CN108330071B

CN108330071B - Beauveria bassiana strain with insect intestinal infection effect and pest control application thereof

Info

Publication number: CN108330071B
Application number: CN201710043852.2A
Authority: CN
Inventors: 王四宝; 曲爽
Original assignee: Center for Excellence in Molecular Plant Sciences of CAS
Current assignee: Center for Excellence in Molecular Plant Sciences of CAS
Priority date: 2017-01-19
Filing date: 2017-01-19
Publication date: 2021-10-08
Anticipated expiration: 2037-01-19
Also published as: CN108330071A

Abstract

The invention relates to a beauveria bassiana strain with an insect intestinal infection effect and application thereof in pest control. Specifically, the invention relates to Beauveria bassiana (Beauveria bassiana) with a microorganism preservation number of CGMCC No.13180 or spores, mycelium or fermentation products thereof, a composition containing the strain or the spores thereof, a preparation method thereof and application of the strain or the spores thereof in pest control. The strain and the composition of the invention uniquely play a synergistic role in controlling pests (such as lepidoptera and diptera insects) through intestinal infection and intestinal body wall double infection, and have wide application prospects.

Description

Beauveria bassiana strain with insect intestinal infection effect and pest control application thereof

Technical Field

The invention belongs to the field of biotechnology and pesticide. The invention relates to a novel insecticidal fungus strain with both intestinal toxicity and body wall infection and application thereof in pest control, in particular to a novel beauveria bassiana strain infected by insect foregut and application thereof in agriculture and insect-borne pest control.

Background

Insects occupy a predominant population on earth, and many pests pose great threats to human survival and health, such as crop reduction, damage to forestry development, disease transmission, etc. (pediogo & Rice,2014, organization and pest management (wavelet and Press)).

Lepidoptera pests are the most one of the pests in agriculture and forestry, such as pine moth, black cutworm, prodenia litura and the like, and a great amount of manpower, material resources and financial resources are required to be invested every year for controlling the pests so as to reduce the damage of the pests. In addition, mosquito-borne diseases are a serious health-threatening group of diseases such as malaria, dengue fever, Zika and yellow fever, which cause hundreds of millions of infections and millions of deaths each year. In view of the lack of effective vaccines and the growing severity of drug resistance, the main approach to control mosquito-borne diseases has been to cut off their transmission pathways, i.e., to reduce the number of mosquitoes.

At present, pest control mainly depends on a chemical control method, but with the use of a large amount of chemical pesticides, the living environment of human beings is greatly polluted, and pesticide residues in agricultural and sideline products bring great harm to the health of human beings. In addition, the problem of drug resistance of pests is becoming more serious, and the application of chemical pesticides is limited.

Compared with chemical control, biological control has the advantages of safety, effectiveness, durability and the like. In recent years, biological control methods have been increasingly used for pest control, mainly by using natural enemies, parasites or pathogenic bacteria of insects, to achieve long-term effective control of pests (lorto, 2016, Annual Review of Phytopathology, 55).

In biological insecticide, the application of the biocontrol fungus preparation is the most extensive, and the biocontrol fungus preparation has the advantages of wide host range, good safety, easy production, preparation and the like, and is used for controlling pests as the biological insecticide at the earliest. Since 1960, there are 171 fungal pesticide products for biocontrol, mainly derived from: beauveria bassiana (Beauveria bassiana), Beauveria brucei (Beauveria brongniartiii), Metarrhizium anisopliae (Metarrhizium anisopliae), and Isaria fumosorosea (Isaria fumosorosea) (de Faria & Wraight,2007, Biological Control,43, 237-. Currently, entomopathogenic fungi have been widely studied and applied worldwide as an important biological control means.

Beauveria bassiana and Metarhizium robustum have been developed into various preparations for preventing and treating agricultural and forestry pests, but the field prevention and treatment effect is greatly restricted by environmental factors. Particularly In summer when a large number of pests outbreak, factors such as high temperature, strong ultraviolet rays and The like can affect The survival rate of fungi and The toxicity of pesticides, often cause unstable control effect of The microbial inoculum, become important limiting factors influencing The popularization and application of The fungal pesticides, and also become important technical problems In The world (Arthurs,2001, Entomologia Experimentalis et application, 100, 69-76; Braga,2001, Photochemistry and Photobiology,73, 140. mangostia 146; Jaronski,2009, In The science of fungal entomophilogens (Springer), pp.159-185.).

The process of infection and the mechanism of killing by invading the host by the body wall of entomopathogenic fungi has been studied to date, usually by penetrating the blood cavity of the host insect through the body wall, which leads to death of the host (Ortiz-Urquiza & Keyhani,2013, Insects,4(3),357- & 374.). The whole infection process mainly comprises the stages of adhesion of conidia to the insect body wall of a host, spore germination, hypha penetration of the body wall and hypha entering insect haemolymph and mass propagation, and finally the insect host dies due to the large depletion of nutrition. The whole infection period is long, and the influence of environmental factors is large, which is also an important factor for unstable control effect of the fungal pesticide.

Because the insect digestive tract is relatively stable in environment, the influence of ambient climatic conditions can be avoided, and the digestive tract becomes a main path for bacterial and viral infection. Insect intestinal tract is considered as an important site for interaction between pathogenic microorganisms and hosts, especially an important target for invasion of viruses, bacteria and the like into the insect (Sober Lou et al, 2007, Science,318,1640 1642). Bacteria or viruses enter the insect gut by feeding, and the peritrophic membrane is an important barrier for the host to be infected by the bacterial gut. Pathogenic bacteria often converge to chitinases to help them penetrate the peritrophic membrane (Kelkenberg, Odman-Naresh, Muthuksrishnen, & Merzendorfer,2015, institute Biochemistry and Molecular Biology,56,21-28.), while secreting various enzymes and toxins to act on the midgut epithelial cells, eventually entering the blood cavity of the Insect, causing death of the Insect host (Richards and Goodrich-Blair,2010, Applied and Environmental Microbiology,76, 221-229.).

