CN108624608A

CN108624608A - Target the preparation method and purposes of the forth generation Chimeric antigen receptor of mesothelin

Info

Publication number: CN108624608A
Application number: CN201710160415.9A
Authority: CN
Inventors: 黄飞; 金涛; 王海鹰; 何凤; 史子啸
Original assignee: Shanghai Hrain Biotechnology Co Ltd
Current assignee: Shanghai Hrain Biotechnology Co Ltd
Priority date: 2017-03-17
Filing date: 2017-03-17
Publication date: 2018-10-09
Anticipated expiration: 2037-03-17
Also published as: CN108624608B

Abstract

The present invention relates to the Chimeric antigen receptors and application thereof of targeting mesothelin.Specifically, the present invention provides a kind of polynucleotide sequence, it is selected from：(1) contain the coded sequence of sequentially connected anti-mesothelin single-chain antibody, the coded sequence of people's CD8 α hinge areas, the coded sequence of people's CD8 transmembrane regions, the coded sequence of people's CD28 intracellular regions, the coded sequence of people's 41BB intracellular regions, the coded sequence of people's CD3 ζ intracellular regions, optional EGFR III containing extracellular domain and extracellular domain IV segment coded sequence and people IL15 structural coding sequences polynucleotide sequence；(2) complementary series of (1) described polynucleotide sequence.The present invention also provides the purposes of relevant fusion protein, the carrier containing the coded sequence and the fusion protein, coded sequence, carrier.Meso tEGFR IL15 CART cells prepared by the present invention have specific tumor cell strong killing ability, it has the function of that tracing in vivo and safety switch, CART cells prepared by the present invention can also secrete the IL15 cell factors of high concentration to CART cells prepared by the present invention with tEGFR components.

Description

Target the preparation method and purposes of the forth generation Chimeric antigen receptor of mesothelin

Technical field

The invention belongs to Chimeric antigen receptor fields, and in particular to target Chimeric antigen receptor of mesothelin and application thereof.

Background technology

Cancer of pancreas (Pancreatic Carcinoma) is clinically common alimentary system malignant tumour, is more common in 50 years old Above crowd.Its incidence has apparent regional disparity, and incidence has been in American-European countries in trend is gradually increasing in recent years 4th common malignant tumour occupies the 2nd of the alimentary tract cancer cause of the death, is only second to colorectal cancer, incidence of occult, early symptom Without specificity, Resection Rate is low.In the process of tumor development, very polygenic activation and its expression of product are played Important role, in it is not completely clear in exact molecular mechanism, with modern image and the hair at full speed of endoscopic technic Exhibition clarifies a diagnosis oneself without too big difficulty, but at this time mostly to some symptom and signs and the more apparent cancer of pancreas of Findings Oneself loses best opportunity of operation, and more difficult for the diagnosis of some early stage patients.Therefore seek new treatment means, for cancer of pancreas Treatment be the task of top priority.

In terms of the research of the metastasis and invasion of tumour, mesothelin (Mesothelin) is also the hot spot of current research. Chang in 1996 etc. clones the antigen of monoclonal antibody identification using Cervical Cancer HeLa Cells, and research finds that the antigen exists In normal rnesothelial cells, therefore it is named as Mesothelin.The main reason for tumor patient survival rates low poor prognosis with it Infiltration metastasis is related, and the infiltration metastasis Mechanism Study of tumour is current hot and difficult issue.Mesothelin gene codes are a kind of The precursor protein of 69kDa, the processed embrane-associated protein (i.e. Mesothelin) for forming a 40kDa and a 3lkDa are referred to as For the segment that falls off of megakaryocyte-potentiating factor MPF.Mesothelin height is expressed in kinds of tumors tissue, in serum of ovarian cancer patients Mesothelin mRNA and the expression of protein level height, tissue section strain, which shows to have in Nonviscous protein oophoroma, 66% is in Mesothelin is positive；It being found in the detection of mesothelioma of pleura, 15 cases for being diagnosed as epithelial mesothelioma are all positive, and 4 The sarcomatous celiothelioma of example is all negative；The researchs such as Argani are reported, in the primary pancreatic carcinoma of excision, Immunohistochemical Method detects table Bright 60 have 54 strong positives, and surrounding normal pancreatic tissue is then without Mesothelin reactivities；In other entity tumors point In analysis, official's neck, head, neck, vagina, lung and oesophagus squamous carcinoma frozen section in can find mesothelin immunocompetence, adenocarcinoma of lung, son Endometrial carcinoma, borderline synovial sarcoma and desmoplastic small round cell tumor have a small amount of mesothelin to express, in breast cancer, Thyroid cancer, clear-cell carcinoma, bladder are moved only a little in cell cancer, black cancer and liver cancer or are expressed without Mesothelin.

The biological function of Mesothelin is not yet clear.It is small that Pastan etc. constructs a kind of Mesothelin gene mutations The wild-type mice growth of mouse, these mutant mouses and compatriot and breed identical, and the platelet count of the two does not have Significant difference；There is researches show that Mesothelin to be combined energy mediate cell adhesion with CA 125, thus researchers are also considered as CA 125 and Mesothelin may play an important role in the transfer diffusion of oophoroma；In addition, there is research also to show The expression of Mesothelin genes is adjusted by the signal of interest approach such as Wnt, such as in oophoroma and cancer of pancreas, Wnt signals Transduction pathway sustained activation promotes Mesothelin expression to increase.Although.The function and its carcinogenesis of Mesothelin still has Wait in further clear, but its distribution in the normal tissue it is limited and in the feature of certain tumor tissues height expression, thus Mesothelin can be used as the targeting of tumor specific antibody treatment.

Chimeric antigen receptor (Chimeric Antigen Receptor-T cell, CAR-T) T cell refers to being repaiied through gene After decorations, specific purpose antigen, and the T cell of continuous activation amplification can be identified with MHC non-limiting ways.It is 2012 international thin Born of the same parents, which treat association annual meeting middle finger and go out biological immune cell therapy, has become operation, radiotherapy, the 4th kind for the treatment of tumour outside chemotherapy Means, and future tumors will be become and treat essential means.Chimeric antigen receptor (CAR) is the core component of CAR-T, assigns T Mode non-dependent cell HLA identifies the ability of tumour antigen, this makes the T cell being transformed by CAR compared to nave T cell Surface receptor TCR can identify wider target.The basic engineering of CAR includes a tumor associated antigen (tumor- Associated antigen, TAA) combined area (the scFV sections for being typically derived from monoclonal antibody antigen calmodulin binding domain CaM), one Extracellular hinge area, a transmembrane region and an intracellular signal area.The selection of target antigen for the specificity of CAR, validity with And all it is crucial determinant for the genetic modification T cell safety of itself.

Have 10 in the anti-Mesothelin CAR-T cell therapy clinical tests of ClinicalTrials.gov registrations at present , mainly for malignant tumours such as cancer of pancreas, oophoroma, pleuroma, lung cancer and breast cancer.Carry out in the University of Pennsylvania I phase clinical researches in, patient is that the state of an illness further developed after receiving first-line treatment, and expression of tumor tissue Mesothelin, they receive the T cell treatment for turning CAR mRNA winks.In two generations CAR of this Mesothelin specificity, have There are CD3 ξ and 4-1BB costimulating factor structural domains.The CAR-T survival periods of these Mesothelin specificity are short, in two patients In show antitumor action, it is seen that Mesothelin can be as the antigen of CAR-T cell recognitions, and turns mRNA's in wink Mode is also feasible.The I phase clinical researches that another University of Pennsylvania carries out use slow-virus transfection Mesothelin specific Cs AR.This research for starting from July, 2014 is the malignant pancreatic cancer, epithelial for resistance to chemotherapy Oophoroma and Malignant Epithelium mesothelioma of pleura.In the early stage result of study of 6 patients, 4 patients are in CAR-T cell infusions 28 Stable disease after it.CAR-T cell infusions do not cause acute side reaction, and turn compared to mRNA winks, slow-virus transfection structure The durations of CAR-T cells get a promotion.

Development by clinical test and the analysis to test result, it is thin that researchers fight Mesothelin CAR-T The defect of born of the same parents' therapy in the application has deeper understanding, overcomes presence so as to further carry out targetedly research The problem of.It is to obtain therapeutic efficiency in view of in treatment of solid tumors, promoting CAR-T cells to enter tumor tissues in maximum efficiency Important guarantee.Chemokines CC CL2, University of Pennsylvania Carl June researchs can be largely secreted according to pleural mesothelium oncocyte Group devises while expressing the anti-Mesothelin CAR-T cells of CCL2 receptors CCR2, to pass through the work of CCL2/CCR2 Lethal effect is efficiently played with chemotactic CAR-T cells to tumor tissues.Si Long-Caitlin Cancer center then compares in malignant pleural tumor Compared with the effect of infusion and Systemic infusion CAR-T cells in thoracic cavity, it is found that infusion can make cell duration strong in thoracic cavity, swell Tumor accumulated inside is more, plays better antitumor action.Si Long-Caitlin Cancer center will be with regard to the safety of this kind of infusion Property further carries out clinical research.

It is active medicine that one big advantage of CAR-T cells, which is them, once input, physiological mechanism meeting modulating T cell is put down Weighing apparatus, memory are formed and the amplification of antigen driving.However, this treatment is not perfect enough, T cell can miss the target and attack other groups It knits or amplification amount is excessively high, needed for treatment.It has been included into standard care range in view of CAR-T cells, has designed patient or drug Controllable startup or shutdown mechanism is highly useful come the presence for regulating and controlling CAR-T cells.Due to technical reason, shutdown mechanism is more It is easily applied to T cell.As one of them, iCas9 systems are just in clinical research.For cell when expressing iCas9, use is small Molecular compound can induce iCas9 precursor molecules and form dimer, apoptosis pathway be activated, to realize the purpose of scavenger-cell. In graft versus host disease(GVH disease), small molecule AP1903 has been used for inducing iCas9 dimers and removes T cell, shows this Feasibility (the Clin Cancer Res.2016Apr15 of method；22(8):1875-84.).

In addition, also make CAR-T cells using the scavenging antibody clinically used while expressing these antibody needles To albumen, such as tEGFR, treatment-related toxic reaction generate or treat after the completion of, by giving antibody drug Remove corresponding CAR-T cells (Sci Transl Med 2015；7：275ra22.).

