CN106701947A - Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893 - Google Patents

Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893 Download PDF

Info

Publication number
CN106701947A
CN106701947A CN201611246948.0A CN201611246948A CN106701947A CN 106701947 A CN106701947 A CN 106701947A CN 201611246948 A CN201611246948 A CN 201611246948A CN 106701947 A CN106701947 A CN 106701947A
Authority
CN
China
Prior art keywords
restructuring
cyp2c19
plasmid
genotype
snp site
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201611246948.0A
Other languages
Chinese (zh)
Inventor
谢小冬
车团结
王莉
尤崇革
李琳
李亚鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Baiyuan Gene Technology Co Ltd
Original Assignee
Suzhou Baiyuan Gene Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Baiyuan Gene Technology Co Ltd filed Critical Suzhou Baiyuan Gene Technology Co Ltd
Priority to CN201611246948.0A priority Critical patent/CN106701947A/en
Publication of CN106701947A publication Critical patent/CN106701947A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a kit for detecting the genotype of a gene CYP2C19 at an SNP site rs4986893. The kit comprises a primer pair and a PCR detection reaction reagent, wherein the primer pair is one of (1) and (2): (1) an upstream primer: 5'-CATCAGGATTGTAAGCACCCCC-3' and a downstream primer: 5'-TTTCTCAGGAAGCAAAAAACTTGG-3'; (2) complementary sequences for the sequences in (1). The kit disclosed by the invention can accurately detect the genotype of the gene CYP2C19 at the SNP site rs4986893, and is high in sensitivity, high in specificity and quick in detection. By the application of the kit, the parting result and the sequencing result of the genotype of the gene CYP2C19 at the SNP site rs4986893 are completely consistent, so that the kit can be used for individualized treatment based on CYP2C19 rs4986893 related medicines.

