CN108641899A - A kind of pre- point of lid of centrifuge tube - Google Patents
A kind of pre- point of lid of centrifuge tube Download PDFInfo
- Publication number
- CN108641899A CN108641899A CN201810506108.6A CN201810506108A CN108641899A CN 108641899 A CN108641899 A CN 108641899A CN 201810506108 A CN201810506108 A CN 201810506108A CN 108641899 A CN108641899 A CN 108641899A
- Authority
- CN
- China
- Prior art keywords
- receiving cavity
- centrifuge tube
- lid
- point
- baffle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M23/00—Constructional details, e.g. recesses, hinges
- C12M23/40—Manifolds; Distribution pieces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
- C12M23/00—Constructional details, e.g. recesses, hinges
- C12M23/02—Form or structure of the vessel
- C12M23/06—Tubular
Landscapes
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Sustainable Development (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Clinical Laboratory Science (AREA)
- Centrifugal Separators (AREA)
Abstract
The invention discloses a kind of pre- point of lid of centrifuge tube, including receiving cavity, 2~6 mutual disconnected regions are divided into receiving cavity, the size of receiving cavity opening is adapted to centrifuge tube bore.The invention also discloses a kind of centrifuge tube, including tube body and pre- point of lid, it is divided into 2~6 mutual disconnected regions in the receiving cavity of the pre- point of lid.The invention also discloses a kind of reagents to dispense storage in advance, including pre- Fen Gai and lid seal, and are divided into 2~6 mutual disconnected regions in the receiving cavity of the pre- point of lid, the lid seals size and divides cover gab bore to be adapted in advance.The present invention solves the problems, such as that the single dose that cannot premix reagent in advance dispenses in advance, while manual operation heavy workload and easy the problem of polluting during batch liquid separation are carried out before avoidable reaction, ensure, with reaction is originated simultaneously in batch multiple reaction member short time, to uniform nonspecific reaction caused by the reaction time of each centrifuge tube and the operating time of preventing length.
Description
Technical field
The present invention relates to the reaction vessels that biochemical reaction uses, and in particular to a kind of pre- point of lid of centrifuge tube.
Background technology
Most of biochemical reaction is required for a plurality of reagents or sample simultaneously or same reaction compartment is added portionwise (as centrifuged
The tube bottom such as pipe, PCR pipe), detection reaction result is observed or analyzed after mixing.In experimental study or production application, to prevent not
Same reagent, sample room interaction generate interference to final result, and general each composition is to separate packaging, dynamic defeated, storage, cannot
Premix.Such as even if the PCR premix reagents operated using most judicial convenience carry out PCR detections, it is also desirable to by Taq enzyme premixed liquid, DNA
At least 4~5 kinds of compositions such as template, different primers, aqua sterilisa are separately packed, and are added before reaction after PCR pipe bottom mixes
It is reacted in PCR instrument.
But this reagent assembling form needs user to carry out a large amount of reagent liquid separation work, this is applied to the later stage, especially
It is that large-scale production application brings extensive work, inevitably generates human error and be easy to cause pollution.It is with PCR
Example, study on large sample or production application often face problems with：(1) reagent divides sample heavy workload, uninteresting, of high cost, and by instrument
Device precision, degree of being skilled in technique and sense of responsibility influence greatly, and liquid separation is often to cause the important sources of test error.Although in this regard, having
Finished product liquor removing workstation or automatic liquid separation device go to solve the problems, such as this, but expensive after all, and use cost is high, to ordinary enterprises
User's difficulty has generality；(2) the liquid separation time is long, and reagent is caused to react under non-ideal condition, influences test result standard
True property.Summer is often difficult phase or the problem multiple phase of PCR operations, and an important reason is the sample-adding when sample size is big
It has occurred that non-specific base pairing even extends during liquid separation, so that Unspccific bands or false positive is increased, high temperature makes this
One problem more prominentization, conquering method common at present are to utilize hot start Taq polymerase, or be loaded on ice, but can only also solve
Certainly subproblem；(3) a large amount of liquid separation operations, cause aerosol largely to generate, form the important sources of laboratory PCR pollutions, perhaps
More laboratories are to overcome this phenomenon, need to put into substantial contribution to rationalize laboratory layout, and strengthen laboratory practices.But it is real
It is general often impossible to guard against to test room, the producer is particularly difficult to ordinary enterprises.
Reagent cannot premix need user's liquid separation and a large amount of liquid separation difficulties it is of high cost, be easy pollution this 2 points be clearly lance
Shield, become the obstacle that many biochemistry detection technology widespread adoptions are promoted, also consumes plenty of time, the energy of researcher.
For this problem, storage supplier is dispensed in advance by reagent in the prior art on behalf of concentration liquid separation, but consider to prevent different examinations
Reaction early period between agent, therefore different reagent components are mostly fixed on reaction tube tube bottom in the form of dry powder.The PCR of this form
Reagent dispenses storage and has appeared on the market in advance, easy to use, reduces liquid separation error and pollution, improves efficiency, but due to drying
Cost is too high, holds at high price, while this pre- liquid separation form reduces the flexibility in use of follow-up developer or user,
Therefore market acceptance is low.