Many researchers have long attempted to find highly virulent pathogenic fungi capable of infecting insects through the gut. However, biocontrol fungi often lack specific gut virulence factors and can only infect the host through body wall contact. In recent years, with the continuous progress of filamentous fungi gene manipulation technology, great progress has been made in the research of genetic manipulation and genetic improvement of fungi. In particular, the enterotoxin VipAal of Vip3A family secreted by Bacillus thuringiensis is introduced into a transgenic engineering strain of beauveria bassiana, so that a certain intestinal insecticidal activity is obtained, and a good attempt is made for realizing the dual-path infection of entomopathogenic fungi (Qin et al, 2010, Applied and Environmental Microbiology,76, 4611-4618.).

In conclusion, although entomopathogenic fungi, especially beauveria bassiana and metarhizium robustum, have been developed into various preparations for controlling agricultural and forestry pests, the field control effect is greatly restricted by environmental factors in view of a single insect body wall infection way, and the entomopathogenic fungi are also technical bottlenecks limiting large-scale popularization and application of fungal pesticides and are urgent to solve international problems. To date, there are very few examples of entomopathogenic fungi infecting host insects through the gut, and the study of their specific molecular mechanisms is still open. In order to solve the limiting factor of the biocontrol fungi in application, the research on novel bacterial strains with intestinal toxicity can effectively expand the development and application of the biocontrol fungi, and the method has very important significance on biological control.

Disclosure of Invention

The invention provides a novel bacterial strain with intestinal toxicity.

In some aspects of the present invention, there is provided a Beauveria bassiana (Beauveria bassiana), wherein the microbial collection number of the Beauveria bassiana is CGMCC No. 13180.

In some embodiments of the invention, the beauveria bassiana is virulent to insect gut infection.

In some embodiments of the invention, the beauveria bassiana is infected through the foregut of the insect.

In some embodiments of the invention, the beauveria bassiana is characterized by gut infection virulence against lepidopteran and dipteran pests.

In other aspects of the present invention, there is provided an insect control composition comprising:

(a) beauveria bassiana and/or spores, mycelia or fermentation products thereof as described herein;

(b) an agriculturally pharmaceutically acceptable carrier and/or adjuvant.

In some embodiments of the invention, the composition is in a dosage form suitable for disinsection through the insect gut or composite disinsection through the insect gut body wall.

In some embodiments of the invention, the composition is in a dosage form that exerts a control effect through insect ingestion.

In some embodiments of the invention, the composition causes an intestinal infection through the insect foregut.

In some embodiments of the invention, the composition is in a dosage form selected from the group consisting of: solution, missible oil, liquid suspending agent, dry suspending agent, wettable powder, dry powder, granules, aqueous solution, poison bait and microcapsule.

In some embodiments of the invention, the insect is selected from the group consisting of: lepidoptera, diptera, or other classes of insects, for example moth or butterfly pests, such as pine moth, cutworm, prodenia litura, peach fruit borer, codling moth, cotton bollworm, cabbage butterfly, diamondback moth, stem borer, wheat moth, potato tuber moth, sweet potato wheat moth; mosquitoes, flies, gadflies, gnats, such as anopheles, culex, aedes, house flies, flower flies, toilet flies, slough flies, biting flies, tsetse flies, blowflies, tingling flies, biting flies, gnats, gna; wherein said other classes of insects include, but are not limited to: orthoptera, coleoptera, isoptera, etc., such as locusts, cockroaches, cockchafers, longicorn, termites, etc.

In some embodiments of the invention, the carrier and/or adjuvant is selected from the group consisting of: solvent, wetting agent, dispersing agent, emulsifier, stabilizer, adhesive, filler, controlled release auxiliary agent, synergist, adhesive, spreader, anti-drift agent, safener, antidote, defoamer, spraying auxiliary agent, warning color, attractant and antifreeze.

In some embodiments of the invention, the composition further comprises one or more components selected from the group consisting of: pesticides, plant growth regulators, fertilizers, and soil conditioners.

In some aspects of the invention, there is provided a method of producing a composition described herein, the method comprising:

culturing, propagating or fermenting beauveria bassiana as described herein to obtain beauveria bassiana as described herein, or spores, mycelia or fermentation products thereof;

mixing the obtained product with an agriculturally pharmaceutically acceptable carrier and/or adjuvant.

In some embodiments, the fermentation is selected from: liquid state fermentation, solid state fermentation and liquid-solid two-phase fermentation.

In some embodiments, the method further comprises isolating, purifying, identifying, concentrating, and/or storing the culture, propagation, or fermentation product.

In some aspects of the invention, a method of controlling pests is provided, the method comprising:

beauveria bassiana, or spores, mycelia, or fermentation products thereof, or a composition as described herein, is applied to a place where pests are present or expected to be present.

In some embodiments of the invention, the pest is present or expected to be present at one or more locations selected from the group consisting of: farmland, vegetable field, orchard, forest, pasture, warehouse, residence and water area.

In some embodiments of the invention, the application is by broadcasting, spraying, pouring, fumigating, soil mixing, seed mixing, brushing.

In some aspects of the invention, there is also provided the use of beauveria bassiana, or spores, mycelia, or fermentation products thereof, as described herein, or a composition as described herein, for pest control.

Any combination of the above-described solutions and features may be made by those skilled in the art without departing from the spirit and scope of the present invention. Other aspects of the invention will be apparent to those skilled in the art in view of the disclosure herein.

Drawings

The present invention will now be further described with reference to the accompanying drawings, wherein the showings are for the purpose of illustrating embodiments of the invention only and not for the purpose of limiting the scope of the invention.