Description

For detectingCYP2C19The kit of gene SNP site rs4986893 genotype
Technical field
The present invention relates to be used to detectCYP2C19The kit of gene SNP site rs4986893 genotype.
Background technology
The metabolism that CYP2C19 not only participates in antiepileptic is had proven at present, and many clinical important drugs are all Its substrate.The mankind can be divided into 2 kinds of phenotypes to the oxidative metabolism ability of medicine, and one kind is strong metabolic pattern, and another kind is weak metabolism Type, the latter causes mainly due to CYP2C19*2 and CYP2C19*3 the two deficiency allele.Due to Different Individual There is the difference in terms of drug metabolism, thus it is possible that serious adverse reaction or drug dose are not enough after administration, so that Cause the failure for the treatment of.CYP2C19 can be catalyzed a series of medicines, such as S- mephenytoins (S-mephenytoin, S- in vivo MP), Omeprazole（Omeprazole, OPZ）, western juice (diazepam, DZ), remove the western juice in first ground（demethyldiazepam ), imipramine（Imipramine, IMI), orinase (tolbutamide, D860), phenobarbital (phenobarbital, PB), chloroguanide (proguanil) and two chloroguanides (chlorproguanil) etc..
CYP2C19rs4986893（CYP2C19*3）It is that base at the 4th extron the 636th morphs（G>A）, The codon of 212 original codes for amino acid tryptophan is set to be changed into terminator codon, so as to only produceCYP2C19The volume of preceding 4 extrons Code product：The inactive protein being only made up of 211 amino acid.
The content of the invention
The invention provides for detectingCYP2C19The kit of gene SNP site rs4986893 genotype, detection knot Fruit can be used inCYP2C19 Rs4986893 related medicine individualized treatment.
First purpose of the invention is to provide for detectingCYP2C19The examination of gene SNP site rs4986893 genotype Agent box, the kit includes primer pair and PCR detection reaction reagents；Wherein, the primer pair is（1）Or（2）In one kind：
（1）Sense primer：CYP2C19-F 5'- CATCAGGATTGTAAGCACCCCC-3'
Anti-sense primer：CYP2C19-R 5'- TTTCTCAGGAAGCAAAAAACTTGG-3'；
（2）With（1）In complementary series.
Also in protection scope of the present invention, the derived sequence is to 5 ' ends and/or 3 ' ends to the derived sequence of above-mentioned primer Direction extends consistent several bases or deletes the sequence that consistent several bases are obtained.
Preferably, the PCR detections reaction reagent includes the Green-2-Go containing EvaGreen qPCRMastermix。
Preferably, the reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Preferably, the kit also includes standard items, the standard items are the negative plasmid of restructuring and the positive matter of restructuring Grain, the nucleotides sequence of the negative plasmid of restructuring is classified as sequence table SEQ ID No.1, the nucleotides sequence of the restructuring positive plasmid It is classified as SEQ ID No.2 in sequence table.
Second object of the present invention is to provide a kind of detectionCYP2C19The side of gene SNP site rs4986893 genotype Method, step is as follows：
（1）Build the negative plasmid of restructuring and restructuring positive plasmid：The nucleotides sequence of the negative plasmid of restructuring is classified as in sequence table SEQ ID No.1, the nucleotide sequence of the restructuring positive plasmid is referring to SEQ ID No.2 in sequence table；
（2）Primer pair when PCR is expanded is built, the primer pair is the one kind in a or b：
A, sense primer：CYP2C19-F 5'- CATCAGGATTGTAAGCACCCCC-3'
Anti-sense primer：CYP2C19-R 5'- TTTCTCAGGAAGCAAAAAACTTGG-3'；
Complementary series in b and a；
（3）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested DNA uses step（2）The primer, and enter performing PCR amplification and HRM analyses under identical conditions, collect data；
Preferably, the condition of the HRM analyses is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, raising speed in temperature Rate is 0.06 DEG C/s；
（4）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent Line judges sample to be testedCYP2C19The genotype of gene SNP site rs4986893：
Melting curve with the negative plasmid of restructuring overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is GG；
Melting curve with restructuring positive plasmid overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is AA；
Between the negative plasmid of restructuring and restructuring positive plasmid thenCYP2C19The genotype of gene SNP site rs4986893 is GA。
Preferably, the reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Preferably, the reaction condition when PCR is expanded is：94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C are moved back Fire/extend 20s；40 circulations.
Third object of the present invention is to provide the application method of mentioned reagent box, and step is as follows：
（1）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested DNA uses same primers, and enters performing PCR amplification and HRM analyses under identical conditions, collects data；