Invention content
Goal of the invention：In order to solve to carry out liquid separation heavy workload before reagent cannot be premixed and be reacted in advance and be easy pollution
The problem of, the present invention provides a kind of pre- point of centrifuge tube lid, the present invention also provides a kind of centrifuge tube with pre- point of lid and
It is a kind of to dispense storage in advance with the pre- point of reagent covered.
Technical solution：Pre- point of a kind of centrifuge tube of the present invention covers, including a receiving cavity, in the receiving cavity
It is divided into 2~6 mutual disconnected regions, the size of the receiving cavity opening is adapted to the port bore of centrifuge tube and can
It is inverted in the centrifuge tube.
Preferably, one circle baffle of setting on the outside of the receiving cavity, it is described when receiving cavity is inverted in the centrifuge tube
Baffle is abutted with the port of centrifuge tube.
It is highly preferred that receiving cavity is divided into receiving cavity top and receiving cavity lower part, the accommodating chamber by the baffle
The size of body upper opening is adapted to centrifuge tube bore；The receiving cavity lower dimension adapt to centrifuge tube shelf, centrifuge tube box,
Centrifuge rotor so that pre- point of lid can be placed on centrifuge tube shelf, in centrifuge tube box or centrifuge, design receiving cavity lower part
Purpose is to increase the volume of physical isolation cell, and pre- point of lid can be made to be placed on corresponding centrifuge tube shelf.
Preferably, the baffle is set to the bottom of the receiving cavity so that the receiving cavity is inverted in the centrifugation
When in pipe, the baffle is abutted with the port of centrifuge tube.
Preferably, the receiving cavity is cylindrical shape.
Wherein, centrifuge tube include common centrifuge tube (50mL, 15mL, 10mL, 5mL, 2mL, 1.5mL, 0.5mL and
0.2mL) it is designed, is met according to the specification of above-mentioned centrifuge tube with PCR pipe (0.2mL and 0.1mL), the size of the pre- point of lid
Centrifuge tube tube body and pre- point of lid can form the requirement of sealing structure when being used cooperatively.
A kind of centrifuge tube of the present invention, including at least one tube body and at least one pre- point of lid, the tube body include the
One receiving cavity, the pre- point of lid includes the second receiving cavity, second receiving cavity be divided into 2~6 mutually it is disconnected
The size in region, the second receiving cavity opening is adapted to the port bore of first receiving cavity and can be inverted in institute
It states and forms sealing structure in the first receiving cavity.The second receiving cavity is inverted in the first receiving cavity when use, then will
Centrifuge tube, which carries out centrifugation, can make different reagents or sample enter centrifuge tube bottom.
Wherein, centrifuge tube include common centrifuge tube (50mL, 15mL, 10mL, 5mL, 2mL, 1.5mL, 0.5mL and
0.2mL) it is designed, is met according to the specification of above-mentioned centrifuge tube with PCR pipe (0.2mL and 0.1mL), the size of the pre- point of lid
Centrifuge tube tube body and pre- point of lid can form the requirement of sealing structure when being used cooperatively.
Preferably, one circle baffle of setting on the outside of second receiving cavity, second receiving cavity are inverted in described the
When in one receiving cavity, the baffle is abutted with the port of first receiving cavity.
It is highly preferred that second receiving cavity is divided into the second receiving cavity top and the second receiving cavity by the baffle
Lower part, the size of the second receiving cavity upper opening are adapted to form sealing knot with first receiving cavity port bore
Structure.The second receiving cavity lower dimension adapts to centrifuge tube shelf, centrifuge tube box, centrifuge rotor, designs the second accommodating chamber
The purpose of body lower part is to increase the volume of physical isolation cell, and pre- point of lid can be made to be placed on corresponding centrifuge tube shelf.
Preferably, the baffle is set to the bottom of the second receiving cavity so that second receiving cavity is inverted in described
When in the first receiving cavity, the baffle is abutted with the port of the first receiving cavity.
Preferably, second receiving cavity is cylindrical shape.
Preferably, the centrifuge tube includes multiple tube bodies and multiple pre- point of lid, passes through tube body between each adjacent two tube body
Connector be connected, each adjacent two divide in advance lid between by divide in advance lid attachments be connected, multitube body be in line shape arrangement or tablet
Arrangement.Preferably, the centrifuge tube is 8 unions, 12 unions, 96 unions or 384 unions, wherein 96 unions, 384 unions are tablet
The orifice plate of arrangement.
Wherein, centrifuge tube is multi-joint PCR pipe (0.2mL and 0.1mL), and the size of the pre- point of lid is according to above-mentioned centrifuge tube
Specification is designed, and is met centrifuge tube tube body and can be formed the requirement of sealing structure when dividing lid to be used cooperatively in advance.
