the internode length of the branch is less than 2 cm.

9. The method of claim 7, wherein: and in the 4 th year of transplanting, performing girdling on the trunk of the seedling at a position 20cm away from the ground, wherein the girdling width is 0.5-1.0cm and the trunk reaches the xylem.

10. The method of claim 7, wherein: and 5, transplanting, and performing the following operations in the full-bloom stage of the seedlings: only the central flower remained in 5 flowers of each inflorescence, and all others were thinned out.

11. The method of any of claims 7 to 10, wherein: and D, the target plant in the step D is a plant with full red pulp.

12. The method of any of claims 7 to 10, wherein: the target plants of the step D are apple plants satisfying the following conditions (f1) and/or (f2) and/or (f3) and/or (f 4): (f1) the flesh is completely red; (f2) high flavonoid content in pulp; (f3) the pulp has high anthocyanin content; (f4) the pulp has high oxidation resistance.