The condition of HRM analysis is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, temperature rate-of-rise is 0.06 ℃/s；
（2）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent Line judges sample to be testedCYP2C19The genotype of gene SNP site rs4986893：
Melting curve with the negative plasmid of restructuring overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is GG；
Melting curve with restructuring positive plasmid overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is AA；
Between the negative plasmid of restructuring and restructuring positive plasmid thenCYP2C19The genotype of gene SNP site rs4986893 is GA。
Fourth object of the present invention be to provide mentioned reagent box prepare withCYP2C19 Rs4986893 related medicine Application in individualized treatment reagent.
Kit of the invention can be detected accuratelyCYP2C19The genotype of gene SNP site rs4986893, sensitivity Height, specificity is good, and detection is quick；Using kit pair of the inventionCYP2C19Gene SNP site rs4986893 genotype Parting is completely the same with sequencing result, can be used inCYP2C19 Rs4986893 related medicine individualized treatment, to subsequently grinding Study carefully significant.
Brief description of the drawings
Accompanying drawing is used for providing a further understanding of the present invention, and constitutes a part for specification, with reality of the invention Applying example is used to explain the present invention together, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is HRM methods sensitivity experiment result of the invention.
Fig. 2 is sample HRM methods analysis result of the invention.
Fig. 3 is sampleCYP2C19 rs4986893（c.636G>A）The sequencing result in site；Wherein a represents wild type Sequence, b represents homozygous mutant sequence, and c is heterozygous mutant sequence.
Specific embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, unless otherwise specified, is conventional method.Test material used in following embodiments, unless otherwise specified, is city Sell.Primer used herein and sequent synthesis used and examining order are by raw work bioengineering（Shanghai）Limited company is complete Into.
Embodiment 1CYP2C19 The preparation of rs4986893 standard items
Set up HRM analysis methods it may first have to the external standards needed for preparation method, standard items should comprising highly conserved and Specific sequence, it is ensured that the high specific of reaction.Present invention synthesis is includedCYP2C19 rs4986893（c.636G>A）Position The wild type and homozygous mutant DNA sequence dna of point, are cloned into pMD18-T carriers using gene recombination technology, are constructed The wild type and homozygous mutant of recombinant plasmid pMD18-T-rs4986893, and corresponding PCR identifications and sequencing identification are carried out, Most afterwards through quantitative as the standard items for treating method for building up：Wild type recombinant plasmid is the negative plasmid of restructuring, homozygous mutant restructuring Plasmid is restructuring positive plasmid, is that the method for next step and assessment lay the foundation.
First, structure and the conversion of negative and positive plasmid pMD18-T-rs4986893 are recombinated
1. synthesizeCYP2C19 rs4986893（c.636G>A）Wild type and homozygous mutant DNA sequence dna, the sequence of present invention synthesis Row 200bp, sequence is as follows：
（1）Wild-type sequence
ATAAAGATCAGCAATTTCTTAACTTGATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTGGAT CCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTTTTTTTCTGGGAAATCCAAAATTCTATATT GACCAAGCCCTGAAGTACATTTTTGAATACTACAGTCTTGCCTAGACAGC
The base being wherein underlined is gene mutation site.
（2）Homozygous mutant sequence
ATAAAGATCAGCAATTTCTTAACTTGATGGAAAAATTGAATGAAAACATCAGGATTGTAAGCACCCCCTGAAT CCAGGTAAGGCCAAGTTTTTTGCTTCCTGAGAAACCACTTACAGTCTTTTTTTCTGGGAAATCCAAAATTCTATATT GACCAAGCCCTGAAGTACATTTTTGAATACTACAGTCTTGCCTAGACAGC
The base being wherein underlined is gene mutation site.
2. coupled reaction：The DNA fragmentation of above-mentioned synthesis is attached with pMD18-T, is carried out using following linked system Prepare：
pMD18-T 1μL
DNA 2μL
SolutionI 5μL
ddH2O 2μL
The μ L of cumulative volume 10
16 DEG C are placed in after the completion of preparation carries out overnight coupled reaction.
3. the conversion of pMD18-T-rs4986893 plasmids and PCR are identified
（1）The DH5 α competent cells for freezing are taken out from -80 DEG C of ultra low temperature freezer, being placed on ice chest makes it thaw；
（2）Take in the DH5 α competent cells of the 50 μ L of the μ L of connection product 10 additions that step 2 is obtained, gently shake up rearmounted ice bath 30 Minute；
（3）42 DEG C of water-bath heat shocks 90 seconds, put cooled on ice 2min immediately after heat shock；
（4）After adding the piping and druming of the LB fluid nutrient mediums without resistance of the 1ml of precooling to mix in 1.5ml EP pipes, 37 DEG C 120 Rev/min jog culture 90min；