The reagent that of the present invention a kind of and centrifuge tube is used cooperatively dispenses storage in advance, including pre- Fen Gai and lid seal, institute
It states lid and is sealed on described pre- point and covers and play sealing function, the pre- point of lid includes a receiving cavity, in the receiving cavity
It is divided into 2~6 mutual disconnected regions, the size at the top of the receiving cavity is adapted to the port bore of centrifuge tube and can
It is inverted in the centrifuge tube.The reagent dispenses storage and is readily transported storage in advance, when use and centrifuge tube or PCR pipe cooperation
It uses, opens lid envelope, so that centrifuge tube or the nozzle of PCR pipe is inverted and form sealing structure with pre- point of lid, then centrifuged
Different reagents or sample are made to enter centrifuge tube or PCR pipe tube bottom.
Preferably, one circle baffle of setting on the outside of the receiving cavity, it is described when receiving cavity is inverted in the centrifuge tube
Baffle is abutted with the port of centrifuge tube.
It is highly preferred that receiving cavity is divided into receiving cavity top and receiving cavity lower part, the accommodating chamber by the baffle
The size of body upper opening is adapted to the port bore of centrifuge tube；The receiving cavity lower dimension adapt to centrifuge tube shelf, from
Heart pipe box, centrifuge rotor so that pre- point of lid can be placed on centrifuge tube shelf, in centrifuge tube box or centrifuge, design accommodating chamber
The purpose of body lower part is to increase the volume of physical isolation cell, and pre- point of lid can be made to be placed on corresponding centrifuge tube shelf.
Preferably, the baffle is set to the bottom of the receiving cavity so that the receiving cavity is inverted in the centrifugation
When in pipe, the baffle is abutted with the port of centrifuge tube.
Preferably, the receiving cavity is cylindrical shape.
The lid package includes caping and lid, and the caping and the lid are fixedly connected to form internal cavities, the lid
One circle baffle of body lower end outside setting abuts to form sealing structure with the baffle that the pre- point of outer side of lid is arranged.
Wherein, centrifuge tube include common centrifuge tube (50mL, 15mL, 10mL, 5mL, 2mL, 1.5mL, 0.5mL and
0.2mL) it is designed, is met according to the specification of above-mentioned centrifuge tube with PCR pipe (0.2mL and 0.1mL), the size of the pre- point of lid
Centrifuge tube tube body and pre- point of lid can form the requirement of sealing structure when being used cooperatively.
Reagent or sample in the pre- point of lid in each physics cell carry out liquid separation by automatic liquid separation device.
Advantageous effect：(1) centrifuge tube designed using the present invention, first can be previously added pre- point by different reagent or sample
Gai Zhong separates different reagents using the physical isolation cell in pre- point of lid or sample prevents to react, and waits for same batch reaction
Pre- point of multiple centrifuge tubes lid all complete sample-adding after, centrifuge tube or the inversion of PCR pipe nozzle are covered and covered at pre- point, is centrifuged simultaneously
Reagent is set to be reacted into centrifuge tube or PCR pipe tube bottom；The Centrifugal tube structure of the present invention can ensure the reaction of same batch
It is carried out at the same time, prevents the generation of nonspecific reaction and uniforms the reaction time of each centrifuge tube；(2) it is designed using the present invention
Reagent dispenses storage in advance, and not only shipping storage is convenient, and can also pre- point of lid and centrifuge tube or PCR pipe cooperation be made by opening lid and being honored as a queen
With, the step of both having eliminated liquid separation, the possibility of PCR experiment pollutions is reduced, and can guarantee that same batch reaction is carried out at the same time, it is uniform
Change the reaction time of each centrifuge tube.
Description of the drawings
Fig. 1 is pre- point of lid schematic diagram in embodiment 1；
Fig. 2 is pre- point of lid schematic diagram in embodiment 2；
Fig. 3 is the centrifuge tube schematic diagram in embodiment 3；
Fig. 4 is the centrifuge tube schematic diagram in embodiment 4；
Fig. 5 is the centrifuge tube schematic diagram in embodiment 6；
Fig. 6 is that the reagent in embodiment 7 dispenses storage schematic diagram in advance；
Fig. 7 is that the reagent in embodiment 8 dispenses storage schematic diagram in advance；
Fig. 8 is the gel imaging system band parting of embodiment 9；
Fig. 9 is that the gel imaging system of embodiment 10 is taken a picture；
Figure 10 is the micrograph of embodiment 11.
Specific implementation mode
1-10 and embodiment do further detailed description to the present invention below in conjunction with the accompanying drawings.
1- divides the receiving cavity of lid in advance；1a- receiving cavity top；1b- receiving cavity lower part；2- divides chamber；3- baffles；4- is managed
The receiving cavity of body；5- Pipe connecting fittings；6- divides lid attachments in advance；The caping of 7- lid envelopes；The lid of 8- lid envelopes；The gear of 9- lid envelopes
Plate.