Interleukin 15 (interleukin 15, IL-15) is a kind of cell factor found in 1994, is by 114 The glycoprotein of the 14-15KD sizes of a amino acid composition, belongs to a member in four-helix bundle cytokine family.IL-15 is being tied There is homology with interleukin 2 (interleukin 2, IL-2) on structure, receptor is by the IL-15 receptors a with high-affinity Chain, IL-2/15 receptor βs chain and public chain γ chains composition.Therefore IL-15 has the function of similar in some and IL-2, for example pierces Swash T cell activation and proliferation, enhance NK cell killing activities and B cell is promoted to generate immunoglobulin.Research finds IL- recently 15 have played important function in NK cells, the differentiation of NKT cells and enterocyte, proliferation, activation process, IL-15 with IL-17 is extremely important to the steady-state adjustment of CD8 memory t cells.Research also confirms that IL-15 passes through a kind of special " anti-submission " Mechanism come regulate and control CD8 memory t cells proliferation and NK cells life cycle, i.e., it is a kind of expression IL-15 α chain receptors cell It can be by IL-15 submissions to the cell of expression IL-15 β chains and γ chains.More research shows that IL-15, which is one kind, extensive biology The powerful cell factor for learning function, in addition to there is important adjustment effect to immune system, in non-immunological systems No less important, for example important regulative is also played to skeletal muscle anabolism.

The present invention has carried out dual modification to the CAR of the targeting Mesothelin of structure, and the first reconditioning decorations are the introduction of peace Full switch, that is, tEGFR structures, it can both make to carry out well by tracer in CAR-T cell bodies, it is often more important that this structure can Using the safety switch as CAR-T cells：Appropriate Xidan can be added by being not desired to when it plays a role resists, safely and effectively control infusion The CAR-T cells for Mesothelin target spots play a role in vivo；Second reconditioning decorations are the introduction of IL15 structures, IL15 It is powerful cell factor, has important adjustment effect to immune system, there is the addition of this structure, the CAR- of structure T cell will have stronger strong function.So the present invention not only to CAR-T cells modify but also increase in safety The functionality of CAR-T cells.It lays a good foundation for clinical trial and clinical treatment.

Accumulation with CAR-T cell therapy experiences and constantly improve, application in entity tumor increasingly by All circles pay close attention to.In such circumstances, we will quicken one's step, and utilize itself existing working foundation, R＆D team, medical team Shen It please carry out clinical test, CAR-T cell therapies is pushed to be fast forwarded through on the road of solid tumor.

Invention content

First aspect present invention provides a kind of polynucleotide sequence, and the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected anti-mesothelin single-chain antibody, the coded sequence of people's CD8 α hinge areas, people The coded sequence of CD8 transmembrane regions, the coded sequence of people's CD28 intracellular regions, the coded sequence of people's 41BB intracellular regions, people's CD3 ζ intracellulars The coded sequence of the segment of the coded sequence in area, the III containing extracellular domain of optional EGFR and extracellular domain IV and people's The polynucleotide sequence of IL15 structural coding sequences；With

(2) complementary series of (1) described polynucleotide sequence.

In one or more embodiments, code sequence of the polynucleotide sequence in the anti-mesothelin single-chain antibody Arrange the preceding also coded sequence containing signal peptide.In one or more embodiments, the amino acid sequence such as SEQ of the signal peptide ID NO:Shown in 2 1-22 amino acids.In one or more embodiments, the light chain of the anti-mesothelin single-chain antibody can Become the amino acid sequence such as SEQ ID NO in area:Shown in 2 23-128 amino acids.It is described in one or more embodiments The amino acid sequence of the heavy chain variable region of anti-mesothelin single-chain antibody such as SEQ ID NO:Shown in 2 141-259 amino acids. In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:2 260-306 bit aminos Shown in acid.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the people CD8 transmembrane regions:2 307- Shown in 328 amino acids.In one or more embodiments, the amino acid sequence such as SEQ ID of the people CD28 intracellular regions NO:Shown in 2 329-369 amino acids.In one or more embodiments, the amino acid sequence of the people 41BB intracellular regions Such as SEQ ID NO:Shown in 2 370-417 amino acids.In one or more embodiments, the people CD3 ζ intracellular regions Amino acid sequence such as SEQ ID NO:Shown in 2 418-528 amino acids.In one or more embodiments, the EGFR Segment contain the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or by EGFR extracellular domain III, Extracellular domain IV and transmembrane region composition.In one or more embodiments, the segment of the EGFR contains Human epidermal growth factor receptor 310-646 amino acids sequences, or be made of the 310-646 amino acids sequences of Human epidermal growth factor receptor.Implement in one or more In scheme, the amino acid sequence such as SEQ ID NO of the segment of the EGFR:Shown in 2 577-911 amino acids.At one or In multiple embodiments, coded sequence of the polynucleotide sequence also containing GM-CSF receptor alpha chain signal peptides, the GM-CSF Receptor alpha chain signal peptide is set to the N-terminal of the EGFR segments.In one or more embodiments, the GM-CSF receptor alpha chains The amino acid sequence of signal peptide such as SEQ ID NO:Shown in 2 555-576 amino acids.In one or more embodiments, The polynucleotide sequence also contains the joint sequence for connecting the GM-CSF receptor alpha chains signal peptide and the people CD3 ζ intracellular regions Coded sequence.In one or more embodiments, the amino acid sequence such as SEQ ID NO of the joint sequence:2 529- Shown in 554 amino acids.In one or more embodiments, the amino acid sequence such as SEQ ID of the IL-15 signal peptides NO:Shown in 2 937-965 amino acids.In one or more embodiments, the amino acid sequence such as SEQ of the IL-15 ID NO:Shown in 2 985-1098 amino acids.

In one or more embodiments, the signal peptide before the coded sequence of the anti-mesothelin single-chain antibody Coded sequence such as SEQ ID NO:Shown in 1 1-66 nucleotide sequences.In one or more embodiments, it is described it is anti-between The coded sequence of the light chain variable region of skin element single-chain antibody such as SEQ ID NO:Shown in 1 67-384 nucleotide sequences.One In a or multiple embodiments, the coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-mesothelin single-chain antibody:1 Shown in 421-777 nucleotide sequences.In one or more embodiments, the coded sequence of the people CD8 α hinge areas is such as SEQ ID NO:Shown in 1 778-918 nucleotide sequences.In one or more embodiments, the people CD8 transmembrane regions Coded sequence such as SEQ ID NO:Shown in 1 919-984 nucleotide sequences.In one or more embodiments, the people The coded sequence of CD28 intracellular regions such as SEQ ID NO:Shown in 1 985-1107 nucleotide sequences.Implement in one or more In scheme, the coded sequence such as SEQ ID NO of the people 41BB intracellular regions:Shown in 1 1108-1251 nucleotide sequences. In one or more embodiments, the coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:1 1252-1584 nucleosides Shown in acid sequence.In one or more embodiments, the GM-CSF receptor alpha chains signal peptide and the people CD3 ζ intracellulars are connected The coded sequence of the joint sequence in area such as SEQ ID NO:Shown in 1 1585-1662 nucleotide sequences.At one or more In a embodiment, the coded sequence such as SEQ ID NO of the GM-CSF receptor alpha chains signal peptide:1 1663-1728 nucleosides Shown in acid sequence.In one or more embodiments, the coded sequence such as SEQ ID NO of the segment of the EGFR:1 Shown in 1729-2733 nucleotide sequences.In one or more embodiments, the coded sequence of the IL-15 signal peptides is such as SEQ ID NO:Shown in 1 2896-2952 nucleotide sequences.In one or more embodiments, the segment of the IL-15 Coded sequence such as SEQ ID NO:Shown in 1 2953-3294 nucleotide sequences.

Second aspect of the present invention provides a kind of fusion protein, and the fusion protein is selected from：

(1) contain sequentially connected anti-mesothelin single-chain antibody, people CD8 α hinge areas, people CD8 transmembrane regions, people's CD28 intracellulars Area, the fusion protein of people 41BB intracellular regions and people's CD3 ζ intracellular regions and optional EGFR III containing extracellular domain and extracellular knot The coded sequence of the segment of structure domain IV and the IL15 structural coding sequences of people；With

(2) it is lived in the amino acid sequence that (1) limits by replacing, missing or adding one or several amino acid and retaining Change the active fusion protein derived from (1) of T cell；

Preferably, the anti-mesothelin single-chain antibody is anti-mesothelin monoclonal antibody SS1.

Third aspect present invention provides a kind of nucleic acid constructs, and the nucleic acid constructs contains polynucleotides as described herein Sequence.

In one or more embodiments, the nucleic acid constructs is carrier.In one or more embodiments, institute It is retroviral vector to state nucleic acid constructs, contains replication origin, 3 ' LTR, 5 ' LTR, pis packaging signals, digestion position Point, groundhog hepatitis virus posttranscriptional regulatory element, polynucleotide sequence as described herein, and optional selectable mark Note.

Fourth aspect present invention provides a kind of retrovirus, and the retrovirus contains nucleic acid construct as described herein Object preferably comprises the carrier, the further preferably described retroviral vector.

Fifth aspect present invention provides a kind of T cell of genetic modification, and the cell contains polynucleotides as described herein Sequence, or contain nucleic acid constructs as described herein, or retrovirus as described herein has been infected, or stablize expression this paper institutes The III containing extracellular domain of the fusion protein and optional EGFR stated, the segment of extracellular domain IV and optional transmembrane region, or Stablize and expresses fusion protein as described herein and optional IL-15 segment portions.

Sixth aspect present invention provides a kind of pharmaceutical composition of the T cell containing genetic modification as described herein.

Seventh aspect present invention provides polynucleotide sequence, fusion protein, nucleic acid constructs or reverse transcription as described herein Application of the virus in the T cell for preparing activation.

Eighth aspect present invention offer polynucleotide sequence as described herein, fusion protein, nucleic acid constructs, reverse transcription disease Purposes of the T cell or its pharmaceutical composition of poison or genetic modification in the drug for preparing the disease that treatment mesothelin mediates.

In one or more embodiments, the disease that the mesothelin mediates is oophoroma, mesothelioma of pleura, pancreas The squamous carcinoma of cancer and uterine neck, head, neck, vagina, lung and oesophagus.In one or more embodiments, what the mesothelin mediated Disease is malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.