FIG. 1: colony morphology of Beauveria bassiana Bb-bm01 on SDAY medium.

FIG. 2: the silkworm beauveria bassiana Bb-bm01 spore suspension is orally fed by a micropipettor.

FIG. 3: and (3) determining the toxicity of silkworm infected by Beauveria bassiana Bb-bm01 intestinal tract.

A: the mortality rate of the silkworms fed orally with different numbers of Bb-bm01 spores;

b: the mortality rate of the silkworm fed with beauveria bassiana Bb-bm01, Bb2860 and Bb252 orally;

c: the mortality of the silkworm mature larva (fourth day of five instars) infected by the beauveria bassiana Bb-bm01 intestinal tract is shown, wherein the photograph shows the growth of hypha after the silkworm larva treated by the Bb-bm01 is pupated.

FIG. 4: mortality of Beauveria bassiana Bb-bm01 intestinal tract infected clanis bilineata, wherein the photographs show hyphal growth in clanis bilineata three days after death with Triton X-100 treated clanis bilineata and Bb-bm01 treated clarka.

FIG. 5: the mortality rate of silkworm infected by Beauveria bassiana Bb-bm01 body wall, intestinal tract infection and body wall and intestinal tract complex infection.

FIG. 6: mortality of Anopheles stephensi infected with Beauveria bassiana Bb-bm01 intestinal tract infection, wherein the photographs show hyphal growth in Anopheles stephensi three days after death by Bb-bm01 treatment.

FIG. 7: the beauveria bassiana Bb-bm01 spores are orally taken to feed silkworm, and then the paraffin sections PAS of foregut are observed by a microscope.

A: amplifying by 200 times; b: magnification is 400 times.

FIG. 8: and (3) comparing the virulence of the silkworm infected by the Beauveria bassiana Bb-bm01, Bb2860 and Bb252 body walls.

Detailed Description

The invention provides a new strain Bb-bm01 of beauveria bassiana which is infected by insects (such as agricultural and forestry pests and insect-borne pests, in particular lepidoptera pests (such as lepidoptera pests seriously harming crops and forests) and diptera pests (such as diptera pests spreading mosquito-borne diseases such as malaria dengue fever and yellow fever) through both intestinal tracts and body walls.

Tests on the intestinal toxicity of beauveria bassiana Bb-bm01 show that Bb-bm01 has the intestinal infection toxicity to lepidoptera pests, diptera pests and the like. The observation by tissue section staining proves the new way that Bb-bm01 carries out intestinal infection through the insect foregut part. And the insecticidal toxicity of Bb-bm01 is effectively improved by compositely infecting host insects through body wall and intestinal tract. Therefore, the Bb-bm01 can be prepared into biological pesticides for controlling pests. Therefore, the product of the entomogenous fungi insecticide is more durable and effective, the use of chemical pesticides is reduced, and the application value is important.

Beauveria bassiana new strain Bb-bm01 and microorganism preservation information

The new beauveria bassiana strain Bb-bm01 is a new beauveria bassiana strain separated and purified from the bombyx mori batryticatus by the inventor. The bacterial strain is tested to have insect intestinal infection virulence, so that pests can be controlled through intestinal infection and intestinal body wall double infection, and a synergistic insecticidal effect is formed between the two ways. Moreover, Bb-bm01 has also been superior to other Beauveria bassiana known or commonly used in the art only in terms of virulence for infection of insect body walls.

The Bb-bm01 strain of the invention is sent to China general microbiological culture Collection center (CGMCC) for microbiological preservation in 2016, 11 and 22 days, the preservation number is CGMCC No.13180, and the identification result is survival.

Compositions and preparation thereof

The present invention also provides a composition comprising a strain of the invention, which composition is useful for the control of pests, comprising: beauveria bassiana Bb-bm01 of the invention, or spores, mycelium or fermentation products or extracts thereof; and an agriculturally pharmaceutically acceptable carrier and/or adjuvant.

As used herein, the terms "active substance of the present invention" or "pest control active substance of the present invention" are used interchangeably and refer to beauveria bassiana Bb-bm01 of the present invention, or spores, mycelia, or fermentation products thereof, or extracts thereof.

The strain of the present invention can be cultured, propagated, fermented, collected, etc. using a method conventional in the art. For example, the strains of the invention can be cultured and propagated in a suitable medium, which can be a liquid or solid medium, including but not limited to: SDAY, PDA, SDB. Appropriate carbon sources, nitrogen sources, trace elements, pH adjusters, and the like may be added to the basal medium as required.

The beauveria bassiana of the present invention may also produce different types of spores or mixtures thereof under different culture conditions, for example, blastospores (blastospores) and conidia (conidia). Under liquid culture conditions, beauveria bassiana is easy to produce blastospores. The geminium has thin cell wall, poor anti-stress performance and easy inactivation. Under solid culture conditions, beauveria bassiana produces conidia, and the conidia cell wall thickness is generally more biostable than blastospores. Generally, conidia of beauveria bassiana are more resistant to adverse environments than blastospores, and thus conidia thereof are preferably used in pest control. However, blastospores may also be used under special conditions or for specific control subjects.

As the fermentation process of Beauveria bassiana, methods such as liquid submerged fermentation, solid state fermentation and liquid-solid two-phase fermentation can be used, and among them, the liquid-solid two-phase fermentation method is preferably used. Liquid-solid two-phase fermentation for the production of entomopathogenic fungi means that a large amount of hypha or blastospores are rapidly produced through liquid fermentation, and then the hypha or the blastospores are inoculated on a solid nutrient or inert substrate for solid fermentation, so that the solid nutrient or the inert substrate produces the aerial conidia which are closest to the shape of a natural inoculum. The process combines liquid submerged fermentation and solid state fermentation, gives full play to the advantages of the liquid submerged fermentation and the solid state fermentation, overcomes the defects of poor environmental stability and the like of the geminispores produced by pure liquid fermentation, furthest utilizes the advantage of producing the aerial conidia on the solid surface, shortens the growth period of hyphae, and has the advantages of simple and convenient production method, easily obtained raw materials and low energy consumption and cost. And thus are widely used for the production of conidia of entomopathogenic fungi.