Embodiment 1
A kind of pre- point of lid suitable for centrifuge tube is shown in Fig. 1, including receiving cavity 1, the receiving cavity 1 is by base and lid
Body is fixedly connected to form, and 2~6 mutual disconnected regions 2, the ruler of the receiving cavity opening are divided into the receiving cavity
It is very little to be adapted to and be inverted in the centrifuge tube with centrifuge tube bore.One circle baffle 3 of setting, accommodates on the outside of the receiving cavity
When cavity is inverted in the centrifuge tube, the baffle is abutted with the port of centrifuge tube.Receiving cavity is divided into appearance by the baffle 3
Receive cavity top 1a and receiving cavity lower part 1b, the height of the receiving cavity lower part 1b is the height of receiving cavity top 1a
1.5 times, the size of the receiving cavity top 1a openings is adapted to centrifuge tube bore；The receiving cavity lower part 1b size fits
In centrifuge tube shelf, centrifuge tube box, centrifuge rotor so that pre- point of lid can be placed on centrifuge tube shelf, centrifuge tube box or centrifuge
Interior, the purpose of design receiving cavity lower part is to increase the volume of physical isolation cell, and it is corresponding that pre- point of lid can be made to be placed on
On centrifuge tube shelf.
Wherein, centrifuge tube include common centrifuge tube (50mL, 15mL, 10mL, 5mL, 2mL, 1.5mL, 0.5mL and
0.2mL) it is designed, is met according to the specification of above-mentioned centrifuge tube with PCR pipe (0.2mL and 0.1mL), the size of the pre- point of lid
Centrifuge tube tube body and pre- point of lid can form the requirement of sealing structure when being used cooperatively.
Embodiment 2
The structure of pre- point of lid is shown in Fig. 2 with embodiment 1, the difference is that baffle 3 is set to the bottom of the receiving cavity 1 so that
When the receiving cavity 1 is inverted in the centrifuge tube, the baffle is abutted with the port of centrifuge tube, and the receiving cavity 1 is
It is cylindric.
Wherein, centrifuge tube include common centrifuge tube (50mL, 15mL, 10mL, 5mL, 2mL, 1.5mL, 0.5mL and
0.2mL) it is designed, is met according to the specification of above-mentioned centrifuge tube with PCR pipe (0.2mL and 0.1mL), the size of the pre- point of lid
Centrifuge tube tube body and pre- point of lid can form the requirement of sealing structure when being used cooperatively.
Embodiment 3
A kind of centrifuge tube, is shown in Fig. 3, including tube body and pre- point of lid, and the tube body includes the first receiving cavity 4, described pre- point
Lid includes the second receiving cavity 1, and the size that second receiving cavity 1 is open is suitable with first receiving cavity, 4 port bore
Match and can be inverted in first receiving cavity 4 and form sealing structure, second receiving cavity 1 is divided into 2~6 mutually
Disconnected region 2.The second receiving cavity 1 is inverted in the first receiving cavity 4 when use, then centrifuges centrifuge tube
Different reagents or sample can be made to enter centrifuge tube bottom.
Second receiving cavity, 1 outside setting, one circle baffle 3, second receiving cavity 1 are inverted in described first and hold
When receiving in cavity 4, the baffle 3 is abutted with 4 port of the first receiving cavity；The baffle 3 is by second receiving cavity 1
It is divided into the second receiving cavity top 1a and the second receiving cavity lower part 1b, the height of second receiving cavity lower part 1b is described
The size of 1.5 times of the height of second receiving cavity top 1a, the receiving cavity top 1a openings is adapted to centrifuge tube bore；
The receiving cavity lower part 1b is sized to fit into centrifuge tube shelf, centrifuge tube box, centrifuge rotor so that pre- point of lid can be placed in from
On heart pipe support, in centrifuge tube box or centrifuge, the purpose of design receiving cavity lower part is to increase the volume of physical isolation cell,
And pre- point of lid can be made to be placed on corresponding centrifuge tube shelf.
Wherein, centrifuge tube include common centrifuge tube (50mL, 15mL, 10mL, 5mL, 2mL, 1.5mL, 0.5mL and
0.2mL) it is designed, is met according to the specification of above-mentioned centrifuge tube with PCR pipe (0.2mL and 0.1mL), the size of the pre- point of lid
Centrifuge tube tube body and pre- point of lid can form the requirement of sealing structure when being used cooperatively.
Embodiment 4
The structure of centrifuge tube is shown in Fig. 4 with embodiment 3, the difference is that baffle 3 is set to the bottom of the receiving cavity 1 so that
When second receiving cavity 1 is inverted in first receiving cavity 4, the baffle 3 and the port of the first receiving cavity 4 are supported
It connects；The receiving cavity 1 is cylindrical shape.