（5）The of short duration centrifugation of above-mentioned nutrient solution is sucked and take remaining 100 μ l after 900 μ l and coat the LB flat boards containing Amp antibiotic On, face up placement 30min, after bacterium solution is cultured base absorption completely, is inverted 37 DEG C of insulating box overnight incubations of culture dish；
（6）From 1.5ml EP pipe of the picking monoclonal bacterium colony on flat board in 500 μ L Amp resistance LB fluid nutrient mediums, 37 DEG C 220rpm shaken cultivations 5-6 hours；
（7）Take 1 μ L carries out bacterium solution PCR identifications as template.The bacterium solution that the positive will be accredited as is added to the LB Liquid Cultures of 20ml Expansion is carried out in base to shake；
（8）Above-mentioned dilution bacterium solution is expanded with primer CYP2C19-F and CYP2C19-R, PCR primer is using 2% Ago-Gel electricity Swimming, by detecting that PCR primer identifies positive transformant.
Primer sequence is that HRM analyzes the primer, and sequence is as follows：
Sense primer：CYP2C19-F 5'- CATCAGGATTGTAAGCACCCCC-3'
Anti-sense primer：CYP2C19-R 5'- TTTCTCAGGAAGCAAAAAACTTGG-3'
System is as follows：
10×PCR buffer 2μL
dNTP（2.5μM） 2μL
Primers F（5μM） 1.5μL
Primer R（5μM） 1.5μL
The μ L of template 2
Taq enzyme（5U） 0.5μL
ddH2O 10.5μL
The μ L of cumulative volume 20.
Amplification program/reaction condition：94 DEG C of predegeneration 5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30sec, 35 are followed Ring；72℃ 10min.
4. the extraction of negative and positive plasmid is recombinated
The Plasmid Preparation kit produced using the Imtech of Beijing hundred extracts recombinant plasmid, determines concentration and purity, while inhaling Take a part of plasmid purification and deliver to Shanghai bioengineering Co., Ltd and be sequenced, determine the gene order and purpose of Insert Fragment Sequence is consistent.
2nd, the acquisition of standard items and quantitative
（1）The μ l of bacillus coli DH 5 alpha 100 containing recombinant plasmid pMD18-T-rs4986893 for freezing that step one is obtained are connect Plant in the LB fluid nutrient mediums of 15ml ammonia benzyl resistances, 37 DEG C of 220rpm cultivate 14-16h；
（2）The Plasmid Preparation kit produced using the Tyke bio tech ltd of Beijing hundred extracts recombinant plasmid；
（3）Using the ultramicron ultraviolet-uisible spectrophotometer of the Tyke bio tech ltd of Beijing hundred（ND5000）To extracting Plasmid determine concentration, according to A260/A280Judge the purity of plasmid.A260/A280=1.78。
The HRM-PCR of embodiment 2 is detectedCYP2C19The foundation of rs4986893 methods
First, the preparation of sample to be tested
30 poba gene group DNA of sample are extracted, is used asCYP2C19The template of gene PCR amplification.Poba gene group DNA's Extraction step is as follows：
（1）1ml whole bloods are taken, 3ml TE are added, 10min is stood after reverse mixing, 8000rpm is centrifuged 5 minutes, abandons supernatant；
（2）2-3 times is repeated the above steps to being precipitated as white；
（3）Add 900 μ l 10%SDS and 10 μ l 10mg/ml Proteinase Ks, 55 DEG C of water-bath 1h；
（4）Centrifuge tube is cooled to room temperature, isometric phenol/chloroform/isoamyl alcohol is added（25:24:1）Mix, 12000rpm from Heart 10min；
（5）Isometric phenol/chloroform/isoamyl alcohol is added after careful absorption supernatant（25:24:1）Mix, 12000rpm centrifugations 10min；
（6）Supernatant is taken, adds the absolute ethyl alcohol of two volumes, mixing of turning upside down, 12000rpm centrifugation 10min to abandon supernatant；
（7）Plus 500 μ l 70% ethanol washing precipitation, abandon supernatant after of short duration centrifugation, uncap to dry to ethanol and volatilize completely；
（8）Plus 50 μ l distilled waters or TE dissolving DNAs, -20 DEG C of preservations.
2nd, the design of specific primer and synthesis
The present invention is by ncbi databaseCYP2C19Rs4986893 gene orders are retrieved, and are chosen and are adapted to design primer Fragment sequence be target, devise one group of HRM-PCR primer.
The extension increasing sequence that the present invention chooses is as follows：
The base being wherein underlined is gene mutation site.
The primer sequence is as follows：
Sense primer：CYP2C19-F 5'- CATCAGGATTGTAAGCACCCCC-3'
Anti-sense primer：CYP2C19-R 5'- TTTCTCAGGAAGCAAAAAACTTGG-3'
Amplified fragments size is：61bp.The nucleotides sequence of amplification is classified as：
3rd, HRM-PCR reaction systems and reaction condition
Respectively with sample to be tested DNA, the negative plasmid of restructuring and restructuring positive plasmid as template, with above-mentioned primer CYP2C19-F and CYP2C19-R is amplimer, and entering performing PCR using such as following systems and reaction condition expands.
PCR system：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Wherein primer is biological using raw work using CYP2C19-F and CYP2C19-R, HRM-PCR（Shanghai）Green-2-Go QPCRMastermix kits.HRM analyzers are hundred source Gene A SA-9600 real-time fluorescence quantitative PCR instrument.
PCR amplification programs：
94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations.
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise is 0.06 DEG C/s.
4th, interpretation of result
High-resolution melting curve is drawn according to data are collected, according to the negative plasmid of restructuring, the melting curve of restructuring positive plasmid Judge sample to be testedCYP2C19The genotype of gene SNP site rs4986893：
Melting curve with the negative plasmid of restructuring overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is GG；
Melting curve with restructuring positive plasmid overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is AA； Between the negative plasmid of restructuring and restructuring positive plasmid thenCYP2C19The genotype of gene SNP site rs4986893 is GA.
5th, HRM sensitivity experiments
Restructuring positive plasmid and the negative plasmid of restructuring are diluted to 50ng/ μ l, then the two mixing, accounts for recombinate positive plasmid Ratio is followed successively by 50%, 25%, 12.5%, 5%, 2% and 1% and carries out gradient dilution, enters according to above-mentioned HRM-PCR reaction systems and parameter Row amplification, analysis mutation inspection range, i.e. sensitivity.
Reaction system is as follows：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
PCR amplification programs：
94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations；
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise is 0.06 DEG C/s.
Result is shown in Fig. 1, and experimental data shows, when positive plasmid is respectively 1 with negative plasmid volume ratio:1、1:3、1:7、1: 19、1:49 and 1:When 99, positive plasmid can be detected, so the sensitivity of present invention HRM detection methods used is 1%.
The application detection method of the invention of embodiment 3 detects sampleCYP2C19 Rs4986893 genotype
With detection kit and detection method in the step of embodiment 2, HRM analyses are carried out to 30 samples, with the positive matter of restructuring Grain and the negative plasmid melting curve of restructuring are compared, and the mutation type in sample is determined according to this, and according to HRM analysis result pins It is biological in raw work that 1 sample is selected every kind of genotype at random（Shanghai）Carry out Sanger sequence verifications.
HRM analysis results referring to table 1 and Fig. 2, in 30 samples of data displayCYP2C19Gene rs4986893 is G>A is miscellaneous Closing saltant type has 7, G>A homozygous mutants 6, remaining 16 is wild type.
Sanger sequencing results are referring to Fig. 3：Wherein a is the sequencing result of sample number 2, and b is the sequencing of sample number 11 As a result, c is the sequencing result of sample number 20；Sanger sequencing results are completely the same with the result that the inventive method is detected.
The application method of the present invention of table 1 is to sampleCYP2C19The analysis result of gene rs4986893
Embodiment 4 is used to detectCYP2C19The kit of gene SNP site rs4986893 genotype
It is of the invention for detectingCYP2C19The kit of gene SNP site rs4986893 genotype includes following components：
（1）CYP2C19Rs4986893 standard items：The negative plasmid of restructuring and restructuring positive plasmid, according to the method in embodiment 1 Prepare；
（2）Primer：The primer sequence is：
Sense primer：CYP2C19-F 5'- CATCAGGATTGTAAGCACCCCC-3'
Anti-sense primer：CYP2C19-R 5'- TTTCTCAGGAAGCAAAAAACTTGG-3'；
（3）The PCR amplifing reagents of the Green of Eva containing saturated fluorescence dyestuff.
Detected using the kitCYP2C19The method of gene SNP site rs4986893 genotype is same as Example 2.
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention, Although being described in detail to the present invention with reference to the foregoing embodiments, for a person skilled in the art, it still may be used Modified with to the technical scheme described in foregoing embodiments, or equivalent is carried out to which part technical characteristic. All any modification, equivalent substitution and improvements within the spirit and principles in the present invention, made etc., should be included in of the invention Within protection domain.
Sequence table
<110>Suzhou Bai Yuan gene technology Co., Ltd
<120>Kit for detecting CYP2C19 gene SNP site rs4986893 genotype
<170> PatentIn version 3.5
<210> 1
<211> 200
<212> DNA
<213>Artificial sequence
<400> 1
ataaagatca gcaatttctt aacttgatgg aaaaattgaa tgaaaacatc aggattgtaa 60
gcaccccctg gatccaggta aggccaagtt ttttgcttcc tgagaaacca cttacagtct 120
ttttttctgg gaaatccaaa attctatatt gaccaagccc tgaagtacat ttttgaatac 180
tacagtcttg cctagacagc 200
<210> 2
<211> 200
<212> DNA
<213>Artificial sequence
<400> 2
ataaagatca gcaatttctt aacttgatgg aaaaattgaa tgaaaacatc aggattgtaa 60
gcaccccctg aatccaggta aggccaagtt ttttgcttcc tgagaaacca cttacagtct 120
ttttttctgg gaaatccaaa attctatatt gaccaagccc tgaagtacat ttttgaatac 180
tacagtcttg cctagacagc 200
<210> 3
<211> 144
<212> DNA
<213>Artificial sequence
<400> 3
gatcagcaat ttcttaactt gatggaaaaa ttgaatgaaa acatcaggat tgtaagcacc 60
ccctggatcc aggtaaggcc aagttttttg cttcctgaga aaccacttac agtctttttt 120
tctgggaaat ccaaaattct atat 144
<210> 4
<211> 61
<212> DNA
<213>Artificial sequence
<400> 4
catcaggatt gtaagcaccc cctggatcca ggtaaggcca agttttttgc ttcctgagaa 60
a 61

Claims (9)

1. it is used to detectCYP2C19The kit of gene SNP site rs4986893 genotype, it is characterised in that：The kit Including primer pair and PCR detection reaction reagents；Wherein, the primer pair is（1）Or（2）In one kind：
（1）Sense primer：CYP2C19-F 5'- CATCAGGATTGTAAGCACCCCC-3'
Anti-sense primer：CYP2C19-R 5'- TTTCTCAGGAAGCAAAAAACTTGG-3'；
（2）With（1）In complementary series.
2. kit according to claim 1, it is characterised in that：The PCR detections reaction reagent includes containing EvaGreen Green-2-Go qPCRMastermix.
3. kit according to claim 2, it is characterised in that：The reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
4. according to any described kits of claim 1-3, it is characterised in that：The kit also includes standard items, described Standard items are the negative plasmid of restructuring and restructuring positive plasmid, and the nucleotides sequence of the restructuring feminine gender plasmid is classified as sequence table SEQ ID No.1, the nucleotides sequence of the restructuring positive plasmid is classified as SEQ ID No.2 in sequence table.
5. a kind of detectionCYP2C19The method of gene SNP site rs4986893 genotype, it is characterised in that：Step is as follows：
（1）Build the negative plasmid of restructuring and restructuring positive plasmid：The nucleotides sequence of the negative plasmid of restructuring is classified as in sequence table SEQ ID No.1, the nucleotide sequence of the restructuring positive plasmid is referring to SEQ ID No.2 in sequence table；
（2）Primer pair when PCR is expanded is built, the primer pair is the one kind in a or b：
A, sense primer：CYP2C19-F 5'- CATCAGGATTGTAAGCACCCCC-3'
Anti-sense primer：CYP2C19-R 5'- TTTCTCAGGAAGCAAAAAACTTGG-3'；
Complementary series in b and a；
（3）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested DNA uses step（2）The primer, and enter performing PCR amplification and HRM analyses under identical conditions, collect data；
Preferably, the condition of the HRM analyses is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, raising speed in temperature Rate is 0.06 DEG C/s；
（4）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent Line judges sample to be testedCYP2C19The genotype of gene SNP site rs4986893：
Melting curve with the negative plasmid of restructuring overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is GG；
Melting curve with restructuring positive plasmid overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is AA；
Between the negative plasmid of restructuring and restructuring positive plasmid thenCYP2C19The genotype of gene SNP site rs4986893 is GA。
6. method according to claim 5, it is characterised in that：The reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
7. method according to claim 6, it is characterised in that：The reaction condition when PCR is expanded is：94 DEG C of predegenerations 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations.
8. the application method of any described kits of claim 1-4, it is characterised in that：Step is as follows：
（1）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested DNA uses same primers, and enters performing PCR amplification and HRM analyses under identical conditions, collects data；
The condition of HRM analysis is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, temperature rate-of-rise is 0.06 ℃/s；
（2）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent Line judges sample to be testedCYP2C19The genotype of gene SNP site rs4986893：
Melting curve with the negative plasmid of restructuring overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is GG；
Melting curve with restructuring positive plasmid overlaps thenCYP2C19The genotype of gene SNP site rs4986893 is AA；
Between the negative plasmid of restructuring and restructuring positive plasmid thenCYP2C19The genotype of gene SNP site rs4986893 is GA。
9. any described kits of claim 1-4 prepare withCYP2C19 Rs4986893 related medicine individuation is controlled Treat the application in reagent.
CN201611246948.0A 2016-12-29 2016-12-29 Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893 Pending CN106701947A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201611246948.0A CN106701947A (en) 2016-12-29 2016-12-29 Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611246948.0A CN106701947A (en) 2016-12-29 2016-12-29 Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893