The compositions of the present invention also comprise an agriculturally acceptable carrier and/or adjuvant. As used herein, the term "agriculturally acceptable" ingredient is a substance that is suitable for use in a pesticide without unduly adversely affecting the activity of the active substance. As used herein, the term "effective amount" refers to an amount that can have a controlling effect on a target insect. "agriculturally and pharmaceutically acceptable carrier and/or adjuvant" means a natural or synthetic organic or inorganic substance with which the active ingredient is combined to facilitate its application to the plant. Thus, the carrier is generally inert and agriculturally acceptable, especially on the treated plants, and may be, for example, solid (clays, natural or synthetic silicates, silicas, resins, waxes, solid fertilizers, etc.) or liquid (water, alcohols, ketones, petroleum fractions, aromatic or paraffinic hydrocarbons, chlorinated hydrocarbons, liquefied gases, etc.). These carriers or adjuvants are not essential active ingredients per se and do not have an excessively adverse effect on the activity of the essential active substances.

Carriers and/or adjuvants in the compositions of the invention may include, but are not limited to: the anti-drift agent comprises a solvent, a wetting agent, a dispersing agent, an emulsifying agent, a stabilizing agent, an adhesive, a filler, a controlled release auxiliary agent, a synergist, a sticking agent, a spreading agent, an anti-drift agent, a safety agent, an antidote, an antifoaming agent, a spraying auxiliary agent, a warning color and an attractant.

One or more further active substances other than the active substance according to the invention may also be included in the composition according to the invention. Such a combination can provide certain advantages such as, but not limited to: synergistic in pest control, reduced rates of pesticides, reduced environmental hazards, increased operator safety, broad spectrum control, safening of plant toxicity, improved tolerance of non-pest species (e.g., mammals and fish), etc.

Other active substances that may be used in the compositions of the present invention include, but are not limited to: other pesticides, plant growth regulators, fertilizers, soil conditioners, or other agrochemicals.

In some embodiments, the active of the present invention may be applied in combination with one or more other pesticides, including but not limited to: organophosphate insecticides such as chlorpyrifos, diosmetin, dimethoate, malathion, methylhexao penta, and terbufos; pyrethroid insecticides such as: killing pyrethrin (fenvalerate), deltamethrin, fenpropathrin, cyfluthrin, flucythrinate, bifenthrin, cypermethrin, soluble cyhalothrin, ethofenprox, S-fenvalerate, tralomethrin, tefluthrin, cycloprothrin, -cyfluthrin, and flupropathrin; carbamate insecticides, such as: aldicarb, carbaryl, carbofuran, and methomyl; organochlorine insecticides such as endosulfan, endrin, heptachlor, and lindane; benzoylurea insecticides such as: diflubenzuron, chlorfluazuron, teflubenzuron, chlorfluazuron, hexaflumuron, flufenoxuron, and lufenuron; and other pesticides such as: amitraz, tetranychid, fenpyroximate, hexythiazox, spinosad, and imidacloprid; nematicides such as carbofuran, carbosulfan, aldicarb, fenamiphos, oxamyl, cloxaphos, cadusafos.

In some embodiments, the active substances of the present invention may be used in combination with one or more other substances such as plant growth regulators including, for example: captan, chlormequat chloride, ethephon, gibberellins, mepiquat chloride, defoliant, trinexapac-ethyl, imazalil, paclobutrazol, uniconazole, DCPA, tranexamic acid, and other plant growth regulators.

In some embodiments, the active agents of the present invention may be applied in combination with one or more soil conditioners comprising: organic matter such as humus, which promotes the retention of cationic plant nutrients in soil; mixtures of cationic nutrients, such as calcium, magnesium, caustic potash, sodium and hydrogen complexes; or a microbial composition capable of promoting soil conditions conducive to plant growth. Such microbial compositions include, but are not limited to: bacilli, pseudomonas, azotobacter, azospirillum, rhizobia, and indigenous cyanobacteria.

In some embodiments, the active of the present invention may be applied in combination with one or more fertilizers. Such fertilizers include, but are not limited to: nitrogen fertilizers, such as ammonium sulfate, ammonium nitrate and bone meal; phosphate fertilizers, such as perphosphates, triple perphosphates, ammonium sulfate and diammonium sulfate; potash fertilizers, such as chlorides of caustic potash, potassium sulfate and potassium nitrate.

The compositions of the present invention may be in a variety of forms suitable for preparation, storage and administration. The dosage form of the composition may be selected from: solution, missible oil, liquid suspending agent, dry suspending agent, wettable powder, dry powder, granules, aqueous solution, poison bait and microcapsule. For example, the compositions of the present invention may be in the form of a liquid, which may be in the form of a concentrated composition, or a diluted composition which may be readily sprayed onto the plant to be treated.

In some embodiments of the invention, the compositions of the invention are in a dosage form suitable for disinsection through the insect gut or for composite disinsection through the insect gut body wall. In some embodiments of the invention, the composition is in a dosage form that exerts a control effect through insect ingestion. In some embodiments of the invention, the composition infects through the insect gut.

Application of strain and composition

The bacterial strain and the composition can be used for controlling pests through intestinal infection or intestinal body wall complex infection.