Wherein, centrifuge tube include common centrifuge tube (50mL, 15mL, 10mL, 5mL, 2mL, 1.5mL, 0.5mL and
0.2mL) it is designed, is met according to the specification of above-mentioned centrifuge tube with PCR pipe (0.2mL and 0.1mL), the size of the pre- point of lid
Centrifuge tube tube body and pre- point of lid can form the requirement of sealing structure when being used cooperatively.
Embodiment 5
The structure of centrifuge tube is shown in Fig. 5 with embodiment 3, the difference is that the centrifuge tube is 8 unions, including 8 tube bodies and 8
A pre- point of lid, 8 tube bodies are in line shape arrangement, are connected by Pipe connecting fitting 5 between two neighboring tube body, described 8
Divide in advance and covers the shape arrangement that is in line, by dividing lid attachments 6 connected in advance between two neighboring pre- point of lid, the pre- point of lid attachments 6
Point-blank with the baffle on the outside of the lid.
Wherein, the volume of PCR pipe is 0.2mL or 0.1mL.
Embodiment 6
For the structure of centrifuge tube with embodiment 3, the centrifuge tube that difference is is 12 unions, including 12 tube bodies and 12 are pre-
Point lid, 12 tube bodies are in line shape arrangement, are connected by Pipe connecting fitting 5 between two neighboring tube body, described 12 pre-
Point lid be in line shape arrangement, it is two neighboring pre- point lid between by divide in advance lid attachments 6 be connected, the pre- point of lid attachments 6 with
Baffle on the outside of the lid is point-blank.
Wherein, the volume of PCR pipe is 0.2mL or 0.1mL.
Embodiment 7
The reagent that a kind of and centrifuge tube is used cooperatively dispenses storage in advance, sees that Fig. 6, including pre- Fen Gai and lid are sealed, the lid
It is sealed on described pre- point and covers and play sealing function, the pre- point of lid includes a receiving cavity 1, separation in the receiving cavity
Size for 2~6 mutual disconnected regions 2, the receiving cavity opening is adapted to centrifuge tube bore and can be inverted in institute
It states in centrifuge tube.The reagent dispenses storage and is readily transported storage in advance, is used cooperatively when use, beats with centrifuge tube or PCR pipe
It uncaps envelope, so that centrifuge tube or the nozzle of PCR pipe is inverted and form sealing structure with pre- point of lid, different examinations can be made by then carrying out centrifugation
Agent or sample enter centrifuge tube or PCR pipe tube bottom.1 outside setting of the receiving cavity, one circle baffle 3, receiving cavity 1 are inverted in
When in the centrifuge tube, the baffle 3 is abutted with the port of centrifuge tube.The baffle 3 divides receiving cavity 1 in receiving cavity
The height of portion 1a and receiving cavity lower part 1b, the receiving cavity lower part 1b are 1.5 times of the height of receiving cavity top 1a, institute
The size for stating receiving cavity top 1a openings is adapted to centrifuge tube bore；The receiving cavity lower part 1b is sized to fit into centrifuge tube
Frame, centrifuge tube box, centrifuge rotor so that pre- point of lid can be placed on centrifuge tube shelf, in centrifuge tube box or centrifuge, and design is held
The purpose of cavity lower part received is to increase the volume of physical isolation cell, and pre- point of lid can be made to be placed on corresponding centrifuge tube shelf
On.
The lid package includes caping 7 and lid 8, and the caping 7 and the lid 8 are fixedly connected to form internal cavities, institute
8 lower end outside of lid setting, one circle baffle 9 is stated to abut to form sealing structure with the baffle 3 that the pre- point of outer side of lid is arranged.
Wherein, centrifuge tube include common centrifuge tube (50mL, 15mL, 10mL, 5mL, 2mL, 1.5mL, 0.5mL and
0.2mL) it is designed, is met according to the specification of above-mentioned centrifuge tube with PCR pipe (0.2mL and 0.1mL), the size of the pre- point of lid
Centrifuge tube tube body and pre- point of lid can form the requirement of sealing structure when being used cooperatively.
Embodiment 8
Reagent dispenses storage structure with embodiment 7 in advance, sees Fig. 7, the difference is that baffle 3 is set to the receiving cavity 1
Bottom so that at least part is located at except centrifuge tube after the receiving cavity 1 is inverted, and the receiving cavity 1 is cylindrical shape.
Wherein, centrifuge tube include common centrifuge tube (50mL, 15mL, 10mL, 5mL, 2mL, 1.5mL, 0.5mL and
0.2mL) it is designed, is met according to the specification of above-mentioned centrifuge tube with PCR pipe (0.2mL and 0.1mL), the size of the pre- point of lid
Centrifuge tube tube body and pre- point of lid can form the requirement of sealing structure when being used cooperatively.