Description of the drawings

Fig. 1：MSCV-Meso-tEGFR-IL15CAR retrovirus expression vectors (RV-Meso-tEGFR-IL15) are illustrated Figure.SP：Signal peptide；VL：Light chain variable region；Lk：Connector (G₄S)₃；VH：Heavy chain variable region；H：CD8 α hinge areas；TM：CD8 cross-films Area；WPRE：Groundhog hepatitis virus posttranscriptional regulatory element.

Fig. 2：The portion of MSCV-Meso-tEGFR-IL15CAR retrovirus expression vectors (RV-Meso-tEGFR-IL15) Divide sequencing result peak value figure.

Fig. 3 is the 72 hours Meso-tEGFR-IL15CART expression of FCM results show retroviral infection T cell Efficiency

Fig. 4 is that ELISA is detected on RV-Meso CAR-tEGFR-IL15 viral supernatants and Meso-tEGFR-IL15 CART IL15 amounts in clear

Fig. 5 is Meso-tEGFR-IL15 CART cells and target cell co-cultivation the CD107a expression in 5 hours for preparing 5 days

Fig. 6 is the secretion for the 5 hours INF- γ of Meso-tEGFR-IL15 CART cells and target cell co-cultivation for preparing 5 days

Fig. 7 is thin to tumour after the Meso-tEGFR-IL15 CART cells of preparation 5 days co-culture 16 hours with target cell The lethal effect of born of the same parents

Specific implementation mode

The present invention provides a kind of Chimeric antigen receptor (CAR) of targeting mesothelin.The CAR contains sequentially connected anti-mesothelium Plain single-chain antibody, people CD8 transmembrane regions, people CD28 intracellular regions, people 41BB intracellular regions, people CD3 ζ intracellular regions, is appointed at people CD8 α hinge areas The IL15 structure fragments of the segment and people of the III containing extracellular domain and extracellular domain IV of the EGFR of choosing.

Various anti-mesothelin monoclonals well known in the art can be derived from by being suitable for the invention anti-mesothelin single-chain antibody Antibody.Preferably, these monoclonal antibody specificities identify the 296 to 390th amino acids section of mesothelin.

Therefore, in certain embodiments, it is suitable for the invention anti-mesothelin single-chain antibody and contains specific recognition people The light chain variable region and heavy chain variable region of the monoclonal antibody of 296 to 390th amino acids section of mesothelin.Optionally, institute Stating light chain variable region and heavy chain variable region can be linked together by joint sequence.This kind of single-chain antibody that can be illustrated includes but not It is limited to YP218Fv-PE38, YP223 and SS1.In certain embodiments, the monoclonal antibody is SS1.

Form the fusion protein of the present invention, such as light chain variable region and heavy chain variable region, people CD8 of anti-mesothelin single-chain antibody α hinge areas, people CD8 transmembrane regions, people CD28 intracellular regions, 41BB and people's CD3 ζ intracellular regions etc., can be directly connected between each other, or It can be connected by joint sequence.Joint sequence can be the joint sequence suitable for antibody well known in the art, such as containing G and S Joint sequence.In general, connector contains the front and back motif repeated of one or more.For example, the motif can be GGGS, GGGGS, SSSSG, GSGSA and GGSGG.Preferably, which is adjacent in joint sequence, and amino acid is not inserted between repetition Residue.Joint sequence can include that 1,2,3,4 or 5 repetition motif forms.The length of connector can be that 3~25 amino acid are residual Base, such as 3~15,5~15,10~20 amino acid residues.In certain embodiments, joint sequence is more glycine linlcers Sequence.The quantity of glycine is not particularly limited in joint sequence, usually 2~20, such as 2~15,2~10,2~8.It removes Glycine and serine come, and also contain other known amino acid residue in connector, for example, alanine (A), leucine (L), Threonine (T), glutamic acid (E), phenylalanine (F), arginine (R), glutamine (Q) etc..

It should be understood that in gene cloning operation, it is often necessary to design suitable restriction enzyme site, this certainly will be in expressed ammonia Base acid sequence end introduces one or more incoherent residues, and this has no effect on the activity of aim sequence.In order to build Fusion protein, the expression for promoting recombinant protein obtain the recombinant protein being secreted into automatically outside host cell or are conducive to recombinant protein Purifying, it is often necessary to it is other suitable in the ends N-, the ends C- or the albumen of recombinant protein to be added to some amino acid In region, it may for example comprise but be not limited to, suitable joint peptide, signal peptide, leader peptide, end extend etc..Therefore, of the invention The aminoterminal or c-terminus of fusion protein (the i.e. described CAR) can also contain one or more polypeptide fragments, as protein tag.Appoint What suitable label may be used to herein.For example, the label can be FLAG, HA, HA1, c-Myc, Poly-His, Poly-Arg, Strep-TagII, AU1, EE, T7,4A6, ε, B, gE and Ty1.These labels can be used for carrying out albumen pure Change.

The present invention also includes SEQ ID NO:CAR, SEQ ID NO shown in 2 23-528 amino acids sequences:2 23- CAR, SEQ ID NO shown in 911 amino acids sequences:CAR or SEQ ID NO shown in 2 1-528 amino acids sequences:2 Shown in CAR mutant.These mutant include：With the CAR at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity simultaneously retain the biological activity of the CAR (as activation T is thin Born of the same parents) amino acid sequence.The sequence identity between the sequence of BLASTp two comparisons of calculating of such as NCBI can be used.

Mutant further includes：In SEQ ID NO:2 amino acid sequence, SEQ ID NO shown in 23-528:2 23- Amino acid sequence shown in 911, SEQ ID NO:2 amino acid sequence or SEQ ID NO shown in 1-528:Shown in 2 There are one or several biological activities for being mutated (insertion, deletion or substitution) while still retaining the CAR in amino acid sequence Amino acid sequence.Several mutation are often referred within 1-10, such as 1-8,1-5 or 1-3.Substitution is preferably Conservative replaces.For example, in the art, when carrying out conservative replaces with amino acid similar in performance, usually will not Change the function of protein or polypeptide." amino acid similar in performance " includes for example, the amino acid with similar side chain The family of residue, these families include the amino acid (such as lysine, arginine, histidine) with basic side chain, have acid The amino acid (such as aspartic acid, glutamic acid) of property side chain, amino acid (such as the sweet ammonia with uncharged polar side chain Acid, asparagine, glutamine, serine, threonine, tyrosine, cysteine), the amino acid (example with non-polar sidechain Such as alanine, valine, leucine, isoleucine proline, phenylalanine, methionine, tryptophan), have β-branch side The amino acid (such as threonine, valine, isoleucine) of chain and amino acid (such as tyrosine, phenylpropyl alcohol with aromatic side chain Propylhomoserin, tryptophan, histidine).Therefore, in polypeptide of the present invention one is replaced with another amino acid residue from the same side chain class A or several sites, will not be in substantially influences its activity.

The present invention includes encoding the polynucleotide sequence of fusion protein of the present invention.The present invention polynucleotide sequence can be DNA form or rna form.DNA form includes cDNA, genomic DNA or artificial synthesized DNA.DNA can be it is single-stranded or Double-strand.DNA can be coding strand or noncoding strand.The present invention also includes the degeneracy of the polynucleotide sequence of encoding fusion protein Variant encodes identical amino acid sequence but the different nucleotide sequence of nucleotide sequence.

Polynucleotide sequence as described herein can usually use PCR amplification method to obtain.Specifically, can be public according to institute herein The nucleotide sequence opened, especially open reading frame sequence carry out design primer, the commercially available libraries cDNA are used in combination or by art technology The libraries cDNA prepared by conventional method known to personnel expand as template and obtain related sequence.When sequence is longer, usually need Twice or multiple PCR amplification, then the segment that each time amplifies is stitched together by proper order again.For example, In certain embodiments, the polynucleotide sequence such as SEQ ID NO of fusion protein described herein are encoded:1 67-1584 cores Shown in thuja acid, or such as SEQ ID NO:Shown in 1 1-1584 nucleotide.

In certain embodiments, polynucleotide sequence of the invention also includes the nucleotides sequence of the segment of coding EGFR Row.

It is suitable for the invention the EGFR that EGFR can be well known in the art, such as the EGFR from people.EGFR contains the ends N End extracellular domain I and II, extracellular domain III, extracellular domain IV, transmembrane region, membrane-proximal region structural domain and tyrosine-kinase Enzyme domains.Present invention preferably uses truncated EGFR (" tEGFR ", i.e., the segments of EGFR as described herein), do not wrap especially Include the truncated EGFR of its intracellular region (membrane-proximal region structural domain and tyrosine kinase domain).In certain embodiments, also It does not include extracellular domain I and II that further can further be truncated to the EGFR not including intracellular region.Therefore, certain In embodiment, the tEGFR that the present invention uses contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or It is made of the extracellular domain III, extracellular domain IV and transmembrane region of EGFR.In certain embodiments, the tEGFR contains There are the 310-646 amino acids sequences of Human epidermal growth factor receptor, or is made of the 310-646 amino acids sequences of Human epidermal growth factor receptor, wherein the 310-480 amino acids sequences are that the extracellular domain III, 481-620 of Human epidermal growth factor receptor are the extracellular domain IV of Human epidermal growth factor receptor, the 621-646 amino acids are the transmembrane region of Human epidermal growth factor receptor.In certain embodiments, the extracellular knot of the amino acid sequence of the tEGFR Structure domain III and IV such as SEQ ID NO:Amino acid sequence shown in 2 577-888 amino acids.In certain embodiments, institute State the transmembrane domain such as SEQ ID NO of tEGFR:Shown in 2 889-911 amino acids.

To promote the expression of tEGFR, can also targeting sequencing be set in its N-terminal.In certain embodiments, the present invention uses Signal peptide from GM-CSF receptors (" GMCSFR ") α chains.In certain embodiments, the amino acid sequence of the signal peptide is such as SEQ ID NO:Shown in 2 555-576 amino acids.

It in addition to this, can be by the coded sequences of T2A polypeptides by the coded sequence of the signal peptide and tEGFR and the present invention The coded sequence of people CD3 ζ intracellular regions is connected in CAR.In one or more embodiments, the amino acid sequence of the T2A peptides Such as SEQ ID NO:Shown in 2 529-554 amino acids.

Therefore, in certain embodiments, polynucleotide sequence of the invention contains the coded sequence of CAR of the present invention, T2A The coded sequence of the coded sequence of polypeptide, the coded sequence of signal peptide from GM-CSF receptor alpha chains and tEGFR.Certain In embodiment, the sequence such as SEQ ID NO of polynucleotides of the present invention:Shown in 1 67-3294 nucleotide, or such as SEQ ID NO:Shown in 1.

The present invention also relates to nucleic acid constructs, which contains polynucleotide sequence as described herein, Yi Jiyu One or more regulating and controlling sequences of these series of operations connection.Polynucleotide sequence of the present invention can in many ways by Operation is to ensure the expression of the fusion protein (CAR and/or tEGFR).It can basis before nucleic acid constructs is inserted into carrier Difference or the requirement of expression vector and nucleic acid constructs is operated.Change polynucleotide sequence using recombinant DNA method Technology be known in the art.

Regulating and controlling sequence can be suitable promoter sequence.Promoter sequence is usually grasped with the coded sequence of albumen to be expressed The property made connection.Promoter can any nucleotide sequence of transcriptional activity be shown in selected host cell, including dash forward Become, truncated and hybrid promoter, and can be from coding and the homologous or heterologous extracellular or intracellular polypeptide of the host cell Gene obtain.Regulating and controlling sequence can also be suitable transcription terminator sequences, be identified by host cell to terminate the sequence of transcription Row.Terminator sequence is connect with 3 ' end effectors of the nucleotide sequence for encoding the polypeptide.Have in the host cell of selection Any terminator of function can be used in the present invention.Regulating and controlling sequence can also be suitable targeting sequencing, to host cell translation The non-translational region of important mRNA.5 ' ends of targeting sequencing and the nucleotide sequence for encoding the polypeptide are operatively connected.It is selecting Functional any terminator can be used in the present invention in the host cell selected.

In certain embodiments, the nucleic acid constructs is carrier.Usually pass through the more of the present invention that are operably connected Nucleotide sequence is incorporated to expression vector to promoter, and by construct, realizes the expression of polynucleotide sequence of the present invention.The carrier Can be suitable for replicating and integrating eukaryocyte.Typical cloning vector includes that can be used for adjusting it is expected nucleic acid sequence expression Transcription and translation terminator, homing sequence and promoter.

The polynucleotide sequence of the present invention can be cloned into the carrier of many types.For example, plasmid, phagocytosis can be cloned into Grain, phage-derived object, animal virus and clay.Further, carrier is expression vector.Expression vector can be with viral vectors Form is supplied to cell.Viral vector technology be well known in the present art and such as Sambrook etc. (2001, Molecular Cloning:A Laboratory Manual, Cold Spring Harbor Laboratory, New York) It is described in other virology and molecular biology manual.The virus that can be used as carrier includes but not limited to reverse transcription disease Poison, adenovirus, adeno-associated virus, herpesviral and slow virus.

In general, suitable carrier is included in the replication orgin to work at least one organism, promoter sequence, conveniently Restriction enzyme sites and one or more selectable label (for example, WO 01/96584；WO01/29058；And U.S. Patent number 6,326,193)。

For example, in certain embodiments, the present invention uses retroviral vector, the retroviral vector to contain multiple Initiation site processed, 3 ' LTR, 5 ' LTR, pis packaging signals, restriction enzyme site, groundhog hepatitis virus posttranscriptional regulatory element, herein The polynucleotide sequence, and optional selectable label.The groundhog hepatitis virus posttranscriptional regulatory element can The stability of enhanced virus transcript.

One example of suitable promoter is instant early stage cytomegalovirus (CMV) promoter sequence.The promoter sequence Row are can to drive the strong constitutive promoter sequence for being operably coupled to any polynucleotide sequence high level expression thereon Row.Another example of suitable promoter is -1 α of the elongation growth factor (EF-1 α).It is also possible, however, to use other composing types open Promoter sequences, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary cancer viral (MMTV), people are immune scarce It is instant to fall into long end repetition (LTR) promoter of virus (HIV), MoMuLV promoters, avian leukosis virus promoter, Epstein-Barr virus Early promoter, Rous sarcoma virus promoter and people's gene promoter, such as, but not limited to actin promoter, Myosin promoter, ferroheme promoter and creatine kinase promoter.Further, it also contemplates for starting using induction type Son.The use of inducible promoter provides molecular switch, and the induction type that is operably connected can be opened when expressing in the time limit The expression of the polynucleotide sequence of promoter, and expression is being closed when expression is undesirable.The example of inducible promoter Including but not limited to metallothionein promoter, Glucocorticoid promoter, progesterone promoter and tetracycline promoter.

In order to assess the expression of CAR polypeptides or part thereof, the expression vector for being introduced into cell also may include selectable mark Any of gene or reporter or both are remembered, in order to from the cell mass for seeking to be transfected or infect by viral vectors Middle identification and selection expression cell.In other respects, selectable label can be carried on independent section of DNA and be used for corotation Contaminate program.The flank of selectable label and both reporters can all have regulatory sequence appropriate, so as in host It is expressed in cell.Useful selectable marker includes such as antibiotics resistance gene, such as neo etc..

Reporter is used to identify the cell of potential transfection and the functionality for evaluating regulatory sequence.DNA by After introducing recipient cell, the expression of reporter is measured under the suitable time.Suitable reporter may include encoding The base of luciferase, beta galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase or Green Fluorescent Protein gene Cause.Suitable expression system is well known and prepares using known technology or commercially obtain.

The method that gene is introduced cell and gene expression is entered to cell is well known in the art.Carrier can by Any method in this field is easily introduced into host cell, for example, mammal, bacterium, yeast or insect cell.For example, Expression vector can be transferred to host cell by physics, chemistry or biological means.

The physical method that polynucleotides are introduced to host cell includes calcium phosphate precipitation, lipofection, particle bombardment, micro- Injection, electroporation etc..The biological method that interested polynucleotides are introduced to host cell includes being carried using DNA and RNA Body.Include dispersion system of colloid by the chemical means that polynucleotides introduce host cell, such as macromolecular complex, nanometre glue Capsule, microballoon, pearl；With the system based on lipid, including oil in water emulsion, micella, mixed micelle and liposome.

The biological method that polynucleotides are introduced to host cell includes using viral vectors, especially retrovirus vector Body, this has become the most widely used method that gene is inserted into mammal such as people's cell.Other viral vectors can source From slow virus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus etc..Many has been developed based on virus System, for gene transfer to be entered mammalian cell.For example, retrovirus provides the convenience for gene delivery system Platform.By the gene insertion vector of selection and it is packaged into retroviral particle using technology as known in the art.It should Recombinant virus then can be detached and be transferred in vivo or in vitro subject cell.Many retroviral systems are in the art It is known.In some embodiments, using adenovirus vector.Many adenovirus vectors are well known in the art. In one embodiment, slow virus carrier is used.

Therefore, in certain embodiments, the present invention also provides the retrovirus for activating T cell, which contains There are retroviral vector as described herein and corresponding packaging gene, such as gag, pol and vsvg.

It is suitable for the invention various types of T cells that T cell can be various sources.For example, T cell can derive from The PBMC of B cell malignant tumor patient.

It in certain embodiments, can be first with suitable (such as 30~80ng/ml, such as 50ng/ml) after obtaining T cell CD3 antibody stimulation activation, then containing suitable (such as 30~80IU/ml, such as 50IU/ml) IL2 culture mediums carry out It cultivates spare.

Therefore, in certain embodiments, the present invention provides a kind of T cell of genetic modification, the T cell of the genetic modification Containing polynucleotide sequence as described herein, or contain retroviral vector as described herein, or has infected as described herein Retrovirus, or be prepared using method described herein, or stablize and express fusion protein as described herein and optional tEGFR。

The CAR-T cells of the present invention can undergo firm internal T cell and extend and be held with high level in blood and marrow Continue extended time quantum, and forms specific memory T cell.Be not intended to be fettered by any specific theory, encounter and with Afterwards eliminate expression Surrogate antigen target cell after, CAR-T cells of the invention can differentiation in vivo at center remember sample state.

The invention also includes a kind of cell therapy, wherein T cell is expressed CAR as described herein and optionally by genetic modification TEGFR and CAR-T cells by injection need its recipient in.The cell of injection can kill the tumour cell of recipient. Unlike antibody therapy, CAR-T cells can replicate in vivo, generate the long-term persistence that continued tumor can be caused to control.

The anti-tumor immune response caused by CAR-T cells can be active or passive immunity response.In addition, what CAR was mediated Immune response can be a part for adoptive immunotherapy step, and wherein CAR-T cells induction is to the antigen-binding portion dtex in CAR Anisotropic immune response.

Therefore, CAR, its coded sequence, nucleic acid constructs, expression vector, virus and the CAR-T that the present invention can be used are thin The disease of born of the same parents' treatment is preferably the disease that mesothelin mediates.

Specifically, herein, " disease that mesothelin mediates " especially includes various types of oophoromas, mesothelioma of pleura The squamous carcinoma of (such as epithelial mesothelioma), cancer of pancreas and uterine neck, head, neck, vagina, lung and oesophagus.In certain embodiments, The disease that the mesothelin mediates is malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.

The T cell of the CAR- modifications of the present invention can be administered alone or as pharmaceutical composition and diluent and/or and its Such as relevant cell factor of his component or cell mass combine application.Briefly, pharmaceutical composition of the invention may include as CAR-T cells as described herein, with one or more pharmacy or physiologically acceptable carriers, diluent or excipient are combined. Such composition may include buffer solution such as neutral buffered saline, sulfate buffered saline etc.；Carbohydrate such as Portugal Grape sugar, mannose, sucrose or glucan, mannitol；Protein；Polypeptide or amino acid such as glycine；Antioxidant；Chelating agent Such as EDTA or glutathione；Adjuvant (for example, aluminium hydroxide)；And preservative.

The mode that the pharmaceutical composition of the present invention can be suitable for the disease of (or prevention) to be treated is applied.The quantity of application It will be determined by such factor with frequency, such as the illness of patient and the type of patient disease and severity.

When pointing out " effective quantity in immunology ", " antitumor effective quantity ", " tumour-inhibition effective quantity " or " therapeutic dose ", The precise volume of the present composition to be administered can be determined that the age of consideration patient (object), weight, tumour are big by doctor The individual difference of small, infection or metastasis degree and illness.It can usually point out：Include the pharmaceutical composition of T cell described herein It can be with 10⁴To 10⁹The dosage of a cell/kg weight, preferably 10⁵To 10⁶The dosage of a cell/kg weight.T cell composition It can also be with these dosage multiple applications.Cell can be by using well known injection technique in immunotherapy (see for example Rosenberg etc., New Eng.J.of Med.319:1676,1988) it applies.Optimal dose for specific patient and treatment Scheme can simultaneously therefore adjustment for the treatment of be readily determined by medical domain technical staff by monitoring the disease indication of patient.

The application of object composition object can carry out in any convenient manner, including by spray-on process, inject, swallow, defeated Liquid, implantation or transplanting.Compositions described herein can by subcutaneous, intradermal, tumor, in knot, in spinal cord, intramuscular, pass through vein It is administered to patient in interior injection or peritonaeum.In one embodiment, T cell composition of the invention passes through intradermal or subcutaneous note It penetrates and is administered to patient.In another embodiment, T cell composition of the invention is preferably applied by being injected intravenously.T is thin The composition of born of the same parents can be injected directly into tumour, lymph node or infection position.

In some embodiments of the present invention, CAR-T cells of the invention or combinations thereof object can with it is known in the art Other therapies combine.The therapy includes but not limited to chemotherapy, radiotherapy and immunosuppressor.For example, in combination with well known in the art Treatment mesothelin mediate disease radiotherapy or chemotheraping preparation treated.

Herein, " anti-tumor effect " refers to a kind of biological effect, can be by the reduction of gross tumor volume, tumor cell number Reduction, the reduction of transfer number, the increase of life expectancy are indicated with the improvement of the relevant various physiological signs of cancer.

" patient ", " object ", " individual " etc. are used interchangeably herein, and referring to can cause the work of immune response organic Body, such as mammal.Example includes but not limited to people, dog, cat, mouse, rat and its genetically modified organism.

The present invention is using the gene order of Anti-mesothelin antibodies (scFV for being specifically derived from SS1), full genome of the present invention The genetic fragment of Chimeric antigen receptor Mesothelin scFv-CD8H＆TM-CD28-41BB-CD3 ζ-tEGFR-IL15 is synthesized, It is inserted into retroviral vector MSCV, empty carrier MSCV, can be used for recombinating introducing purpose nucleic acid sequence, that is, encode CAR Nucleic acid sequence.Recombinant plasmid packaging virus in 293T cells infects T cell, T cell is made to express the Chimeric antigen receptor. In one embodiment of the invention, realize that the method for transformation of the T lymphocytes of Chimeric antigen receptor genetic modification is to be based on Retroviral Transformation method.This method has transformation efficiency high, and foreign gene can stablize expression, and can shorten external training Support the advantages that T lymphocytes reach the time of clinical number of stages.In transgenosis T lymphocytic cell surfaces, the nucleic acid of conversion passes through Transcription, accurate translation are on it.The retrovirus for the expression CAR that the present invention is obtained is prepared by Retronectin methods CAR-T cells, the efficiency of infection of the CAR-T cells flow cytometer detection CAR after preparing 3 days, ELISA detect CART cell conditioned mediums IL15 secrete, prepare 5 days after CAR-T cells in vitro with the tumour cell of the Mesothelin positives (K562-Mesothelin) Co-culture 5 hours detection CD107a expression and INF- γ secretion, prepare 5 days after CAR-T cells in vitro with Mesothelin Positive tumour cell (K562-Meso) co-cultures the specific killing action of 16 hours detection CAR-T cells against tumor cells (cytotoxicity).Therefore Mesothelin-tEGFR CART-IL15 of the present invention can be in celiothelioma, cancer of pancreas, oophoroma etc. It is applied in treatment.Further, CAR of the invention also carries tEGFR components, and the space conformation of the component can be with drug The monoclonal antibody against EGFR Cetuximab of rank is combined closely, can be as the label of cell surface, while it is thin also to be adapted for T The internal tracking (can be detected by streaming and immunohistochemistry) of born of the same parents；(cetuximab) can also be resisted to remove by appropriate Xidan in vivo, It is anti-that appropriate Xidan can be added when the CAR of the present invention being not intended to play a role, safely and effectively control the CAR-T cells and send out in vivo The effect of waving.Therefore, CAR of the invention also has the function of tracing in vivo and safety switch.

The present invention is described in further detail by reference to following EXPERIMENTAL EXAMPLE.These embodiments are merely for explanation Property purpose provide, be not intended to it is restrictive, unless otherwise prescribed.Therefore, the present invention should not be interpreted in any way as being limited to Lower embodiment, but should be interpreted as including since introduction provided herein will become apparent from any and whole variation. Method used in embodiment and reagent, unless otherwise stated, for the method and reagent of this field routine.

NT cells used in embodiment are the T cell of the untransfected in source same as Example 4, are used as control cell. K562 cell origins are used as control cell in ATCC cell banks for the cell of negative expression mesothelin.K562-Mesothelin Cell (referred to as, K562-Meso) is the K562 stable cell lines for making its height expression mesothelin through genetic engineering means.

Embodiment 1：The determination of Meso CAR-tEGFR-IL15 gene orders

The IL15 sequence informations (NP_000576.1) that people is searched from NCBI site databases, to the 72nd ammonia of mature peptide Base acid N is mutated into D, and sequence is in website http:Codon optimization is carried out on //sg.idtdna.com/site, is ensured in coding ammonia It is more suitable for human cell's expression in the case that base acid sequence is constant.

Each nucleotide sequence and amino acid sequence information are shown in (SEQUNCE ID NO.1-2)

Above-mentioned sequence is attached successively, different restriction enzyme sites is introduced in each sequence junction, is formed complete MesothelinCAR-tEGFR-IL15 gene sequence informations.

Embodiment 2：Include the structure of the viral vectors of the nucleic acid sequence of CAR molecules

By the nucleotide sequence of the CAR molecules prepared in embodiment 1 through NotI (NEB) and EcoRI (NEB) double digestion, warp The sites NotI-EcoRI of retrovirus RV carriers are inserted into T4 ligases (NEB) connection, are transformed into competence E.coli (DH5 α), recombinant plasmid is served Hai Sheng works Bioisystech Co., Ltd to be sequenced, by sequencing result and the NY-ESO-1 being fitted to Whether TCR-aPD1 sequence alignments are correct to verify sequence.Sequencing primer is：

Sense sequences：AGCATCGTTCTGTGTTGTCTC(SEQUNCE ID NO.3)

Antisense sequences:TGTTTGTCTTGTGGCAATACAC(SEQUNCE ID NO.4)

After being sequenced correctly, simultaneously plasmid purification is extracted using the plasmid purification kit of Qiagen companies, plasmid purification Plasmid calcium phosphate method transfects 293T cells and carries out retrovirus Packaging experimentation.

The plasmid map obtained constructed by the present embodiment is as shown in Figure 1.Fig. 2 shows the portion of the retrovirus expression plasmid Divide sequencing result peak value figure.

Embodiment 3：Retrovirus is packed

1. 293T cells should be less than for 20 generations in the 1st day, do not cover with excessively.With 0.6*10^6cells/ml bed boards, 10cm Ware adds the DMEM culture mediums of 10ml, mixes well cell, 37 degree of overnight incubations；

It is transfected (being typically bed board 14-18h or so) 2. the 2nd day 293T cell fusion degree reaches 90% or so；Prepare Plasmid composite, it is 12.5ug that the amount of various plasmids, which is Retro backbone (MSCV), and Gag-pol 10ug, VSVg are 6.25ug CaCl₂250ul, H₂O is that 1ml total volumes are 1.25ml；Addition is with plasmid composite isometric in another pipe HBS, be vortexed concussion 20s when adding plasmid composite.Softly mixture is added to along side in 293T wares, 37 degree of cultures 4h removes culture medium, and PBS is washed one time, rejoins the fresh culture of preheating.

3. the 4th day：Packing is stored in -80 degree after collecting supernatant after transfection 48h and being filtered with 0.45um filters, continues to add The fresh DMEM medium of preheating.

Embodiment 4：The T cell of retroviral infection people

1. purer CD3+T cells are obtained with Ficcol separating liquids (oceans Tianjin Hao) separation, with the X-VIVO of serum containing 5%AB (LONZA) culture medium adjustment cell density is 1 × 10⁶/mL.Cell is inoculated into advance with the holes 1ml/ with anti-human 50ng/ml CD3 antibody (Beijing is with vertical Hai Yuan) and 50ng/ml CD28 antibody (Beijing is with vertical Hai Yuan), add the leucocyte of 100IU/ml Interleukin 2 (the double aigrets in Beijing), restrovirus infection in 48 hours is cultivated in stimulation；

2.T after cell activation culture every other day, PBS is diluted to Retronectin (Takara) packets of final concentration of 15 μ g/ml By non-tissue treated culture plates, 24 orifice plates are per 250 μ l of hole.It is protected from light, 4 DEG C spare overnight.

The culture of 3.T cell activations two days later, takes out 2 pieces of 24 orifice plates being coated with, and coating buffer is abandoned in suction, is added containing 2%BSA's HBSS room temperatures close 30min.Confining liquid volume is per 500 μ l of hole, and confining liquid is abandoned in suction, with the HBSS board-washings two containing 2.5%HEPES It is secondary.

4. in virus liquid adding holes, 2ml virus liquids being added per hole, 32 DEG C, 2000g, centrifuge 2h.

5. discarding supernatant liquid, the T cell 1 × 10 after activation is added per hole for 24 orifice plates⁶A, volume 1ml, culture medium is that T is thin IL-2 200IU/ml are added in born of the same parents' culture medium.30 DEG C, 1000g, centrifuge 10min.

6. after centrifugation, culture plate is placed in 37 DEG C, is cultivated in 5%CO2 incubators.

7. after infection for 24 hours, cell suspension is sucked out, 1200rpm, 4 DEG C, 7min is centrifuged.

8. after cell infection, the density of cell is observed daily, adds the T cell culture solution of the 100IU/ml containing IL-2 in due course, The density of T cell is set to maintain 5 × 10⁵/ ml or so, makes cell expand.

Thus to obtain the CART cells of retrovirus shown in embodiment 3 have been infected respectively, it is respectively designated as meso- TEGFR CART cells and meso-t-IL15CART cells.

Embodiment 5：The ratio of T lymphocytes and the expression of surface C AR albumen after flow cytomery infection

72 hours CAR-T cells and NT cells (control group) after infecting are collected by centrifugation respectively, PBS is abandoned after washing 1 time Clearly, PBS after corresponding antibody is protected from light 30min is added to wash, is resuspended, last flow cytomery.CAR+ is by anti-mouse IgG F (ab') antibody (Jackson Immunoresearch) and APC-EGFR antibody tests.

Fig. 3 shows, the retroviral infection T cell being prepared using embodiment 3 is after 72 hours, meso-t-IL15 The expression efficiency of CAR+ is 25.4%.

Embodiment 6：ELISA detects IL15 contents in RT supernatants

72 hours CAR-T supernatants after taking viral supernatants and virus to infect, according to Human IL-15 Immunoassay The operational manual detection of (R＆D Systems) detects each vial supernatant (Mesothelin-tEGFR, Mesothelin- TEGFR-IL18, Mesothelin-tEGFR-IL15D) and each CART cells (Mesothelin-tEGFR, Mesothelin- TEGFR-IL18, Mesothelin-tEGFR-IL15D) content of IL15 in supernatant.

The result of the present embodiment shows that the content of Mesothelin-tEGFR-IL15 virus liquid supernatants IL15 is in Fig. 4 The content of 5000pg/ml, Mesothelin-tEGFR-IL15 CART cell conditioned mediums IL15 are 700pg/ml.

Embodiment 7：CD107a detection of expression after CAR-T cells are co-cultured with target cell

1. taking one piece of 96 orifice plate of the bottoms V, add CART/NT cells 2*10 per hole⁵A and target cell (K562-Meso)/control is thin Born of the same parents (K562) 2*10⁵It is a, the X-VIVO complete mediums for being free of IL-2 for 100ul are resuspended, BD GolgiStop are added and (contain Often 1 μ l BD GolgiStop are added in 1ml culture mediums in monesin), 2ul CD107a antibody (1 is added per hole:50), 37 DEG C It is incubated 5 hours, collects cell.

2. sample is centrifuged removal culture medium, it is primary that PBS washes cell, 400g, and 4 DEG C centrifuge 5 minutes.Supernatant is abandoned, often pipe adds Enter appropriate specific surfaces antibody (CD107a antibody, Biolegend), resuspension volume 100ul is protected from light incubation 30 minutes on ice.

3. the PBS cleanings cell per effective 3mL 1 time, 400g is centrifuged 5 minutes.Carefully suck supernatant.

4. appropriate PBS is resuspended, flow cytomery CD107a.

As a result it shows in Figure 5.Fig. 5 shows that Meso-tEGFR-IL15 CART cell CD107a expression rates are 24.6%.

Embodiment 8：INF- γ secretions detect after CAR-T cells are co-cultured with target cell

1. taking the CAR-T cells prepared, it is resuspended with Lonza culture mediums, adjustment cell concentration is 1 × 10⁶/mL。

2. experimental group contains target cell (K562-Meso) or negative control cell (K562) 2 × 10 per hole⁵It is a, CAR-T cells 2×10⁵A, 200 μ l are free of the Lonza culture mediums of IL-2.It is added after mixing well in 96 orifice plates.BD is added simultaneously GolgiPlug (contains BFA, 1 μ l BD GolgiPlug are added in every 1ml cell culture mediums), after mixing well, 37 DEG C of incubation 5-6 Hour.Cell is collected, as experimental group.

3. the PBS cleanings cell per effective 1mL 1 time, 300g is centrifuged 5 minutes.Supernatant is abandoned, often appropriate specific table is added in pipe Face antibody CAR, CD3, CD4, CD8, resuspension volume 100ul are protected from light incubation 30 minutes on ice.

After 4.PBS washes cell, 250 μ l/EP pipe Fixation/Permeabilization solution are added, 4 DEG C incubate 20 minutes are educated to fix cell and rupture of membranes.With 1 × BD Perm/Wash^TMBuffer cleans cell 2 times, 1mL/ times.

5. carrying out intracellular factor dyeing, appropriate IFN-γ cell factor fluorescence antibody or negative control are taken, with BD Perm/ Wash^TMBuffer is diluted to 50 μ l.The cell for having fixed rupture of membranes is fully resuspended with this antibody diluent, 4 DEG C are protected from light incubation 30min, 1 × BD Perm/Wash^TMThe cleaning cells 2 times of buffer 1mL/ times, are then resuspended with PBS.

6. flow cytomery.

As a result it shows in figure 6.Fig. 6 shows that Meso-tEGFR-IL15 CART cell INF- γ expression rates are 32.5%.

Embodiment 9：CAR-T cells detect tumor specific cell lethal effect after being co-cultured with target cell

1.K562 cells (negative control cell) are resuspended in serum free medium (1640), adjustment cell concentration be 1 × 10⁶/ ml, addition fluorescent dye BMQC (2,3,6,7-tetrahydro-9-bromomethyl-1H, 5Hquinolizino (9, 1-gh) coumarin) to final concentration of 5 μM.

2. mixing, 37 DEG C of incubation 30min.

3. room temperature, 1500rpm centrifuges 5min, abandons supernatant, and cell is resuspended in cytotoxicity culture medium (without phenol red 1640+ 5%AB serum) in, 37 DEG C of incubation 60min.

4. fresh cells toxicity culture medium cleans cell twice, and is resuspended in fresh cells toxicity culture medium, and density 1 × 10⁶/ml。

5. target cell (K562-Meso) is suspended in the PBS containing 0.1%BSA, adjustment a concentration of 1 × 10⁶/ml。

6. fluorescein based dye CFSE (carboxyfluoresceindiacetatesuccinimidyl ester) is added to end A concentration of 1 μM.

7. mixing, 37 DEG C of incubation 10min.

8. after being incubated, being added and being reacted with end mark with the isometric FBS of cell suspension, incubation at room temperature 2min.

9. cleaning cell is simultaneously resuspended in fresh cells toxicity culture medium, density 1 × 10⁶/ml。

10. cleaning effector T cell is simultaneously suspended in cytotoxicity culture medium, adjustment a concentration of 5 × 10⁶/ml。

11. in all experiments, the cytotoxicity of CAR-T cells and the negative control effector T cell (NT) being uninfected by Cytotoxicity compare.

12.CAR-T and NT, according to effector cell：Target cell=5:1,1:1, ratio, in 5ml sterility test pipes (BD Biosciences it) is cultivated, every group of two multiple holes of setting.In each co-cultivation group, target cell 50,000 (50 μ l) is cloudy Property control cell be 50,000 (50 μ l).One group of setting simultaneously includes only target cell and negative control cell.

13. co-cultured cell is placed in 37 DEG C of incubation 16h.

14. after the completion of being incubated, PBS cleans cell, the concentration recommended to specifications immediately after rapidly joins 7-AAD (7-aminoactinomycin D), is incubated 30min on ice.

15. being not required to clean, machine testing in streaming is directly carried out, data are analyzed with Flow Jo.

16. it is thin to measure the U266 targets lived after T cell and target cell co-cultivation using the living cells gating of 7AAD feminine genders for analysis The ratio of born of the same parents and K562 negative control cells living.

17. the T cell for each group of co-cultivation and target cell

The target cell survival % of cytotoxic killer cell %=100- calibrations, i.e., (target cell lives thin when no effector cell Born of the same parents' number-when containing effector cell target cell viable count)/control cell viable count ratio.

As a result it shows in the figure 7.The results show that being 5 in effect target ratio:In the case of 1, Meso-tEGFR-IL15 CART cells Killing rate to K562-Meso cells is 73%.

Sequence table

<110>The Shanghai bio tech ltd Heng Run Da Sheng

<120>Target the preparation method and purposes of the forth generation Chimeric antigen receptor of mesothelin

<170> PatentIn version 3.3

<210> 1

<211> 3294

<212> DNA

<213>Artificial sequence

<400> 1

atggacttcc aggtgcagat ttttagtttt cttttgatct ccgccagcgt gataatgtca 60

cgaggagata tagagctcac ccagagtccc gcaatcatgt cagcctctcc cggcgaaaaa 120

gtgaccatga cctgtagtgc ttccagttct gttagttata tgcactggta tcaacagaag 180

tccgggacaa gtcctaaacg ctggatttat gacacttcca aactggcttc tggagtgcct 240

gggcggttca gcgggagcgg ttccggtaac tcttacagcc tgaccatctc ttcagtcgaa 300

gctgaagacg atgccacgta ttattgccag caatggagta agcacccact gacatttggg 360

tgcgggacca agcttgaaat aaagggtggc ggcagcgggg gcggaagcgg cgggggaagc 420

caggtgcaac ttcagcaatc aggtcccgag ttggaaaagc cgggagccag cgttaagatc 480

tcatgcaaag ctagcggcta ctctttcaca ggatatacca tgaattgggt caagcaaagc 540

catggaaaat gtttggaatg gatcggactg attaccccct acaacggggc cagctcctac 600

aatcagaaat ttaggggtaa ggccactctc acagtggata aaagctcaag tactgcctat 660

atggacctgc ttagtctgac ctcagaggat agtgccgtgt acttttgtgc cagaggcggt 720

tacgacgggc gagggtttga ctactggggg caggggacga cggttactgt gtctagtacg 780

acaactcccg ctccccggcc tcccacccct gccccaacta ttgcctccca gcctctttcc 840

ttgcgccccg aagcctgcag gcccgcagct gggggcgctg tgcatacaag gggtctcgac 900

ttcgcatgcg acatctacat ttgggcaccc ttggccggga cctgtggagt gctcctcctc 960

agcctggtga tcacactgta ctgcaggtcc aaaagatcta ggctgctgca ttctgattac 1020

atgaacatga cgccgcgccg ccctggtcca accagaaagc attatcagcc ctatgcaccc 1080

cctagagact ttgccgccta tcgttcgaag ttcagtgtcg tgaagagagg ccggaagaag 1140

ctgctgtaca tcttcaagca gcctttcatg aggcccgtgc agactaccca ggaggaagat 1200

ggatgcagct gtagattccc tgaagaggag gaaggaggct gtgagctgag agtgaagttc 1260

tcccgaagcg cagatgcccc agcctatcag cagggacaga atcagctgta caacgagctg 1320

aacctgggaa gacgggagga atacgatgtg ctggacaaaa ggcggggcag agatcctgag 1380

atgggcggca aaccaagacg gaagaacccc caggaaggtc tgtataatga gctgcagaaa 1440

gacaagatgg ctgaggccta ctcagaaatc gggatgaagg gcgaaagaag gagaggaaaa 1500

ggccacgacg gactgtacca ggggctgagt acagcaacaa aagacaccta tgacgctctg 1560

cacatgcagg ctctgccacc aagacgagct aaacgaggct caggcgcgac gaactttagt 1620

ttgctgaagc aagctgggga tgtagaggaa aatccgggtc ccatgttgct ccttgtgacg 1680

agcctcctgc tctgcgagct gccccatcca gccttcctcc tcatcccgcg gaaggtgtgc 1740

aatggcatag gcattggcga gtttaaagat tctctgagca taaatgctac gaatattaag 1800

catttcaaga attgtacttc tattagtggc gacctccata ttcttccggt tgccttcagg 1860

ggtgactctt tcacccacac acctccattg gatccacaag aacttgacat cctgaagacg 1920

gttaaagaga ttacaggctt cctccttatc caagcgtggc ccgagaacag aacggacttg 1980

cacgcctttg agaacctcga aataatacgg ggtcggacga agcaacacgg ccaatttagc 2040

cttgcggttg ttagtctgaa cattacttct ctcggccttc gctctttgaa agaaatcagc 2100

gacggagatg tcatcattag tggaaacaag aacctgtgct acgcgaacac aatcaactgg 2160

aagaagctct tcggtacttc aggccaaaag acaaagatta ttagtaacag aggagagaat 2220

agctgtaagg ctaccggaca agtttgtcac gccttgtgta gtccagaggg ttgctgggga 2280

ccggaaccaa gggattgcgt cagttgccgg aacgtgagtc gcggacgcga gtgtgtggat 2340

aagtgcaatc ttctggaagg ggaaccgcga gagtttgtag aaaattccga atgtatacag 2400

tgtcatcccg agtgtcttcc acaagcaatg aatatcacat gtacagggag gggtcctgat 2460

aactgtatcc aatgtgcaca ctacatagat ggtcctcact gtgtaaagac gtgccccgcc 2520

ggagtaatgg gtgaaaacaa caccctcgtg tggaagtacg ccgatgccgg gcatgtctgt 2580

catttgtgtc atcccaactg cacatatggc tgtaccggtc ctggattgga gggctgtcca 2640

acaaacgggc cgaaaatacc gagtatcgca acaggcatgg tgggagcact tttgcttctc 2700

ctcgttgtcg ccctgggcat cggcttgttc atgcgcgcga aacgagggtc tggagagggt 2760

cggggcagcc ttctgacctg cggtgatgtc gaggagaatc caggcccgat gcgcatctcc 2820

aaaccacatc tcagatccat ctctattcag tgctatctgt gcctgctgct caacagccat 2880

ttcttgacag aagcaggaat acacgtattc atacttggat gtttcagtgc tgggcttccg 2940

aaaactgagg ctaactgggt caacgttata tctgatttga agaaaatcga ggatcttata 3000

cagtccatgc acattgacgc aacactctac actgaatccg acgtgcatcc cagctgtaag 3060

gtaactgcta tgaaatgctt cctgctggaa ttgcaagtaa tatctttgga gagcggtgac 3120

gcaagtatac acgacacggt cgagaacctt atcatcctcg ctaatgattc attgagttcc 3180

aatgggaacg ttactgagtc aggctgtaaa gaatgcgagg agttggagga aaagaatata 3240

aaagagtttc tgcaatcttt cgtccacata gtacagatgt ttattaacac ttcc 3294

<210> 2

<211> 1098

<212> PRT

<213>Artificial sequence

<400> 2

Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser

1 5 10 15

Val Ile Met Ser Arg Gly Asp Ile Glu Leu Thr Gln Ser Pro Ala Ile

20 25 30

Met Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Ser Ala Ser

35 40 45

Ser Ser Val Ser Tyr Met His Trp Tyr Gln Gln Lys Ser Gly Thr Ser

50 55 60

Pro Lys Arg Trp Ile Tyr Asp Thr Ser Lys Leu Ala Ser Gly Val Pro

65 70 75 80

Gly Arg Phe Ser Gly Ser Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile

85 90 95

Ser Ser Val Glu Ala Glu Asp Asp Ala Thr Tyr Tyr Cys Gln Gln Trp

100 105 110

Ser Lys His Pro Leu Thr Phe Gly Cys Gly Thr Lys Leu Glu Ile Lys

115 120 125

Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Gln Val Gln Leu

130 135 140

Gln Gln Ser Gly Pro Glu Leu Glu Lys Pro Gly Ala Ser Val Lys Ile

145 150 155 160

Ser Cys Lys Ala Ser Gly Tyr Ser Phe Thr Gly Tyr Thr Met Asn Trp

165 170 175

Val Lys Gln Ser His Gly Lys Cys Leu Glu Trp Ile Gly Leu Ile Thr

180 185 190

Pro Tyr Asn Gly Ala Ser Ser Tyr Asn Gln Lys Phe Arg Gly Lys Ala

195 200 205

Thr Leu Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Asp Leu Leu

210 215 220

Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg Gly Gly

225 230 235 240

Tyr Asp Gly Arg Gly Phe Asp Tyr Trp Gly Gln Gly Thr Thr Val Thr

245 250 255

Val Ser Ser Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro

260 265 270

Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro

275 280 285

Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp

290 295 300

Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu

305 310 315 320

Ser Leu Val Ile Thr Leu Tyr Cys Arg Ser Lys Arg Ser Arg Leu Leu

325 330 335

His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg

340 345 350

Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg

355 360 365

Ser Lys Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile

370 375 380

Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp

385 390 395 400

Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu

405 410 415

Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly

420 425 430

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

435 440 445

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

450 455 460

Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys

465 470 475 480

Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg

485 490 495

Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala

500 505 510

Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

515 520 525

Arg Ala Lys Arg Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln

530 535 540

Ala Gly Asp Val Glu Glu Asn Pro Gly Pro Met Leu Leu Leu Val Thr

545 550 555 560

Ser Leu Leu Leu Cys Glu Leu Pro His Pro Ala Phe Leu Leu Ile Pro

565 570 575

Arg Lys Val Cys Asn Gly Ile Gly Ile Gly Glu Phe Lys Asp Ser Leu

580 585 590

Ser Ile Asn Ala Thr Asn Ile Lys His Phe Lys Asn Cys Thr Ser Ile

595 600 605

Ser Gly Asp Leu His Ile Leu Pro Val Ala Phe Arg Gly Asp Ser Phe

610 615 620

Thr His Thr Pro Pro Leu Asp Pro Gln Glu Leu Asp Ile Leu Lys Thr

625 630 635 640

Val Lys Glu Ile Thr Gly Phe Leu Leu Ile Gln Ala Trp Pro Glu Asn

645 650 655

Arg Thr Asp Leu His Ala Phe Glu Asn Leu Glu Ile Ile Arg Gly Arg

660 665 670

Thr Lys Gln His Gly Gln Phe Ser Leu Ala Val Val Ser Leu Asn Ile

675 680 685

Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu Ile Ser Asp Gly Asp Val

690 695 700

Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr Ala Asn Thr Ile Asn Trp

705 710 715 720

Lys Lys Leu Phe Gly Thr Ser Gly Gln Lys Thr Lys Ile Ile Ser Asn

725 730 735

Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly Gln Val Cys His Ala Leu

740 745 750

Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu Pro Arg Asp Cys Val Ser

755 760 765

Cys Arg Asn Val Ser Arg Gly Arg Glu Cys Val Asp Lys Cys Asn Leu

770 775 780

Leu Glu Gly Glu Pro Arg Glu Phe Val Glu Asn Ser Glu Cys Ile Gln

785 790 795 800

Cys His Pro Glu Cys Leu Pro Gln Ala Met Asn Ile Thr Cys Thr Gly

805 810 815

Arg Gly Pro Asp Asn Cys Ile Gln Cys Ala His Tyr Ile Asp Gly Pro

820 825 830

His Cys Val Lys Thr Cys Pro Ala Gly Val Met Gly Glu Asn Asn Thr

835 840 845

Leu Val Trp Lys Tyr Ala Asp Ala Gly His Val Cys His Leu Cys His

850 855 860

Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro Gly Leu Glu Gly Cys Pro

865 870 875 880

Thr Asn Gly Pro Lys Ile Pro Ser Ile Ala Thr Gly Met Val Gly Ala

885 890 895

Leu Leu Leu Leu Leu Val Val Ala Leu Gly Ile Gly Leu Phe Met Arg

900 905 910

Ala Lys Arg Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly

915 920 925

Asp Val Glu Glu Asn Pro Gly Pro Met Arg Ile Ser Lys Pro His Leu

930 935 940

Arg Ser Ile Ser Ile Gln Cys Tyr Leu Cys Leu Leu Leu Asn Ser His

945 950 955 960

Phe Leu Thr Glu Ala Gly Ile His Val Phe Ile Leu Gly Cys Phe Ser

965 970 975

Ala Gly Leu Pro Lys Thr Glu Ala Asn Trp Val Asn Val Ile Ser Asp

980 985 990

Leu Lys Lys Ile Glu Asp Leu Ile Gln Ser Met His Ile Asp Ala Thr

995 1000 1005

Leu Tyr Thr Glu Ser Asp Val His Pro Ser Cys Lys Val Thr Ala

1010 1015 1020

Met Lys Cys Phe Leu Leu Glu Leu Gln Val Ile Ser Leu Glu Ser

1025 1030 1035

Gly Asp Ala Ser Ile His Asp Thr Val Glu Asn Leu Ile Ile Leu

1040 1045 1050

Ala Asn Asp Ser Leu Ser Ser Asn Gly Asn Val Thr Glu Ser Gly

1055 1060 1065

Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys Asn Ile Lys Glu Phe

1070 1075 1080

Leu Gln Ser Phe Val His Ile Val Gln Met Phe Ile Asn Thr Ser

1085 1090 1095

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 3

agcatcgttc tgtgttgtct c 21

<210> 4

<211> 22

<212> DNA

<213>Artificial sequence

<223>Primer

<400> 4

tgtttgtctt gtggcaatac ac 22

Claims

1. a kind of polynucleotide sequence, the polynucleotide sequence is selected from：

(1) contain the coded sequence of sequentially connected anti-mesothelin single-chain antibody, coded sequence, the people CD8 of people's CD8 α hinge areas The coded sequence of transmembrane region, the coded sequence of people's CD28 intracellular regions, the coded sequence of people's 41BB intracellular regions, people CD3 ζ intracellular regions The coded sequence of the segment of coded sequence, the III containing extracellular domain of optional EGFR and extracellular domain IV and the IL15 of people The polynucleotide sequence of structural coding sequence；With

(2) complementary series of (1) described polynucleotide sequence.

2. polynucleotide sequence as described in claim 1, which is characterized in that

The polynucleotide sequence also coded sequence containing signal peptide before the coded sequence of the anti-mesothelin single-chain antibody, Preferably, the polynucleotide sequence of the signal peptide such as SEQ ID NO:Shown in 1 1-66 polynucleotides；And/or

The polynucleotide sequence such as SEQ ID NO of the light chain variable region of the anti-mesothelin single-chain antibody:1 67-384 multinuclears Shown in thuja acid；And/or

The polynucleotide sequence such as SEQ ID NO of the heavy chain variable region of the anti-mesothelin single-chain antibody:1 421-777 it is more Shown in nucleotide；And/or

The polynucleotide sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 1 778-918 polynucleotides；And/or

The polynucleotide sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 1 919-984 polynucleotides；And/or

The polynucleotide sequence of the people CD28 intracellular regions such as SEQ ID NO:Shown in 1 985-1107 polynucleotides；And/or

The polynucleotide sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 1 1108-1251 polynucleotides；With/ Or

The polynucleotide sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 1 1252-1584 polynucleotides；With/ Or

The segment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the segment contains 310-646 of Human epidermal growth factor receptor Polynucleotide sequence, or be made of 310-646 polynucleotide sequences of Human epidermal growth factor receptor；It is highly preferred that the multinuclear of the segment Nucleotide sequence such as SEQ ID NO:Shown in 1 1743-2733 polynucleotides；Preferably, the polynucleotide sequence also contains The coded sequence of GM-CSF receptor alpha chain signal peptides, the GM-CSF receptor alpha chains signal peptide are set to the N-terminal of the EGFR segments； Preferably, the polynucleotide sequence of the GM-CSF receptor alpha chains signal peptide such as SEQ ID NO:1 1663-1742 multinuclear glycosides Shown in acid.

The polynucleotide sequence of the human IL-15 intracellular region such as SEQ ID NO:Shown in 1 2953-3294 polynucleotides；It is excellent Selection of land, coded sequence of the polynucleotide sequence also containing human IL-15 signal peptide, the human IL-15 signal peptide are set to institute State the N-terminal of IL-15 segments；Preferably, the polynucleotide sequence of the human IL-15 signal peptide such as SEQ ID NO:1 2896- Shown in 2952 polynucleotides.

3. amino acid sequence as claimed in claim 2, which is characterized in that

The coded sequence such as SEQ ID NO of the signal peptide before the coded sequence of the anti-mesothelin single-chain antibody:2 1- Shown in 22 amino acids sequences；And/or

The coded sequence such as SEQ ID NO of the light chain variable region of the anti-mesothelin single-chain antibody:2 23-128 amino acids sequences Shown in row；And/or

The coded sequence such as SEQ ID NO of the heavy chain variable region of the anti-mesothelin single-chain antibody:2 141-259 amino acids Shown in sequence；And/or

The coded sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 2 260-306 amino acids sequences；And/or

The coded sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 2 307-328 amino acids sequences；And/or

The coded sequence of the people CD28 intracellular regions such as SEQ ID NO:Shown in 2 329-369 amino acids sequences；And/or

The coded sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 2 370-417 amino acids sequences；And/or

The coded sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 418-528 amino acids sequences；And/or

Connect the coded sequence of the joint sequence of the GM-CSF receptor alpha chains signal peptide and the people CD3 ζ intracellular regions such as SEQ ID NO:Shown in 2 555-576 amino acids sequences；And/or

The coded sequence of the segment of the EGFR such as SEQ ID NO:Shown in 2 577-911 amino acids sequences；And/or connection The coded sequence such as SEQ ID NO of the IL-15 signal peptides and joint sequence described in the human IL-15:2 937-965 ammonia Shown in base acid sequence；

The coded sequence of the segment of the human IL-15 such as SEQ ID NO:Shown in 2 985-1098 amino acids sequences.

4. a kind of fusion protein, the fusion protein is selected from：

(1) contain sequentially connected anti-mesothelin single-chain antibody, people CD8 α hinge areas, people CD8 transmembrane regions, people CD28 intracellular regions, The III containing extracellular domain and extracellular domain of the fusion protein of people 41BB intracellular regions and people's CD3 ζ intracellular regions, optional EGFR The coded sequence of the segment of IV and the IL15 structural coding sequences of people；With

(2) by replacing, missing or adding one or several amino acid and retaining activation T in the amino acid sequence that (1) limits The fusion protein derived from (1) of cell activity；

5. fusion protein as claimed in claim 4, which is characterized in that the fusion protein has following one or more special Sign：

The fusion protein also contains signal peptide in the N-terminal of the anti-mesothelin single-chain antibody, it is preferable that the ammonia of the signal peptide Base acid sequence such as SEQ ID NO:Shown in 2 1-22 amino acids；

The amino acid sequence such as SEQ ID NO of the light chain variable region of the anti-mesothelin single-chain antibody:2 23-128 amino acids It is shown；

The amino acid sequence of the heavy chain variable region of the anti-mesothelin single-chain antibody can be such as SEQ ID NO:2 141-259 ammonia Shown in base acid；

The amino acid sequence such as SEQ ID NO of the people CD8 α hinge areas:Shown in 2 260-306 amino acids；

The amino acid sequence of the people CD8 transmembrane regions such as SEQ ID NO:Shown in 2 307-328 amino acids；

The amino acid sequence of the people CD28 intracellular regions such as SEQ ID NO:Shown in 2 329-369 amino acids；

The amino acid sequence of the people 41BB intracellular regions such as SEQ ID NO:Shown in 2 370-417 amino acids；

The amino acid sequence such as SEQ ID NO of the people CD3 ζ intracellular regions:Shown in 2 418-528 amino acids；With

The segment of the EGFR contains the extracellular domain III, extracellular domain IV and transmembrane region of EGFR, or the born of the same parents by EGFR Extracellular portion III, extracellular domain IV and transmembrane region composition；Preferably, the segment contains 310-646 of Human epidermal growth factor receptor Amino acid sequence, or be made of the 310-646 amino acids sequences of Human epidermal growth factor receptor；It is highly preferred that the amino acid sequence of the segment Row such as SEQ ID NO:Shown in 2 577-911 amino acids；Preferably, the fusion protein also contains GM-CSF receptor alpha chains Signal peptide, the GM-CSF receptor alpha chains signal peptide are set to the N-terminal of the EGFR segments；Preferably, the GM-CSF receptor alphas The amino acid sequence of chain signal peptide such as SEQ ID NO:Shown in 2 555-576 amino acids；With

The amino acid sequence of the human IL-15 intracellular region such as SEQ ID NO:Shown in 2 985-1098 amino acids；Preferably, Coded sequence of the amino acid sequence also containing human IL-15 signal peptide, the human IL-15 signal peptide are set to the IL-15 The N-terminal of segment；Preferably, the amino acid sequence of the human IL-15 signal peptide such as SEQ ID NO:2 937-965 amino acids It is shown.

Preferably, the amino acid sequence of the fusion protein such as SEQ ID NO:Shown in 2 23-528 amino acids, or such as SEQ ID NO:Shown in 2 23-911 amino acids, or such as SEQ ID NO:Shown in 2 1-1098 amino acids, or such as SEQ ID NO:Shown in 2.

6. a kind of nucleic acid constructs, the nucleic acid constructs contains the polynucleotide sequence described in any one of claim 1-3；

Preferably, the nucleic acid constructs is carrier；

It is highly preferred that the nucleic acid constructs is retroviral vector, contain replication origin, 3 ' LTR, 5 ' LTR, pis Packaging signal, restriction enzyme site, described in any one of groundhog hepatitis virus posttranscriptional regulatory element and claim 1-3 Polynucleotide sequence.

7. a kind of retrovirus, the retrovirus contains the nucleic acid constructs described in claim 6, preferably comprises described Carrier, the further preferably described retroviral vector.

8. the pharmaceutical composition of a kind of T cell of genetic modification or the T cell containing the genetic modification, which is characterized in that described thin Born of the same parents contain the polynucleotide sequence described in any one of claim 1-3, or containing the nucleic acid constructs described in claim 6, Or the fusion protein described in any one of having infected retrovirus described in claim 7, or stablized expression claim 4-5 With the segment of the III containing extracellular domain of optional EGFR, extracellular domain IV and optional transmembrane region, or stablize expression right It is required that the fusion protein described in any one of 4-5 and optional IL-15 segment portions.

9. the fusion egg described in any one of polynucleotide sequence, claim 4-5 described in any one of claim 1-3 In vain, the nucleic acid constructs described in claim 6 or the retrovirus described in claim 7 are in the T cell for preparing activation Using.

10. the fusion egg described in any one of polynucleotide sequence, claim 4-5 described in any one of claim 1-3 In vain, the nucleic acid constructs described in claim 6, the retrovirus described in claim 7 or gene according to any one of claims 8 The purposes of the T cell of modification or its pharmaceutical composition in the drug for preparing the disease that treatment mesothelin mediates；

Preferably, the disease that the mesothelin mediates is oophoroma, mesothelioma of pleura, cancer of pancreas and uterine neck, head, neck, the moon The squamous carcinoma in road, lung and oesophagus, preferably malignant pleural mesothelioma, cancer of pancreas, oophoroma and lung cancer.