Insects that can be controlled with the strains or compositions of the invention include, but are not limited to: lepidoptera, diptera, or other classes of insects, for example, moth or butterfly pests, such as pine moth, cutworm, prodenia litura, peach fruit borer, codling moth, cotton bollworm, cabbage caterpillar, diamond back moth, bagworm moth, stabbing moth, silkworm moth, diamond-back moth, stem borer, dead leaf moth, boat moth, fall webworm, acacia caterpillar, stem borer, wheat moth, potato tuber moth, sweet potato wheat moth, and the like; mosquitoes, flies, gadflies, gnats, such as anopheles, culex, aedes, house flies, flower flies, toilet flies, slough flies, biting flies, tsetse flies, blowflies, tingling flies, biting flies, blowflies, tingling flies, biting flies, stomach flies, lice flies, cattle flies, chironomi mosquitoes, gnats with a bright chest, gnats with a brown foot, gnats, etc. Other classes of insects include, but are not limited to: locust, cockroach, chafer, longicorn, termite, etc.

The strains or compositions of the present invention can be applied to a locus where pests are present or expected to be present to eliminate, reduce or prevent pests caused by the pests. For example, the strain or composition of the present invention can be applied to agricultural fields (e.g., areas where crops such as cereals, cotton, vegetables and fruits are grown or areas where such crops are to be planted), forests (e.g., for forestry protection), pastures, warehouses, residences, waters, and the like where needed. The strains or compositions of the invention may also be used in the field of veterinary medicine, for example for effectively controlling the infestation by endo-and ectoparasites, such as mosquitoes, flies, gadflies, etc., which afflict animals. .

The application mode of the strain or the composition can be sowing, spraying, pouring, fumigating, soil mixing, seed dressing, brushing and the like. One of ordinary skill in the art can select the appropriate formulation and corresponding mode of administration as desired for the particular application.

Furthermore, the strains or compositions of the invention may also be administered in combination with other active substances as desired to additionally provide certain advantages, such as, but not limited to: synergistic effects on pest control, reduced rates of insecticide application, reduced environmental hazards, increased operator safety, broad spectrum control, safening of plant toxicity, improved tolerance of non-pest species (e.g., mammals and fish), etc. Other active substances that may be administered in combination with the strains or compositions of the invention include, but are not limited to: other pesticides, plant growth regulators, fertilizers, soil conditioners, or other agrochemicals (as described above). The active substance according to the invention and the other active substances can be administered simultaneously, consecutively or alternately.

All numerical ranges provided herein are intended to expressly include all numbers between the end points of the ranges and numerical ranges there between. The features mentioned with reference to the invention or the features mentioned with reference to the embodiments can be combined. All the features disclosed in this specification may be combined in any combination, and each feature disclosed in this specification may be replaced by alternative features serving the same, equivalent or similar purpose. Thus, unless expressly stated otherwise, the features disclosed are merely generic examples of equivalent or similar features.

As used herein, "comprising," having, "or" including "includes" comprising, "" consisting essentially of … …, "" consisting essentially of … …, "and" consisting of … …; "consisting essentially of … …", "consisting essentially of … …", and "consisting of … …" are subordinate concepts of "comprising", "having", or "including".

Only a few embodiments of the present invention are described herein. Various combinations, modifications or adaptations of the present invention may occur to those skilled in the art without departing from the spirit and scope of the present invention and such equivalents are intended to be encompassed by the present invention as defined in the following claims.

Examples

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make appropriate modifications and alterations to the present invention, which fall within the scope of the invention.

The experimental procedures for the conditions not specified in the examples below can be carried out by methods conventional in the art, for example, by referring to the molecular cloning, A Laboratory Manual, New York, Cold Spring Harbor Laboratory Press, 1989 or according to the conditions recommended by the supplier. Methods for sequencing DNA are conventional in the art and tests are also available from commercial companies.

Unless otherwise indicated, percentages and parts are by weight. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

Example 1 isolation and identification of Strain Bb-bm01

The strain Bb-bm01 is a new strain of Beauveria bassiana (Beauveria basssiana) separated and purified from bombyx mori batryticatus. Bb-bm01 is obtained by screening specifically according to the following method: under aseptic conditions, the stiff silkworm growing with white hyphae on the whole body is placed above a sterilized SDAY culture medium plate and is shaken slightly, then the SDAY plate is placed in an incubator at 27 ℃ for culturing for 3-4 days, a single colony is picked up to a purification culture medium (SDAY), and the purification culture is carried out in the incubator at 27 ℃. The bacterial colony of a strain similar to beauveria bassiana on the SDAY culture medium is in a velvety round shape, the color is gradually changed into milky white or light yellow, hypha is fluffy, and a powder layer is loose, and the strain is named as Bb-bm01 (figure 1).

Bb-bm01 is delivered to China general microbiological culture Collection center (CGMCC) for microbiological preservation in 2016, 11 and 22 months, the preservation number is CGMCC No.13180, and the identification result is survival.

Mycelia of the strain Bb-bm01 were picked from the SDAY medium, subjected to total DNA extraction, and ITS (internal transcribed spacer) sequences were PCR-amplified, and Bb-bm01 was identified by sequence alignment. The specific primers for PCR amplification are as follows:

ITS-F(SEQ ID NO:1):5'-TCCGTAGGTGAACCTGCTGAGGGAT-3'；

ITS-R(SEQ ID NO:2):5'-TCCTCCGCTTATTGATATGCTTAA-3'。

the length of the ribosomal DNA-ITS obtained by amplification of Bb-bm01 is 569 bp; the PCR product was cloned into pMD-18T vector (Takara) and sent to Shanghai Bioengineering Co., Ltd for sequencing. The DNA sequence obtained by sequencing was (SEQ ID NO: 3):

TCCGTAGGTGAACCTGCTGAGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTAATACAGCTCGCACCGGGACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

the comparison of the sequencing result with an NCBI gene database shows that the homology of the Bb-bm01 ribosomal DNA-ITS sequence and the ribosomal DNA-ITS sequence of a plurality of Beauveria bassiana strains in the NCBI database can reach up to 99 percent, and the result shows that the Bb-bm01 is Beauveria bassiana (Beauveria bassiana).

Meanwhile, the determination and analysis of ITS sequences further prove that Bb-bm01 is different from the known beauveria bassiana strain.

Example 2 method of orally feeding spores of Beauveria bassiana (balsamo) Vuillemin

The invention provides a method for feeding beauveria bassiana by oral administration. Taking a lepidopteran model animal silkworm as an example:

a fresh suspension of beauveria bassiana spores of a certain concentration was prepared with 0.01% Triton X-100 sterile water. Selecting the silkworm larva of the fifth day. The head of the larva was fixed, and 1. mu.l of the spore suspension was pipetted by a micropipette (Gilson, P2) and slowly injected into the mouth of the silkworm larva (FIG. 2). The whole process avoids the spore suspension from contacting with larval mouthparts and body walls, and prevents spores of beauveria bassiana from infecting insects through the body walls. Then placing the mulberry leaves into an incubator with the temperature of 27 ℃ and the humidity of 30-40%, and feeding the mulberry leaves with fresh mulberry leaves.

Example 3 intestinal infection of Lepidoptera larvae by Beauveria bassiana Bb-bm01

Inoculating Beauveria bassiana Bb-bm01 to SDAY culture medium, culturing at 27 deg.C for 10 days, preparing into conidium suspension with 0.01% Triton X-100 sterile water, measuring spore concentration with blood counting plate, and preparing into 1 × 10⁹、1×10⁸、1×10⁷、1×10⁶、1×10⁵、1×10⁴Spore suspension at individual spore/ml (conidia/ml) concentration.

A. Aiming at the fifth-instar next-day larva of the silkworm P50 strain

The next day larva of five-instar silkworm P50 strain is taken to perform intestinal toxicity determination of Beauveria bassiana Bb-bm01, and the rearing conditions of the silkworm larva are that the temperature is 27 ℃ and the humidity is 40%. 1 mul of Bb-bm01 spore suspension with different concentrations is taken respectively, and the larva of the silkworm P50 second day of age is fed orally by a micropipette, and the blank control is 0.01 percent of Triton X-100. Each group of 30 silkworm larvae, each concentration was replicated in triplicate and larvae mortality was recorded daily. The results of the intestinal toxicity assay show that: the strain Bb-bm01 has enteropathogenicity on silkworm larvae, when 10000 spores are fed to each silkworm, all the silkworm larvae die after five days, while the silkworm larvae of the control group do not die (fig. 3A).

Meanwhile, intestinal toxicity measurement is carried out on other two strains of beauveria bassiana Bb2860 and Bb252 (which are purchased from the American Ministry of agriculture entomopathogenic fungi Collection ARSEF) commonly used in laboratories, and the rearing conditions of silkworm larvae are as above. Respectively taking 1 μ l of the extract at a concentration of 1 × 10⁸Spore suspension of Bb-bm01, Bb2860 and Bb252 per ml was orally fed to the fifth-instar next-day larva of Bombyx mori P50 by micropipette (Gilson, P2) with a blank control of 0.01% Triton X-100. Each group of 30 silkworm larvae, each concentration was replicated in triplicate and larvae mortality was recorded daily. The results of the intestinal toxicity assay show that: neither the strains Bb2860 and Bb252 had enteropathogenicity for silkworm larvae (fig. 3B).

B. Aiming at the mature larva of silkworm (fifth instar fourth day larva of silkworm P50)

In addition, 1. mu.l of 1X 10 was used⁷The spores/ml Bb-bm01 were orally fed to the aged silkworm larvae (fourth day larva of fifth instar of silkworm P50 strain) of Bombyx mori in a control group of 0.01% Triton X-100, each group of 30 silkworm larvae, and the three groups were repeated. Virulence determination results show that Bb-bm01 has intestinal infection virulence to the mature larvae, and the silkworms all die after 6 days of infection (FIG. 3B); when the silkworm larva became pupate, it was observed that Bb-bm01 was grown from the head of the pupa, and then gradually grown over the whole body (FIG. 3C).

C. For Clanis bilineata (Douda moth larva)

Taking lepidoptera pest Clanis bilineata (Clanis bilineata) as a research object, selecting three-instar Clanis bilineata (Clanis bilineata larva) to carry out enterotoxicity determination of beauveria bassiana Bb-bm01, wherein the feeding conditions of the Clanis bilineata are that the temperature is 26 ℃ and the humidity is 30-40%. Mu.l of Bb-bm01 spore suspension (1X 10)⁹Spores/ml), orally feeding clanis bilineata tsingtauica with a micropipette, blank control of 0.01% Triton X-100, 30 clanis bilineata tsingtauica per group, three replicates each, and recording the death status of clanis bilineata tsingtauica per day. The measurement result shows that the strain Bb-bm01 is against scalesThe winged pest Clanis bilineata has intestinal infection toxicity, and after the Clanis bilineata dies, the hyphae of Bb-bm01 gradually penetrate the body wall of Clanis bilineata and grow on the body surface of Clanis bilineata in a large amount (figure 4).

And (4) conclusion: the above results demonstrate that the strain Bb-bm01 of the present invention has a controlling effect on lepidopteran insects and can exert an effect through intestinal infection.

Example 4 Beauveria bassiana Bb-bm01 body wall and intestinal tract complex infection has insecticidal synergy

The five-instar next-day larva of a lepidoptera model animal silkworm P50 strain is taken as a research object, and the insecticidal toxicity of the infection of the body wall of the beauveria bassiana Bb-bm01 is determined by spraying. Bb-bm01 spore suspension concentration of 1X 10⁷Each spore/ml, the control group is 0.01% Triton X-100, each group of 30 silkworm larvae is sprayed with 5ml, and the silkworm larvae are placed in an incubator with the temperature of 27 ℃ and the humidity of 90% for feeding, and the three groups are repeated. The results show that: bb-bm01 was also highly pathogenic to silkworm larvae through body wall infection (FIG. 5).