9 sex identification kit of embodiment
9.1 kits assemble
Three parts will be divided into per single dose pigeon for meat molecular biology sex identification reagent, i.e.,：PCR Master Mix (raw works
Taq PCR Mix 2 ×, containing blue dyestuff) 25 μ L, 1 μM of dilution primers F (sequence AGAACGTGGCAACAGAGTAC) 12 μ L, 1 μM
Primer R (sequence TGAAATGATCCAGTGCTTGT) 12 μ L are diluted, same three difference point bottom of chamber of pre- point of lid portion is respectively placed in, are covered
Upper cover is sealed, and -20 DEG C save backup.
9.2 kits use
100 times of fresh dove hemodilution takes 1 μ L to be placed in PCR pipe tube bottom；Kit in taking 9.1 carefully removes lid envelope, will be pre-
It point is placed on after being fixed in PCR pipe, centrifuges 10s, taking-up, which is placed in PCR instrument, reacts, reaction condition：95℃5min；94℃
30s, 50 DEG C of 30s, 72 DEG C of 40s, 34 cycles；72℃5min.
9.3 sex identification
1% agarose electrophoresis, EB dyeing, gel imaging system band parting are shown in Fig. 8.Female is two bands (5,7,9,17
Number dove), male is a band (1,11,19,20, No. 13 dove).
10 single-tube rapid ligation kit of embodiment
10.1 kit assembles
It is unable to multigelation due to quickly connecting reagent, conventional rapid ligation kit is done into single-tube, concrete operations are such as
Under：It takes and is sealed with the matched pre- Fen Gai of PCR pipe and lid, will quickly connect reagent per single dose and be divided into two parts, i.e.,：T4DNA
1 μ L of Ligase (NEB companies) (containing 10uints), 2X T4DNA Ligase Buffer [130mM Tris-HCl, 20mM
MgCl2, 2mM DTT, 2mM ATP, 15% polyethylene glycol (PEG6000) (25 DEG C of 7.5@of pH)] and 5 μ L, it is respectively placed in same pre- point
Two differences of lid divide bottom of chamber portion, and close the lid envelope, and -20 DEG C save backup.
10.2 kit uses
1 μ g of pEGFP plasmids (Clontech companies) are taken, by specification is after Nde I, Xba I (NEB companies) double digestion through core
Determine molten to be 8 μ L after sour deposition and purification, each 4 μ L, which are divided to, to be contained in two PCR pipes, and a pipe is developmental tube, and another pipe compares, and takes 10.1
Kit divides lid in advance, carefully removes lid and is honored as a queen and is fixed on developmental tube, and desk centrifuge centrifuges 10s, and centrifugation is in room after vibrating mixing
Temperature stands 10min.1% agarose electrophoresis, EB dyeing compare connection effect, the results showed that experiment after gel imaging system photograph
Group joint efficiency is shown in Fig. 9 up to 90% or more.
The convenient pyrrole Luo Hong-methyl green dye liquor of 11 teaching demonstration kit of embodiment
11.1 preparing solution：
Solution A takes methyl green 2g to be dissolved in 98mL distilled water, and pyronine G 5g is taken to be dissolved in 95mL distilled water.Take 6mL first
Base green solution and 2mL pyrrole Luo Hong solution are added in 16mL distilled water, as A liquid, are put into spare in brown bottle.
Solution B first takes sodium acetate 1.64g, and it is spare to be dissolved to 100mL with distilled water；Acetic acid 1.2mL is taken again, uses distilled water
It is spare to be diluted to 100mL.The sodium acetate solution 30mL prepared and diluted acetic acid 20mL are taken, distilled water 50mL is added.
11.2 kit assembles
Per group's single dose：It takes and is sealed with the pre- Fen Gai of the matched brown of 1.5mL centrifuge tubes and lid, by 50 μ L solution As and 200
μ L solution Bs are respectively placed in same two difference point bottom of chamber of pre- point of lid portion, and close the lid envelope, saves backup.
11.3 kit uses
A fritter onion endepidermis cell is taken, is placed on clean glass slide.11.2 kits are taken to divide lid in advance, carefully
It removes lid and is honored as a queen and be fixed on 1.5mL centrifuge tubes, so that solution is entered after centrifuge tube with hand whipping and gently mix, with pipettor
It takes 50 μ L mixing drops on onion endothelium, dyes 3-5min, covered sucks extra dye liquor with blotting paper.Using aobvious
Micro mirror is observed, the result is shown in Figure 10.
Claims (10)
1. a kind of pre- point of lid of centrifuge tube, which is characterized in that including a receiving cavity, be divided into 2~6 in the receiving cavity
The size in a mutually disconnected region, the receiving cavity opening is adapted to the port bore of centrifuge tube and can be inverted in described
In centrifuge tube.
2. a kind of pre- point of lid of centrifuge tube according to claim 1, which is characterized in that setting one on the outside of the receiving cavity
Baffle is enclosed, when receiving cavity is inverted in the centrifuge tube, the baffle is abutted with the port of centrifuge tube.