Publications (1)

Publication Number Publication Date
CN106701947A true CN106701947A (en) 2017-05-24

Family

ID=58906019

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611246948.0A Pending CN106701947A (en) 2016-12-29 2016-12-29 Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893

Country Status (1)

Country Link
CN (1) CN106701947A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108949995A (en) * 2018-08-23 2018-12-07 山东德诺生物科技有限公司 For detecting the primed probe group and its application of rs4986893
CN110106236A (en) * 2019-05-06 2019-08-09 上海派森诺生物科技股份有限公司 Utilize the kit and its method of high-resolution melting curve method detection Levetiracetam medication related gene SCN1A polymorphism

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103952481A (en) * 2014-04-04 2014-07-30 宋竞岩 Primer combination for detecting allele CYP2C19*3 and detection kit thereof
CN104450935A (en) * 2014-12-25 2015-03-25 上海中优医药高科技有限公司 Method for detecting relevant gene polymorphism of clopidogrel medication by adopting HRM technology

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103952481A (en) * 2014-04-04 2014-07-30 宋竞岩 Primer combination for detecting allele CYP2C19*3 and detection kit thereof
CN104450935A (en) * 2014-12-25 2015-03-25 上海中优医药高科技有限公司 Method for detecting relevant gene polymorphism of clopidogrel medication by adopting HRM technology

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LINAZHANG ET AL.: "Comparison of High-Resolution Melting Analysis, TaqMan Allelic Discrimination Assay, and Sanger Sequencing for Clopidogrel Efficacy Genotyping in Routine Molecular Diagnostics", 《THE JOURNAL OF MOLECULAR DIAGNOSTICS》 *
SONG C ET AL.: "Rapid and sensitive detection of KRAS mutation after fast-COLD-PCR enrichment and high-resolution melting analysis", 《DIAGN MOL PATHOL》 *
刘丽琴: "结直肠癌和肺癌KRAS和BRAF基因突变HRM检测方法的建立", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 *
左伋 等: "《遗传医学进展》", 31 May 2014, 复旦大学出版社 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108949995A (en) * 2018-08-23 2018-12-07 山东德诺生物科技有限公司 For detecting the primed probe group and its application of rs4986893
CN110106236A (en) * 2019-05-06 2019-08-09 上海派森诺生物科技股份有限公司 Utilize the kit and its method of high-resolution melting curve method detection Levetiracetam medication related gene SCN1A polymorphism

Similar Documents

Publication Publication Date Title
CN107858373A (en) Endothelial cell conditionity knocks out the construction method of CCR5 genetic mouse models
JP2008278871A (en) Probe set, probe carrier and method for discriminating and identifying fungus
CN106978497A (en) Detection primer, probe and the detection kit of EML4 ALK fusion gene mutations
CN105950747A (en) Rice blast resistance gene Pi1 functional specificity molecular marker and application thereof
CN107058594A (en) A kind of method, primer and kit for detecting gout tumor susceptibility gene SNP genotype
CN109868324B (en) Specific primer and detection method thereof
CN106811530A (en) Kit and primer based on HRM technology for detection Drug Resistance of Mycobacterium Tuberculosis
CN108753776A (en) A kind of circular rna circGHR and detection primer participating in chicken muscle growth and development
WO2024055406A1 (en) Soybean saponin-related kasp marker and use thereof
CN102776286A (en) Primer, probe and assay kit for detecting v-ros avian UR2 sarcoma viral oncogene homolog 1 (ROS1) gene fusion mutation
CN103374575B (en) CYP4V2 gene mutant and application thereof
CN109136389A (en) A kind of DNA bar code standard detection segment CO II, kit and its application method identifying American cockroach
CN103074415A (en) Obesity gene susceptivity and pre-warning detection kit
CN106701947A (en) Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893
CN104830984B (en) The fluorescence PCR detecting method and the primer and probe of melon anthrax bacteria
CN109735610A (en) It is a kind of for detecting the gene polymorphism sites of para-Bombay blood group
CN106701945A (en) Kit used for detecting genotype of GATA4 gene SNP site rs867858
CN107574171A (en) A kind of corn salt resistance main effect QTL and its related gene, molecular labeling and application
CN107190071A (en) A kind of SNP marker for being used to detect RhD variation phenotypes
KR101566472B1 (en) Method for identifying of Mulberry tree
CN106755439A (en) Kit for detecting GATA4 gene SNP site rs904018 genotype
CN106701946A (en) Kit for detecting genotype of gene JAG2 at SNP site rs2238286
CN106755440A (en) Kit for detecting NOTCH3 gene SNP site rs12082 genotype
CN113981072A (en) Primers, probes, kit and method for detecting HLA-A29 gene
CN113717980A (en) Gene for controlling color of peach epicarp and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20170524

RJ01 Rejection of invention patent application after publication