Meanwhile, Beauveria bassiana Bb-bm01 is used for respectively carrying out body wall infection, intestinal infection and body wall and intestinal complex infection on the next day larva of the fifth age of P50 of the silkworm. Wherein the spore suspension concentration of the infection of the body wall with Bb-bm01 is 1X 10⁷The number of spores per ml of the feed Bb-bm01 for silkworm larvae infected by intestinal tract is 10⁴Spores/head, blank control 0.01% Triton X-100. The death of silkworms was recorded daily by repeating three times for 30 heads each.

Virulence assay results showed that beauveria bassiana Bb-bm01 complex infections in body wall and gut were significantly more virulent than single body wall infections (p <0.001, Log-rank (Mantel-cox) Test) or gut infections (p <0.0001, Log-rank (Mantel-cox) Test) (fig. 5). The result proves that the double-way composite infection can effectively improve the insecticidal toxicity of the bacterial strain Bb-bm01 and has insecticidal synergy.

Example 5 Beauveria bassiana Bb-bm01 A.globisporus (Anopheles stephensi) tool against the dipteran pest Anopheles stephensi Has toxicity to intestinal infection

Prepared with 0.01 percent of Triton X-100 sterile waterFresh Bb-bm01 spore suspension, the spore concentration was measured with a hemocytometer to make 1X 10⁸Spore suspension at individual spores/ml concentration was then mixed in equal volumes with sterile 10% sucrose water. And (3) selecting diptera pest Anopheles stephensi imagoes to carry out intestinal infection toxicity determination on beauveria bassiana Bb-bm 01. The culture condition of anopheles stephensi is temperature 26 deg.C and humidity 90%. By a composition containing 5X 10⁷Soaking sterile cotton balls in 10% sucrose water containing spores/ml Bb-bm01, and placing the cotton balls containing the spores above a mosquito feeding container for anopheles stephensi to eat; the blank was 10% sucrose water containing 0.01% Triton X-100, 50 adult Anopheles stephensi per group, triplicate, and mosquito deaths recorded daily.

The measurement result shows that the strain Bb-bm01 has intestinal infection toxicity to anopheles stephensi of diptera, and hyphae of Bb-bm01 penetrate from the head of the mosquito after the mosquito dies (figure 6). The results show that the bacterial strain Bb-bm01 can effectively control dipteran pests, and the control can be carried out through intestinal infection.

Example 6 Beauveria bassiana Bb-bm01 intestinal infection through foregut of Bombyx mori

Another important problem to be solved by the present invention is to specify the specific site and route of enteric infection of the host insect by beauveria bassiana Bb-bm 01.

Fresh Bb-bm01 spore suspension was prepared with 0.01% Triton X-100 sterile water, and the spore concentration was measured with a hemocytometer to obtain a 1X 10 suspension⁷Spore/ml concentration spore suspension. Using a micropipette, 1. mu.l of Bb-bm01 spore suspension (1X 10)⁷Spore/ml) of silkworm P50 strain, and control group of spore suspension (1 × 10) of Beauveria bassiana Bb252 (laboratory-stored strain, tested to have no toxicity of intestinal infection) with no toxicity of intestinal infection⁷Spores/ml). The rearing conditions of silkworm larva are 26 deg.C and 30-40% humidity.

Silkworm larvae which are fed with spores for 12h, 24h, 48h and 84h are respectively taken, immediately dissected and separated from intestinal tracts of infected silkworms, placed in a stationary liquid (60% absolute ethyl alcohol, 30% chloroform and 10% glacial acetic acid) and placed for 24h at 4 ℃. Fixing deviceAfter finishing the determination, washing the mixture twice by using 70% ethanol, and finally storing the mixture in the 70% ethanol. The tissue was then transferred to 100% absolute ethanol and placed in a homogenizer for 1h for dehydration (3 times). The dehydrated intestinal tissue was placed in xylene for 15 minutes (3 times). The intestinal tissue was placed in paraffin melted at 65 ℃ and embedded for 2 days. The embedded samples were left at room temperature for 2 hours and then at 4 ℃ for 20 minutes and sliced into 5 μm thick slices with a microtome. And placing the cut slices on a glass slide coated with gelatin, placing the glass slide on a sheet baking machine (at 42 ℃) for baking for 15 minutes, flattening the slices to be flattened, sucking off the redundant gelatin, and placing the slices on the sheet baking machine for 24-36 hours. The slices were then deparaffinized by immersion in xylene for 20 minutes. The dewaxed sample was rehydrated with 100%, 95%, 80%, 70% ethanol each wash for 5 minutes, ddH₂O rinse for 3 min (2 times). And finally, staining the section by PAS, and observing the section under a microscope after staining.

The results showed that Bb-bm01 was orally infected through the foregut of silkworms. After Bb-bm01 is fed to silkworm, the spores of Bb-bm01 adhere to the folds of foregut of silkworm, germinate and penetrate through the foregut intestinal wall to enter the blood cavity of insect to form thallus, and propagate in the blood cavity of insect in large quantity (figure 7). Meanwhile, we also performed paraffin section on silkworms fed with the control strain Bb252 without intestinal infection ability. The results show that the spores of Bb252 do not germinate in the intestinal tract of the silkworm, and the spores of Bb252 sequentially pass through the foregut, the midgut and the hindgut and are finally discharged out of the body.