3. a kind of pre- point of lid of centrifuge tube according to claim 2, which is characterized in that receiving cavity is divided by the baffle
The size of receiving cavity top and receiving cavity lower part, the receiving cavity upper opening is adapted to the bore of centrifugation pipe port；
Or the baffle is set to the bottom of the receiving cavity so that when the receiving cavity is inverted in the centrifuge tube, the gear
Plate is abutted with the port of centrifuge tube.
4. a kind of centrifuge tube, including at least one tube body and at least one pre- point of lid, which is characterized in that the tube body includes first
Receiving cavity, the pre- point of lid includes the second receiving cavity, and second receiving cavity is divided into 2~6 mutual disconnected areas
The size in domain, the second receiving cavity opening is adapted to the port bore of first receiving cavity and can be inverted in described
Sealing structure is formed in first receiving cavity.
5. a kind of centrifuge tube according to claim 4, which is characterized in that one circle gear of setting on the outside of second receiving cavity
Plate, when second receiving cavity is inverted in first receiving cavity, the end of the baffle and first receiving cavity
Mouth abuts.
6. a kind of centrifuge tube according to claim 5, which is characterized in that second receiving cavity is divided by the baffle
Second receiving cavity top and the second receiving cavity lower part, the size of the second receiving cavity upper opening are held with described first
Receive the port bore adaptation of cavity；Or the baffle is set to the bottom of the second receiving cavity so that second receiving cavity is fallen
When being placed in first receiving cavity, the baffle is abutted with the port of the first receiving cavity.
7. according to a kind of centrifuge tube described in claim 4-6 any one, which is characterized in that the centrifuge tube includes multiple pipes
Body and multiple pre- point of lid, are connected between each adjacent two tube body, each adjacent two passes through between dividing lid in advance by Pipe connecting fitting
Pre- that lid attachments is divided to be connected, multiple tube bodies are in line shape arrangement or tablet arrangement.
8. the reagent that a kind of and centrifuge tube is used cooperatively dispenses storage in advance, including pre- Fen Gai and lid seal, and the lid is sealed on institute
It states pre- point and covers and play sealing function, which is characterized in that the pre- point of lid includes a receiving cavity, is divided in the receiving cavity
2~6 mutual disconnected regions are divided into, the size of the receiving cavity opening is adapted to and can fall with the port bore of centrifuge tube
It is placed in the centrifuge tube.
9. reagent according to claim 8 dispenses storage in advance, which is characterized in that one circle of setting on the outside of the receiving cavity
Baffle, when receiving cavity is inverted in the centrifuge tube, the baffle is abutted with the port of centrifuge tube.
10. reagent according to claim 9 dispenses storage in advance, which is characterized in that receiving cavity is divided by the baffle
Receiving cavity top and receiving cavity lower part, the size of the receiving cavity upper opening are adapted to the port bore of centrifuge tube；
Or the baffle is set to the bottom of the receiving cavity so that when the receiving cavity is inverted in the centrifuge tube, the gear
Plate is abutted with the port of centrifuge tube.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810506108.6A CN108641899A (en) | 2018-05-24 | 2018-05-24 | A kind of pre- point of lid of centrifuge tube |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810506108.6A CN108641899A (en) | 2018-05-24 | 2018-05-24 | A kind of pre- point of lid of centrifuge tube |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108641899A true CN108641899A (en) | 2018-10-12 |
Family
ID=63757697
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810506108.6A Pending CN108641899A (en) | 2018-05-24 | 2018-05-24 | A kind of pre- point of lid of centrifuge tube |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108641899A (en) |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN2472816Y (en) * | 2001-03-22 | 2002-01-23 | 武汉中敏基因工程有限公司 | Multiple sectioned centrifugal tube |
| CN1597462A (en) * | 2003-09-17 | 2005-03-23 | 中山大学达安基因股份有限公司 | Reagent box components container having inside portition |
| CN2784420Y (en) * | 2004-11-10 | 2006-05-31 | 北京博奥生物芯片有限责任公司 | Nest type PCR reaction tube |
| US20090226911A1 (en) * | 2007-12-10 | 2009-09-10 | The Trustees Of The University Of Pennsylvania | Reaction chamber having pre-stored reagents |
| CN203569099U (en) * | 2013-11-08 | 2014-04-30 | 金陵科技学院 | Electric disposable micro tissue grinder |
