CN108179183A - A kind of method for detecting LRP2 gene SNP site rs2544390 genotype - Google Patents

A kind of method for detecting LRP2 gene SNP site rs2544390 genotype Download PDF

Info

Publication number
CN108179183A
CN108179183A CN201810134450.8A CN201810134450A CN108179183A CN 108179183 A CN108179183 A CN 108179183A CN 201810134450 A CN201810134450 A CN 201810134450A CN 108179183 A CN108179183 A CN 108179183A
Authority
CN
China
Prior art keywords
recombination
plasmid
lrp2
genotype
gene snp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201810134450.8A
Other languages
Chinese (zh)
Inventor
车团结
徐红
陈游
杨震
李亚鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Baiyuan Gene Technology Co Ltd
Original Assignee
Suzhou Baiyuan Gene Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Baiyuan Gene Technology Co Ltd filed Critical Suzhou Baiyuan Gene Technology Co Ltd
Priority to CN201810134450.8A priority Critical patent/CN108179183A/en
Publication of CN108179183A publication Critical patent/CN108179183A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides a kind of method for detecting LRP2 gene SNP site rs2544390 genotype, and step is as follows：The negative plasmid of structure recombination and recombination positive plasmid；The peripheral blood genomic DNA of sample to be tested is extracted, the DNA of negative plasmid, recombination positive plasmid and sample to be tested carries out PCR amplification to recombination and HRM is analyzed, and collects data；High-resolution melting curve is drawn according to data are collected, the genotype of sample to be tested LRP2 gene SNP sites rs2544390 is judged according to the melting curve of the negative plasmid of recombination, recombination positive plasmid.The method of the present invention can accurately detect the genotype of LRP2 gene SNP sites rs2544390, and high sensitivity, specificity is good, and detection is rapid；Method using the present invention is completely the same with sequencing result to the parting of LRP2 gene SNP site rs2544390 genotype, can be used in the auxiliary judgment of gout liability.

Description

A kind of method for detecting LRP2 gene SNP site rs2544390 genotype
Technical field
The present invention relates to a kind of methods for detecting LRP2 gene rs2544390 genotype.
Background technology
Gout (Gout) is to cause joint and certain by purine metabolic disturbance and the uric acid excretion disorder of renal tubule source property A kind of metabolic disease of organ injury.In recent years China's incidence rapid growth, rejuvenation trend is apparent, shows disease patient up to 1.2 hundred million It is more than people, wherein more than 30,000,000 gout.The multifactor pathogenic mechanism of h and E is not fully apparent from, so far more than 95% patient Fail Target-driven therapy.The clinical manifestation of gout early stage is is interrupted ictal acute arthritis, and predominantly simple joint is involved, swelling and pain one As continue 7-10 days, can be by drug or spontaneous remission, the intermittent phase is asymptomatic.With the extension of the course of disease, gout attack times, by Tired joint number gradually increases, and the intermittent phase also begins to symptom occur, while tophus is formed in joint or skin soft tissue, severe patient There is joint to damage or disable, kidney stone, Chronic Renal Impairment etc. occur, chronic renal failure may finally be developed into.
High blood Aciduria (Hyperuricemia, HUA) is drunk, the clothes of metabolic syndrome, hypertension, obesity, diuretics With etc. risk factors it is all related with the occurrence and development of gout.It is unclear about the pathogenesis of gout at present, but numerous studies It is a kind of disease of multifactorial inheritance as caused by environment and genetics factor collective effect to be shown to be gout, and the gout being currently known is related Gene has ABCG2, IRGM etc..Research finds that the people for only having 10% or so in high blood Aciduria crowd may develop into gout, says The bright gene for not participating in uric acid metabolism directly may also be related with gout neurological susceptibility.In view of gout is to serious harm caused by patient And white elephant, screening and research to gout tumor susceptibility gene are increasingly subject to the concern of people.
(the low-density lipoprotein receptor-relate of Genus Homo LDH receptor related protein 2 Dprotein LRP2) positioned at chromosome 4q22-q23, the transmembrane protein being made of 655 amino acid is encoded, combines and turns for ATP Transport Protein G superfamily member.LRP2 molecules are a kind of cell surface proteins, belong to a kind of endocytosis receptor, are low-density lipoproteins One of seven major member of polymeric immunoglobulin receptor (low density lipoprotein receptor, LDLR) gene family.LRP2 is in addition to ginseng With outside endocytosis, also there is cellular signal transduction.LRP2bp, can as a kind of Novel joint molecule combined with LRP2 Can by with acceptor interaction, recruit various protein moleculars and form protein complexes, mediation receptor participates in signal transduction.People is low 2 binding protein of density lipoprotein receptor phase albumen wide expression in various tissues and organ, in people uterus, testis, small intestine, knot Expression is higher in intestines, blood leucocyte and human pancreatic cancer cell.LRP2 genes are expressed in liver and body tubular tissue, It is activated according to purine degradation pathway in liver or the underexcretion of renal tubule is inferred under the background of intake alcohol LRP2 gene mutations influence uric acid level.
Invention content
In order to solve the problems in the existing technology, the present invention provides a kind of detection LRP2 gene rs2544390 bases Because of the method for type.The invention also discloses for expanding and detect the primer sequence of sample LRP2 gene SNPs rs2544390.
The applicant devises a kind of method for detecting LRP2 gene SNP rs2544390 genotype, for examining LRP2 The genotype of gene SNP rs2544390, the result can be used for the relevant gout liability wind of LRP2 gene SNPs rs2544390 Danger assessment.
First purpose of the present invention is to provide a kind of method for detecting LRP2 gene SNP site rs2544390 genotype, Step is as follows：
(1) the negative plasmid of structure recombination and recombination positive plasmid：The nucleotides sequence of the negative plasmid of recombination is classified as sequence SEQ ID No.1 in table, the nucleotides sequence of the recombination positive plasmid are classified as SEQ ID No.2 in sequence table；
(2) the peripheral blood genomic DNA of sample to be tested is extracted, to recombinating negative plasmid, recombinating positive plasmid and treating test sample This DNA carries out PCR amplification and HRM analyses, collects data；
Preferably, the condition of the HRM analyses is：94℃90s；60℃30s；83-94 DEG C of collection data, temperature rise Rate is 0.06 DEG C/s；
(3) according to data drafting high-resolution melting curve is collected, according to the negative plasmid of recombination, the molten of positive plasmid is recombinated Solution curve judges the genotype of sample to be tested LRP2 gene SNP sites rs2544390：
The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve of the negative plasmid of recombination is GG；
The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve for recombinating positive plasmid is AA；
The genotype of then LRP2 gene SNP sites rs2544390 between the negative plasmid of recombination and recombination positive plasmid For GA.
Preferably, the primer is one kind in (1)-(3) during the PCR amplification：
(1) sense primer：LRP2-F 5'-GATGGGCACTCTGACGGT-3'
Downstream primer：LRP2-R 5'-GTTGTTGCAAGCCGAAGAGC-3'
(2) with (1) in complementary series；
(3) sequence in (1) to several bases or is deleted one to several bases to 5 ' ends and/or 3 ' extreme directions extension one Obtained sequence.
Preferably, the reaction system during PCR amplification is：
Preferably, the reaction condition during PCR amplification is：94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 10s；60 DEG C are moved back Fire/extension 20s；40 cycles.
Second object of the present invention is to provide a kind of for detecting LRP2 gene SNP site rs2544390 genotype Kit, the kit include the negative plasmid of recombination, recombination positive plasmid and for expanding above-mentioned recombination feminine gender plasmid and again The primer of group positive plasmid；The nucleotides sequence of the negative plasmid of recombination is classified as SEQ ID No.1 in sequence table, the recombination sun The nucleotides sequence of property grain is classified as SEQ ID No.2 in sequence table.
Preferably, the primer is one kind in (1)-(3)：
(1) sense primer：LRP2-F 5'-GATGGGCACTCTGACGGT-3'
Downstream primer：LRP2-R 5'-GTTGTTGCAAGCCGAAGAGC-3'
(2) with (1) in complementary series；
(3) sequence in (1) to several bases or is deleted one to several bases to 5 ' ends and/or 3 ' extreme directions extension one Obtained sequence.
Preferably, the reaction system during PCR amplification is：
Preferably, PCR reaction conditions are：94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 A cycle.
Third object of the present invention is to provide the application method of mentioned reagent box, and step is as follows：
(1) the peripheral blood genomic DNA of sample to be tested is extracted, to recombinating negative plasmid, recombinating positive plasmid and treating test sample
This peripheral blood genomic DNA carries out PCR amplification and HRM analyses：
The condition of HRM analysis is：
94℃ 90s；
60℃ 30s；
83-94 DEG C of collection data, temperature rate-of-rise are 0.06 DEG C/s；
(2) according to data drafting high-resolution melting curve is collected, according to the negative plasmid of recombination, the molten of positive plasmid is recombinated Solution curve judges the genotype of sample to be tested LRP2 gene SNP sites rs2544390：
The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve of the negative plasmid of recombination is GG；
The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve for recombinating positive plasmid is AA；
The genotype of then LRP2 gene SNP sites rs2544390 between the negative plasmid of recombination and recombination positive plasmid For GA.
Fourth object of the present invention is to provide SEQ ID No.1 and SEQ ID No.2 in sequence table and is preparing detection Application in the kit of LRP2 gene SNP site rs2544390 genotype.
The 5th purpose of the present invention is to provide in sequence table SEQ ID No.2, right in SEQ ID No.1, sequence table It is required that application of any kits of 5-8 in aided assessment gout liability reagent is prepared.
The method of the present invention can accurately detect the genotype of LRP2 gene SNP sites rs2544390, and high sensitivity is special The opposite sex is good, and detection is rapid；Using parting and sequencing of the method for the present invention to LRP2 gene SNP site rs2544390 genotype As a result it is completely the same, it can be used in the auxiliary judgment of gout liability.
Description of the drawings
Attached drawing is used to provide further understanding of the present invention, and a part for constitution instruction, the reality with the present invention Example is applied together for explaining the present invention, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is the HRM method sensitivity experiment results of the present invention.
Fig. 2 is the method specificity experiments result of the present invention.
Fig. 3 is the HRM method analysis results of the sample present invention.
Fig. 4 be sample LRP2rs2544390 (c.79+13985G>A) the sequencing result in site；Wherein a is wild type sequence Row, b are heterozygous mutant sequence, and c is homozygous mutant sequence.
Specific embodiment
Below in conjunction with the accompanying drawings and the present invention is described in detail in specific embodiment.Following embodiment is convenient for preferably Understand the present invention, but do not limit the present invention.Experimental method in example below is conventional method unless otherwise specified. The primer and sequent synthesis used and examining order are completed by Sangon Biotech (Shanghai) Co., Ltd..
The preparation of embodiment 1LRP2rs2544390 standard items
Establish HRM analysis methods it may first have to which the external standards needed for preparation method, standard items should include height and protect Keep the sequence with specificity, it is ensured that the high specific of reaction.(c.79+13985G present invention synthesis includes LRP2rs2544390 >A) wild type in site and homozygous mutant DNA sequence dna, are cloned into using gene recombination technology in pMD18-T carriers, structure The wild type of pMD18-T-rs2544390 and homozygous mutant recombinant plasmid are built out, and carries out corresponding PCR identifications and sequencing mirror Fixed, most afterwards after quantitative as the standard items for treating method for building up, wild type recombinant plasmid is recombinates negative plasmid, homozygous mutant Recombinant plasmid is recombination positive plasmid, is laid the foundation for the method for next step and assessment.
First, structure and the conversion of recombination feminine gender and positive plasmid pMD18-T-rs2544390
1. synthesize LRP2rs2544390 (c.79+13985G>A) wild type and homozygous mutant DNA sequence dna, the present invention close Into sequence 171bp, sequence is as follows：
(1) wild-type sequence
GAGGCAGCATGGATTGTGGTGGAAAGAACATCACATGTCAAGTCAGGACATTCATGGGTCTTGTTCCTG ATGAATGAAGGAAAAATGGGCACAGACGAAGAGGGCCCCTGACTGCTGAAAAGGACCCATGGCCACTTGTCTCCTGGGCATAGTCTCCCTCATCTCAGTCCC
(2) homozygous mutant sequence
GAGGCAGCATGGATTGTGGTGGAAAGAACATCACATGTCAAGTCAGGACATTCATGGGTCTTGTTCCTG ATGAATGAAGGAAAAATGGGCACAGACGAAGAGGGCCCCTGACTGCTGAAAAGGACCCATGGCCACTTGTCTCCTGGACATAGTCTCCCTCATCTCAGTCCC
The base being wherein underlined is gene mutation site.
2. coupled reaction：The DNA fragmentation of above-mentioned synthesis with pMD18-T is attached, is carried out using following linked system It prepares：
Preparation completion is placed on 16 DEG C and carries out staying overnight coupled reaction.
The conversion of 3.pMD18-T-rs2544390 plasmids and PCR identifications
(1) the DH5 α competent cells frozen are taken out from -80 DEG C of ultra low temperature freezer, being placed on ice chest makes its defrosting；
(2) the 10 μ L of connection product that step 2 obtains is taken to add in the DH5 α competent cells of 50 μ L, gently shake up postposition ice Bath 30 minutes；
(3) 42 DEG C of water-bath heat shocks 90 seconds, put cooled on ice 2min immediately after heat shock；
(4) after the piping and druming mixing of the LB fluid nutrient mediums without resistance of the 1ml of precooling is added in 1.5ml EP pipes, 37 DEG C 120 revs/min of jog culture 90min；
(5) the of short duration centrifugation of above-mentioned culture solution is sucked to the LB for remaining 100 μ l being taken to be coated on the antibiotic containing Amp after 900 μ l It on tablet, faces up and places 30min, after bacterium solution is cultured base absorption completely, be inverted 37 DEG C of insulating box cultures of culture dish Night；
(6) picking monoclonal bacterium colony is in the 1.5ml EP pipes of 500 μ L Amp resistance LB fluid nutrient mediums from tablet, and 37 DEG C 220rpm shaken cultivations 5-6 hours；
(7) 1 μ L is taken to carry out bacterium solution PCR identifications as template.The bacterium solution for being accredited as the positive is added to the LB liquid of 20ml It carries out expanding in culture medium and shake；
(8) above-mentioned dilution bacterium solution being expanded with primer LRP2-F and LRP2-R, PCR product uses 2% agarose gel electrophoresis, Positive transformant is identified by detecting PCR product.
Primer sequence analyzes the primer for HRM, and sequence is as follows：
Sense primer：LRP2-F 5'-GATGGGCACTCTGACGGT-3'
Downstream primer：LRP2-R 5'-GTTGTTGCAAGCCGAAGAGC-3'
System is as follows：
Amplification program/reaction condition：94 DEG C of pre-degeneration 5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30sec, 35 cycles； 72℃10min。
4. the negative plasmid of recombination and recombination positive plasmid extraction
Recombinant plasmid, measured concentration and purity are extracted using the Plasmid Preparation kit of hundred Imtech of Beijing production, together When take 10 μ l plasmid purifications that supreme marine growth Engineering Co., Ltd is sent to be sequenced, determine the gene order and purpose of Insert Fragment Sequence is consistent.
2nd, the acquisition of standard items and quantitative
(1) escherichia coli DH5a containing recombinant plasmid pMD18-T-rs2544390 frozen for obtaining step 1 100 μ l are inoculated in the LB fluid nutrient mediums of 15ml ammonia benzyl resistances, and 37 DEG C of 220rpm cultivate 14-16h；
(2) recombinant plasmid is extracted using the Plasmid Preparation kit of hundred Tyke bio tech ltd of Beijing production；
(3) the ultramicron ultraviolet-uisible spectrophotometer (ND5000) using hundred Tyke bio tech ltd of Beijing is right The plasmid measured concentration of extraction, according to A260/A280Judge the purity of plasmid, A260/A280=1.81.
Embodiment 2HRM-PCR detects the foundation of LRP2rs2544390 methods
First, the preparation of sample to be tested
The peripheral blood genomic DNA of 30 samples is extracted, the template as the amplification of LRP2 gene PCRs.Specific extracting method It is as follows：
(1) 1ml whole bloods are taken, 3ml TE is added in, 10min is stood after reverse mixing, 8000rpm is centrifuged 5 minutes, abandons supernatant Liquid；
(2) 2-3 times is repeated the above steps to being precipitated as white；
(3) 900 μ l 10%SDS and 10 μ l 10mg/ml Proteinase Ks, 55 DEG C of water-bath 1h are added in；
(4) centrifuge tube is cooled to room temperature, adds in isometric phenol/chloroform/isoamyl alcohol (25:24:1) mixing, 12000rpm centrifuges 10min；
(5) isometric phenol/chloroform/isoamyl alcohol (25 is added after carefully drawing supernatant:24:1) mixing, 12000rpm centrifugations 10min；
(6) supernatant is taken, adds in the absolute ethyl alcohol of two volumes, turn upside down mixing, and 12000rpm centrifugation 10min are abandoned Clearly；
(7) plus the washing of the ethyl alcohol of 500 μ l 70% precipitates, and abandons supernatant after of short duration centrifugation, drying of uncapping is waved completely to ethyl alcohol Hair；
(8) plus in 50 μ l distilled waters or TE dissolving DNAs, -20 DEG C of preservations.
2nd, the design and synthesis of specific primer
The present invention searches Genus Homo by being retrieved to LRP2rs2544390 gene orders in Ensemble databases The gene order of LRP2 gene SNP sites rs2544390 is drawn with 5 softwares of Primer Premier and 7 softwares of Oligo Object designs, (c.79+13985G the upstream and downstream primer sequence of design includes be mutated amplification site>A), choosing is suitble to design to draw The fragment sequence of object is target, and using 7 software of 5 softwares of Primer Premier and Oligo, it is long to design several groups of amplified fragments Spend the primer within 400bp.Then it carries out database primer BLAST specificity to compare, selects specificity high, that has scored draws Object is sent to company's synthesis as primary election primer, then carries out primer screening, selects to be most suitable for the primer of amplification condition for HRM experiments Analysis.
The primer sequence is as follows：
Sense primer：LRP2-F 5'-GATGGGCACTCTGACGGT-3'
Downstream primer：LRP2-R 5'-GTTGTTGCAAGCCGAAGAGC-3'
Amplified fragments size is：171bp.The nucleotides sequence of amplification is classified as：
5’-GAGGCAGCATGGATTGTGGTGGAAAGAACATCACATGTCAAGTCAGGACATTCATGGGTCTTGTTC CTGATGAATGAAGGAAAAATGGGCACAGACGAAGAGGGCCCCTGACTGCTGAAAAGGACCCATGGCCACTTGTCTCC TGGGCATAGTCTCCCTCATCTCAGTCCC-3’。
Or
5’-GAGGCAGCATGGATTGTGGTGGAAAGAACATCACATGTCAAGTCAGGACATTCATGGGTCTTGTTC CTGATGAATGAAGGAAAAATGGGCACAGACGAAGAGGGCCCCTGACTGCTGAAAAGGACCCATGGCCACTTGTCTCC TGGACATAGTCTCCCTCATCTCAGTCCC-3’。
The base being wherein underlined is gene mutation site.
3rd, HRM-PCR reaction systems and reaction condition
Respectively using sample to be tested DNA, the negative plasmid of recombination and recombination positive plasmid as template, with above-mentioned primer LRP2-F and LRP2-R is amplimer, and PCR amplification is carried out using following systems and reaction condition.
PCR system：
Wherein primer uses raw work biological (Shanghai) using LRP2-F and LRP2-R, HRM-PCR, Green-2-Go qPCR Mastermix kits.HRM analyzers are hundred source Gene A SA-9600 real-time fluorescence quantitative PCR instrument.
PCR amplification program：
94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 cycles；
HRM is analyzed：
94℃ 90s
60℃ 30s
83-94 DEG C of collection data, temperature rate-of-rise are 0.06 DEG C/s.
4th, interpretation of result
High-resolution melting curve is drawn according to data are collected, according to the melting of recombination negative plasmid, recombination positive plasmid Curve judges the genotype of sample to be tested LRP2 gene SNP sites rs2544390：
The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve of the negative plasmid of recombination is GG；
The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve for recombinating positive plasmid is AA；
The genotype of then LRP2 gene SNP sites rs2544390 between the negative plasmid of recombination and recombination positive plasmid For GA.
5th, sensitivity experiment
Recombination positive plasmid and the negative plasmid of recombination are diluted to 50ng/ μ l, it is dilute that the two mixing then is carried out gradient It releases, recombination positive plasmid accounting is followed successively by 50%, 25%, 12.5%, 5%, 2% and 1%, according to above-mentioned HRM-PCR reactants System and parameter are expanded, analysis mutation inspection range, i.e. sensitivity.
Reaction system is as follows：
PCR amplification program：
94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 cycles.
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise are 0.06 DEG C/s.
As a result with reference to Fig. 1, experimental data is shown, when recombination positive plasmid and the negative plasmid volume ratio of recombination are respectively 1:1、 1:3、1:7、1:19、1:49 and 1:When 99, recombination positive plasmid can be detected, so the spirit of the HRM detection methods of the present invention Sensitivity is 1%.
Fig. 1 is the HRM method sensitivity experiment results of the present invention.
6th, specificity experiments
Using LRP2 positive plasmids sample and LRP2 feminine gender plasmid samples as template, specificity is carried out using sterile water as template Research.It is amplimer with above-mentioned LRP2-F and LRP2-R, PCR amplification is carried out using following system and reaction condition.
PCR system：
Wherein used primer and kit and instrument and equipment are consistent in above-mentioned.
PCR amplification program：
94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 cycles；
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise are 0.06 DEG C/s.
As a result with reference to Fig. 2, experimental data show, when using LRP2 be mutated the positive and wild ' negative ' specimens of LRP2 as template into During row Amplification Analysis, two amplification curves are may occur in which, when being expanded using sterile water as template, instrument detecting system is 40 S type fluorescent amplification curves cannot be still generated after a cycle, show that reaction system specificity is good.
Fig. 2 is the amplification method specificity experiments result of the present invention.
The detection method detection sample gene mutation of the application present invention of embodiment 3
With the testing conditions in 2 step of embodiment, HRM analyses are carried out to 32 samples, with recombination positive plasmid and recombination The melting curve of negative plasmid compares, and determines the mutation type in sample according to this.Each base is directed to according to HRM analysis results 1 sample is selected at random because of type carries out Sanger sequence verifications in raw work biological (Shanghai).
For HRM analysis results referring to table 1 and Fig. 3, data show that LRP2 genes rs2544390 wild types have 22 in 32 samples Example, G>A heterozygous mutants have 7, G>A homozygous mutants 3.
Fig. 3 is the HRM method analysis results of the sample present invention.
Sanger sequencing results are referring to Fig. 4.
Fig. 4 be sample LRP2rs2544390 (c.79+13985G>A) the sequencing result in site；Wherein, a is compiled for sample Numbers 7 sequencing result, LRP2rs2544390 are wild type, and b is the sequencing result of sample number 17, LRP2rs2544390 G> A heterozygosis changes, sequencing results of the c for sample number 31, LRP2rs2544390 G>A homozygosis changes.As it can be seen that with side of the present invention The result of method detection is completely the same.
The method of the application present invention of table 1 is to the analysis result of sample
Embodiment 4 is used to detect the kit of LRP2 gene SNP site rs2544390 genotype
The present invention's includes following components for detecting the kit of LRP2 gene SNP site rs2544390 genotype：
(1) LRP2rs2544390 standard items：The negative plasmid of recombination and recombination positive plasmid, according to the method in embodiment 1 It prepares.
(2) primer：The primer sequence is：
Sense primer：LRP2-F 5'-GATGGGCACTCTGACGGT-3'
Downstream primer：LRP2-R 5'-GTTGTTGCAAGCCGAAGAGC-3'.
(3) the HRM-PCR amplifing reagents of the Green of Eva containing saturated fluorescence dyestuff.
Method using kit detection LRP2 gene SNP site rs2544390 genotype is same as Example 2.
Finally it should be noted that：The foregoing is only a preferred embodiment of the present invention, is not intended to restrict the invention, Although the present invention is described in detail referring to the foregoing embodiments, for those skilled in the art, still may be used To modify to the technical solution recorded in foregoing embodiments or carry out equivalent replacement to which part technical characteristic. All within the spirits and principles of the present invention, any modification, equivalent replacement, improvement and so on should be included in the present invention's Within protection domain.
Sequence table
<110>Suzhou Bai Yuan gene technology Co., Ltd
<120>A kind of method for detecting LRP2 gene SNP site rs2544390 genotype
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 171
<212> DNA
<213>Genus Homo LDH receptor related protein (ow-density lipoprotein receptor-relate dprotein )
<400> 1
gaggcagcat ggattgtggt ggaaagaaca tcacatgtca agtcaggaca ttcatgggtc 60
ttgttcctga tgaatgaagg aaaaatgggc acagacgaag agggcccctg actgctgaaa 120
aggacccatg gccacttgtc tcctgggcat agtctccctc atctcagtcc c 171
<210> 2
<211> 171
<212> DNA
<213>Genus Homo LDH receptor related protein (ow-density lipoprotein receptor-relate dprotein )
<400> 2
gaggcagcat ggattgtggt ggaaagaaca tcacatgtca agtcaggaca ttcatgggtc 60
ttgttcctga tgaatgaagg aaaaatgggc acagacgaag agggcccctg actgctgaaa 120
aggacccatg gccacttgtc tcctggacat agtctccctc atctcagtcc c 171

Claims (10)

  1. A kind of 1. method for detecting LRP2 gene SNP site rs2544390 genotype, it is characterised in that：Step is as follows：
    (1) the negative plasmid of structure recombination and recombination positive plasmid：The nucleotides sequence of the negative plasmid of recombination is classified as in sequence table SEQ ID No.1, the nucleotides sequence of the recombination positive plasmid are classified as SEQ ID No.2 in sequence table；
    (2) the peripheral blood genomic DNA of sample to be tested is extracted, to recombination feminine gender plasmid, recombination positive plasmid and sample to be tested DNA carries out PCR amplification and HRM analyses, collects data；
    Preferably, the condition of the HRM analyses is：94℃90s；60℃30s；83-94 DEG C of collection data, temperature rate-of-rise For 0.06 DEG C/s；
    (3) high-resolution melting curve is drawn according to collection data, according to the negative plasmid of recombination, the melting song of recombination positive plasmid Line judges the genotype of sample to be tested LRP2 gene SNP sites rs2544390：
    The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve of the negative plasmid of recombination is GG；
    The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve for recombinating positive plasmid is AA；
    The genotype of then LRP2 gene SNP sites rs2544390 between the negative plasmid of recombination and recombination positive plasmid is GA.
  2. 2. according to the method described in claim 1, it is characterized in that：The primer is one in (1)-(3) during the PCR amplification Kind：
    (1) sense primer：LRP2-F 5'-GATGGGCACTCTGACGGT-3'
    Downstream primer：LRP2-R 5'-GTTGTTGCAAGCCGAAGAGC-3'
    (2) with (1) in complementary series；
    (3) sequence in (1) to several bases or is deleted one and obtained to several bases to 5 ' ends and/or 3 ' extreme directions extension one Sequence.
  3. 3. method according to claim 1 or 2, it is characterised in that：The reaction system during PCR amplification is：
  4. 4. according to any methods of claim 1-3, it is characterised in that：The reaction condition during PCR amplification is：94℃ Pre-degeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 cycles.
  5. 5. a kind of kit for being used to detect LRP2 gene SNP site rs2544390 genotype, it is characterised in that：The reagent Box includes the negative plasmid of recombination, recombination positive plasmid and for expanding above-mentioned recombination feminine gender plasmid and recombinating drawing for positive plasmid Object；The nucleotides sequence of the negative plasmid of recombination is classified as SEQ ID No.1 in sequence table, the nucleotide of the recombination positive plasmid Sequence is SEQ ID No.2 in sequence table.
  6. 6. kit according to claim 5, it is characterised in that：The primer is one kind in (1)-(3)：
    (1) sense primer：LRP2-F 5'-GATGGGCACTCTGACGGT-3'
    Downstream primer：LRP2-R 5'-GTTGTTGCAAGCCGAAGAGC-3'
    (2) with (1) in complementary series；
    (3) sequence in (1) to several bases or is deleted one and obtained to several bases to 5 ' ends and/or 3 ' extreme directions extension one Sequence.
  7. 7. kit according to claim 5 or 6, it is characterised in that：The reaction system during PCR amplification is：
    Preferably, PCR reaction conditions are：94 DEG C of pre-degeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 are followed Ring.
  8. 8. the application method of any kits of claim 5-7, it is characterised in that：Step is as follows：
    (1) the peripheral blood genomic DNA of sample to be tested is extracted, to recombination feminine gender plasmid, recombination positive plasmid and sample to be tested Peripheral blood genomic DNA carries out PCR amplification and HRM analyses：
    The condition of HRM analysis is：
    94℃90s；
    60℃30s；
    83-94 DEG C of collection data, temperature rate-of-rise are 0.06 DEG C/s；
    (2) high-resolution melting curve is drawn according to collection data, according to the negative plasmid of recombination, the melting song of recombination positive plasmid Line judges the genotype of sample to be tested LRP2 gene SNP sites rs2544390：
    The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve of the negative plasmid of recombination is GG；
    The genotype that then LRP2 gene SNP sites rs2544390 is overlapped with the melting curve for recombinating positive plasmid is AA；
    The genotype of then LRP2 gene SNP sites rs2544390 between the negative plasmid of recombination and recombination positive plasmid is GA.
  9. 9. SEQ ID No.1 and SEQ ID No.2 are preparing detection LRP2 gene SNP site rs2544390 genes in sequence table Application in the kit of type.
  10. 10. any kit of SEQ ID No.2, claim 5-8 exists in SEQ ID No.1, sequence table in sequence table Prepare the application in aided assessment gout liability reagent.
CN201810134450.8A 2018-02-09 2018-02-09 A kind of method for detecting LRP2 gene SNP site rs2544390 genotype Pending CN108179183A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810134450.8A CN108179183A (en) 2018-02-09 2018-02-09 A kind of method for detecting LRP2 gene SNP site rs2544390 genotype

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810134450.8A CN108179183A (en) 2018-02-09 2018-02-09 A kind of method for detecting LRP2 gene SNP site rs2544390 genotype

Publications (1)

Publication Number Publication Date
CN108179183A true CN108179183A (en) 2018-06-19

Family

ID=62552587

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810134450.8A Pending CN108179183A (en) 2018-02-09 2018-02-09 A kind of method for detecting LRP2 gene SNP site rs2544390 genotype

Country Status (1)

Country Link
CN (1) CN108179183A (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117618528A (en) * 2023-12-01 2024-03-01 广东医科大学 Sipunculus nudus polypeptide SRP and application thereof in preparation of acute kidney injury treatment drugs

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105296650A (en) * 2015-11-25 2016-02-03 广州莱德璞检测技术有限公司 Method for detecting rs9263726 allele
CN106133136A (en) * 2014-01-17 2016-11-16 松尾洋孝 Gout morbidity association molecule, uric acid association disease quality associate evaluation methodology and kits for evaluation, inspection body and the medicine of disease quality with inflammation
CN106929591A (en) * 2017-04-21 2017-07-07 武汉友芝友医疗科技股份有限公司 A kind of human HLA B*5801 genetic polymorphism detection kits
CN107058509A (en) * 2017-02-28 2017-08-18 苏州百源基因技术有限公司 Kit and its detection method for detecting SLC2A9 gene SNP site rs3775948 genotype
CN107058594A (en) * 2017-06-19 2017-08-18 中山大学附属第三医院 A kind of method, primer and kit for detecting gout tumor susceptibility gene SNP genotype

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106133136A (en) * 2014-01-17 2016-11-16 松尾洋孝 Gout morbidity association molecule, uric acid association disease quality associate evaluation methodology and kits for evaluation, inspection body and the medicine of disease quality with inflammation
CN105296650A (en) * 2015-11-25 2016-02-03 广州莱德璞检测技术有限公司 Method for detecting rs9263726 allele
CN107058509A (en) * 2017-02-28 2017-08-18 苏州百源基因技术有限公司 Kit and its detection method for detecting SLC2A9 gene SNP site rs3775948 genotype
CN106929591A (en) * 2017-04-21 2017-07-07 武汉友芝友医疗科技股份有限公司 A kind of human HLA B*5801 genetic polymorphism detection kits
CN107058594A (en) * 2017-06-19 2017-08-18 中山大学附属第三医院 A kind of method, primer and kit for detecting gout tumor susceptibility gene SNP genotype

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
孙雪: "尿酸与糖代谢的相关性及遗传关联分析", 《中国优秀硕士学位论文全文数据库(电子期刊)医药卫生科技辑》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN117618528A (en) * 2023-12-01 2024-03-01 广东医科大学 Sipunculus nudus polypeptide SRP and application thereof in preparation of acute kidney injury treatment drugs

Similar Documents

Publication Publication Date Title
CN107058594A (en) A kind of method, primer and kit for detecting gout tumor susceptibility gene SNP genotype
CN108517360A (en) A kind of circulating tumor dissociative DNA abrupt climatic change quality-control product and preparation method thereof
CN107058538B (en) Primer composition, kit composed of primer composition and application of kit
CN107488711A (en) The method and its kit of the genotype detection of point mutation
WO2024055406A1 (en) Soybean saponin-related kasp marker and use thereof
CN105925689A (en) Molecular marker and method for identifying allelotype of rice chalk gene Chalk5
CN105671167A (en) Specific primer-probe set for porcine-derived real-time fluorescent PCR (polymerase chain reaction) detection
CN109161543B (en) DNA probe for enriching low-frequency DNA mutation and application thereof
CN106834287A (en) A kind of SNP marker for detecting RhD negative phenotypes
JP2005503149A (en) Genetic polymorphisms involved in ion channel disease
CN108179183A (en) A kind of method for detecting LRP2 gene SNP site rs2544390 genotype
CN106701945A (en) Kit used for detecting genotype of GATA4 gene SNP site rs867858
CN107190071B (en) It is a kind of for detecting the SNP marker of RhD variation phenotypes
CN109735610A (en) It is a kind of for detecting the gene polymorphism sites of para-Bombay blood group
CN113981071A (en) CSF1R related gene mutation as marker for diagnosing CVM and application thereof
CN104830991A (en) Primer and kit for detecting PDGFRA (platelet-derived growth factor receptor alpha) gene D842V polymorphic sites and PCR (polymerase chain reaction) method of primer and kit
CN105442053B (en) A kind of DNA library of checkout and diagnosis ion channel disease Disease-causing gene and its application
CN111518896A (en) Primer group, application, product and method for detecting nicotine dependence related SNP site
CN106755439A (en) Kit for detecting GATA4 gene SNP site rs904018 genotype
CN101245393B (en) Method and reagent kit for forecasting outbreak age of carcinoma of colon
CN106701946A (en) Kit for detecting genotype of gene JAG2 at SNP site rs2238286
CN108103166A (en) A kind of method for detecting NLRP3 gene SNP site rs3806268 genotype
CN106701947A (en) Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893
CN107058509A (en) Kit and its detection method for detecting SLC2A9 gene SNP site rs3775948 genotype
CN108359718A (en) A method of detection TLR4 gene SNP site rs2149356 genotype

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180619