Example 7 comparison of virulence of Beauveria bassiana Bb-bm01, Bb2860 and Bb252 body wall infection of Bombyx mori

The five-instar next-day larva of the silkworm P50 strain is taken, and beauveria bassiana Bb-bm01, Bb2860 and Bb252 are subjected to determination of body wall infection insecticidal toxicity in a spraying mode. The breeding condition of silkworm larva is 27 deg.C and 40% humidity. Collecting fresh Beauveria bassiana Bb-bm01, Bb2860 and Bb252 with 0.01% Triton X-100, wherein the spore suspension concentration is 1 × 10⁷Spores/ml, control 0.01% Triton X-100. Spraying 5ml of 30 silkworm larvae in each group, and standing at a certain temperatureThe larvae were housed at 27 ℃ in an incubator with 90% humidity, and the death of the larvae was recorded daily in triplicate.

The results of the virulence assay show: compared with other two strains of beauveria bassiana Bb2860 and Bb252, Bb-bm01 has high pathogenicity to silkworm larvae through body wall infection (figure 8).

It is to be understood that the above-listed are only a few specific embodiments of the present invention. Obviously, the present invention is not limited to the above examples, and Bb-bm01 may also infect and thereby control other insects, such as prodenia litura (lepidoptera), corn borer (lepidoptera), locust, cockroach (orthoptera), chafer, longicorn beetle (coleoptera), termite (isoptera), and the like.

Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims. All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference.

Sequence listing

<110> Shanghai Life science research institute of Chinese academy of sciences

<130> 167998 1CNCN

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 25

<212> DNA

<213> Artificial sequence

<400> 1

tccgtaggtg aacctgctga gggat 25

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence

<400> 2

tcctccgctt attgatatgc ttaa 24

<210> 3

<211> 569

<212> DNA

<213> Beauveria bassiana (Beauveria bassiana)

<400> 3

tccgtaggtg aacctgctga gggatcatta ccgagttttc aactccctaa cccttctgtg 60

aacctaccta tcgttgcttc ggcggactcg ccccagcccg gacgcggact ggaccagcgg 120

cccgccgggg acctcaaact cttgtattcc agcatcttct gaatacgccg caaggcaaaa 180

caaatgaatc aaaactttca acaacggatc tcttggctct ggcatcgatg aagaacgcag 240

cgaaacgcga taagtaatgt gaattgcaga atccagtgaa tcatcgaatc tttgaacgca 300

cattgcgccc gccagcattc tggcgggcat gcctgttcga gcgtcatttc aaccctcgac 360

ctccccttgg ggaggtcggc gttggggacc ggcagcacac cgccggccct gaaatggagt 420

ggcggcccgt ccgcggcgac ctctgcgcag taatacagct cgcaccggga ccccgacgcg 480

gccacgccgt aaaacaccca acttctgaac gttgacctcg aatcaggtag gactacccgc 540

tgaacttaag catatcaata agcggagga 569

Claims

1. Beauveria bassiana (balsamo) Vuillemin (B) ((B))Beauveria bassiana) Wherein the microbial preservation number of the beauveria bassiana is CGMCC No. 13180.

2. An insect control composition comprising:

(a) beauveria bassiana and/or spores, mycelium or fermentation products thereof according to claim 1;

(b) an agriculturally pharmaceutically acceptable carrier and/or adjuvant.

3. The composition of claim 2, wherein the composition is in a dosage form suitable for disinsection through the insect gut or composite disinsection through the insect gut body wall.

4. The composition of claim 2, wherein the insect is selected from the group consisting of: lepidopteran, dipteran, orthopteran, coleopteran, and isopteran.

5. The composition of claim 2, wherein the insect is selected from the group consisting of: moth pests, butterfly pests, mosquitoes, flies, gadflies and gnats.

6. The composition of claim 2, wherein the insect is selected from the group consisting of: pine moth, cutworm, prodenia litura, peach fruit borer, apple leaf roller moth, cotton bollworm, cabbage butterfly, diamond back moth, stem borer, wheat moth, potato tuber moth, sweet potato moth, anopheles mosquito, culex, aedes, house fly, flower fly, toilet fly, rotting fly, biting fly, tsetse fly, blowfly, tingling fly, fan fly, dermatofly, stomach fly, lice fly, gadfly, chironomid, gnat, crab gnat, chafer, beetle, longicorn and termite.

7. The composition of claim 2, wherein the carrier and/or adjuvant is selected from the group consisting of: solvent, wetting agent, dispersing agent, emulsifier, stabilizer, adhesive, filler, controlled release auxiliary agent, synergist, adhesive, spreader, anti-drift agent, safener, antidote, defoamer, spraying auxiliary agent, warning color, attractant and antifreeze.

8. The composition of claim 2, further comprising one or more components selected from the group consisting of: pesticides, plant growth regulators, fertilizers, and soil conditioners.

9. A method of producing the composition of any one of claims 2 to 8, the method comprising:

cultivating, proliferating or fermenting Beauveria bassiana according to claim 1 to obtain Beauveria bassiana according to component (a) in any one of claims 2-8, or spores, mycelia or fermentation products thereof;

mixing component (a) with an agriculturally pharmaceutically acceptable carrier and/or adjuvant.

10. A method of controlling pests, the method comprising:

beauveria bassiana, or spores, mycelia or fermentation products thereof according to claim 1, or the composition according to any one of claims 2 to 8 is applied to a place where pests are present or are expected to be present.

11. The method of claim 10, wherein the pest is present or expected to be present at one or more locations selected from the group consisting of: farmland, forest, pasture, warehouse, residence and water area.

12. The method of claim 10, wherein the pest is present or expected to be present at a location selected from the group consisting of: vegetable fields and fruit orchards.

13. Use of beauveria bassiana according to claim 1, or spores, mycelium or fermentation product thereof, or a composition according to any one of claims 2 to 8 for pest control.