| CN204958918U (en) * | 2015-08-25 | 2016-01-13 | 广州维伯鑫生物科技有限公司 | Reaction tube of pre -installation fluorescence PCR reagent |
| CN205687905U (en) * | 2016-06-20 | 2016-11-16 | 中国检验检疫科学研究院 | Direct PCR amplification kit |
| CN206570308U (en) * | 2017-02-20 | 2017-10-20 | 北京大有泰莱生物技术有限公司 | PCR reacts sample adding device and detection means |
| CN206970629U (en) * | 2017-07-20 | 2018-02-06 | 温和心 | A kind of paraffin cellular-type ring mediated responses pipe device |
| CN208964919U (en) * | 2018-05-24 | 2019-06-11 | 金陵科技学院 | A kind of centrifuge tube, a kind of centrifuge tube divide lid, a kind of reagent to dispense storage in advance in advance |
| CN114100721A (en) * | 2021-12-09 | 2022-03-01 | 美林美邦（厦门）生物科技有限公司 | Freeze-drying pipe and multi-connected freeze-drying pipe |
-
2018
- 2018-05-24 CN CN201810506108.6A patent/CN108641899A/en active Pending
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN2472816Y (en) * | 2001-03-22 | 2002-01-23 | 武汉中敏基因工程有限公司 | Multiple sectioned centrifugal tube |
| CN1597462A (en) * | 2003-09-17 | 2005-03-23 | 中山大学达安基因股份有限公司 | Reagent box components container having inside portition |
| CN2784420Y (en) * | 2004-11-10 | 2006-05-31 | 北京博奥生物芯片有限责任公司 | Nest type PCR reaction tube |
| US20090226911A1 (en) * | 2007-12-10 | 2009-09-10 | The Trustees Of The University Of Pennsylvania | Reaction chamber having pre-stored reagents |
| CN203569099U (en) * | 2013-11-08 | 2014-04-30 | 金陵科技学院 | Electric disposable micro tissue grinder |
| CN204958918U (en) * | 2015-08-25 | 2016-01-13 | 广州维伯鑫生物科技有限公司 | Reaction tube of pre -installation fluorescence PCR reagent |
| CN205687905U (en) * | 2016-06-20 | 2016-11-16 | 中国检验检疫科学研究院 | Direct PCR amplification kit |
| CN206570308U (en) * | 2017-02-20 | 2017-10-20 | 北京大有泰莱生物技术有限公司 | PCR reacts sample adding device and detection means |
| CN206970629U (en) * | 2017-07-20 | 2018-02-06 | 温和心 | A kind of paraffin cellular-type ring mediated responses pipe device |
| CN208964919U (en) * | 2018-05-24 | 2019-06-11 | 金陵科技学院 | A kind of centrifuge tube, a kind of centrifuge tube divide lid, a kind of reagent to dispense storage in advance in advance |
| CN114100721A (en) * | 2021-12-09 | 2022-03-01 | 美林美邦（厦门）生物科技有限公司 | Freeze-drying pipe and multi-connected freeze-drying pipe |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107129930B (en) | A kind of fully integrated detection of nucleic acids micro-fluidic chip and its application method | |
| CN103403190B (en) | Nucleic acid detection method, and device and kit for use in same | |
| US20150251176A1 (en) | Genetic sample collection systems | |
| CN100389880C (en) | Collection assembly | |
| CN103157400B (en) | Instrument and method for exposing container to multiple areas | |
| US20170176303A1 (en) | Method and device for transferring liquids | |
| US4266681A (en) | Multiple breakpoint resealable ampoule | |
| CN104862216B (en) | High flux visualization total enclosing split type LAMP-LFD detection chip device | |
| CN108641899A (en) | A kind of pre- point of lid of centrifuge tube | |
| CN206089646U (en) | High flux multiplicity biochip system | |
| CN208964919U (en) | A kind of centrifuge tube, a kind of centrifuge tube divide lid, a kind of reagent to dispense storage in advance in advance | |
| US20050250145A1 (en) | On-line chemical reaction system | |
| CN203728843U (en) | Split type LAMP-LFD (loop-mediated isothermal amplification-lateral flow dipstick) chip detection device with characteristics of high throughput, visualization and full closing | |
| WO2019052521A9 (en) | Integrated tubular reaction device | |
| CN219117434U (en) | Closed Crispr/Cas12a nucleic acid detection reaction tube | |
| CN108786951A (en) | A kind of reagent detection pipe and reagent detect tube assembly | |
| CN216550413U (en) | Tube assembly for one-tube reagent freeze-drying and PCR reaction | |
| CN204188621U (en) | A kind of dynamic color method detecting limulus kit for glucan in fungus | |
| CN204255863U (en) | A kind of integrated chemical reaction device for fast detecting | |
| Loten et al. | Developmental validation of the Maxwell® FSC DNA IQ™ Casework kit on the Maxwell® FSC Instrument | |
| EP3399034A1 (en) | Device and method for extracting nucleic acids from biological sample materials with solvent-free reagents | |
| CN105907640A (en) | Container, liquid storing member, cartridge set, and method of manufacturing liquid storing member | |
| CN213895831U (en) | Pipe cap structure for nucleic acid detection reaction pipe and nucleic acid detection reaction pipe | |
| CN102559897B (en) | Primer group for NPT(Noctumal Penile Tumescence)II gene detection, corresponding reagent kit for and use method thereof | |
| CN217809346U (en) | PCR tube cap |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |