CN106701945A - Kit used for detecting genotype of GATA4 gene SNP site rs867858 - Google Patents
Kit used for detecting genotype of GATA4 gene SNP site rs867858 Download PDFInfo
- Publication number
- CN106701945A CN106701945A CN201611244552.2A CN201611244552A CN106701945A CN 106701945 A CN106701945 A CN 106701945A CN 201611244552 A CN201611244552 A CN 201611244552A CN 106701945 A CN106701945 A CN 106701945A
- Authority
- CN
- China
- Prior art keywords
- restructuring
- plasmid
- gata4
- genotype
- gene snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a k it used for detecting the genotype of a GATA4 gene SNP site rs867858. The kit comprises a primer pair and a PCR detection reaction reagent, wherein the primer pair is one of (1) an upstream primer GATA4-F 5'-TTGCATTGTGTTTCTAGCACCGAG-3' and a downstream primer GATA4-R 5'-AGATGCCGTCATTCGGGCTG-3' and (2) a sequence complementary to the (1). The kit can accurately detect the genotype of the GATA4 gene SNP site rs867858, has the advantages of high sensitivity, good specificity and fast detection; and the parting and sequencing result of the GATA4 gene SNP site rs867858, obtained by using the kit, is consistent, so the kit can be used for auxiliary determination of the ventricular septal defect type heart disease.
Description
Technical field
Kit the present invention relates to be used to detect GATA4 gene SNP site rs867858 genotype.
Background technology
GATA4 is located at chromosome 8q23.1, cDNA total length 3414bp, including 6 extrons, encodes by 442 amino acid
The protein of composition, it is highly conserved in evolution.Transcriptional activation domain, middle two neighbouring zinc fingerses of the GATA4 by N-terminal
The transcriptional activation domain of domain and C-terminal is constituted, and Zinc finger domain Cys-X2-Cys-X17-Cys-X2-Cys therein can be with target base
Because DNA sequence element 5 '-(A/T) GATA (A/G) -3 ' of promoter region is combined, so as to adjust the transcriptional activity of downstream target gene.
GATA4, as zinc finger protein activating transcription factor, is one of GATA gene families, to the heart early stage heart development
The formation of pipe and the differentiation of heart primordial cell, regulating and controlling effect is shifted.In autosomal dominant inheritance, GATA4 genes
Mutation is relevant with most of atrial septal defects, and some patientss merge ventricular septal defect, pulmonary stenosis etc., and with serious
Diastolic dysfunction and chamber backflow lesion, illustrate that GATA4 genes also have important regulation and control in human heart growth course
Effect, GATA4 genetic heterozygosis mutation may cause haplotype not enough or dominant negative effect, trigger congenital heart disease.
High-resolution melting curve（high resolution melting, HRM）It is in the reaction of Conventional polymerase chain formula
（PCR）During saturated fluorescence dye Tu such as Eva Green combined with DNA double chain, when making DNA double chain dissociate by heat temperature raising
When, fluorescent dye is discharged from the local DNA molecular for unwinding, and double-strand can be made due to being mismatched between mutation, SNP site double-strand base
DNA is untied first in this site, by the fluorescence intensity in real-time monitoring temperature-rise period, from fluorescence intensity and time axial curve
Just can determine whether there is mutation or SNP.Different loci, heterozygote whether, G/C content, amplicon length etc. can all influence to melt bent
The peak shape of line, so HRM analyses can effectively distinguish different mutational sites, SNP site and possess the amplified fragments of different G/C contents.
The content of the invention
The invention provides the kit for detecting GATA4 gene SNP rs867858 genotype.Testing result can use
In the congenital atrial septal defect type cardiopathic auxiliary diagnosis related to GATA4 gene SNPs rs867858.
First purpose of the invention is to provide the kit for GATA4 gene SNP site rs867858 genotype, institute
Stating kit includes primer pair and PCR detection reaction reagents；Wherein, the primer pair is（1）Or（2）In one kind：
（1）Sense primer：GATA4-F 5'- TTGCATTGTGTTTCTAGCACCGAG-3'
Anti-sense primer：GATA4-R 5'- AGATGCCGTCATTCGGGCTG-3'；
（2）With（1）In complementary series.
Also in protection scope of the present invention, the derived sequence is to 5 ' ends and/or 3 ' ends to the derived sequence of above-mentioned primer
Direction extends consistent several bases or deletes the sequence that consistent several bases are obtained.
Preferably, the PCR detections reaction reagent includes the Green-2-Go qPCRMastermix containing EvaGreen.
Preferably, the reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Preferably, the kit also includes standard items, the standard items are the negative plasmid of restructuring and the positive matter of restructuring
Grain, the nucleotides sequence of the negative plasmid of restructuring is classified as sequence table SEQ ID No.1, the nucleotides sequence of the restructuring positive plasmid
It is classified as SEQ ID No.2 in sequence table.
Second object of the present invention is to provide a kind of method of detection GATA4 gene SNP site rs867858 genotype,
Step is as follows：
（1）Build the negative plasmid of restructuring and restructuring positive plasmid：The nucleotides sequence of the negative plasmid of restructuring is classified as in sequence table
SEQ ID No.1, the nucleotide sequence of the restructuring positive plasmid is referring to SEQ ID No.2 in sequence table；
（2）Primer pair when PCR is expanded is built, the primer pair is the one kind in a or b：
A, sense primer：GATA4-F 5'- TTGCATTGTGTTTCTAGCACCGAG-3'
Anti-sense primer：GATA4-R 5'- AGATGCCGTCATTCGGGCTG-3'；
Complementary series in b and a；
（3）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested
DNA uses step（2）The primer, and enter performing PCR amplification and HRM analyses under identical conditions, collect data；
Preferably, the condition of the HRM analyses is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, raising speed in temperature
Rate is 0.06 DEG C/s；
（4）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent
Line judges the genotype of sample to be tested GATA4 gene SNP sites rs867858：
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring positive plasmid is CC；
The genotype of the then GATA4 gene SNP sites rs867858 between the negative plasmid of restructuring and restructuring positive plasmid is AC.
Preferably, the reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Preferably, the reaction condition when PCR is expanded is：94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C are moved back
Fire/extend 20s；40 circulations.
Third object of the present invention is to provide the application method of mentioned reagent box, and step is as follows：
（1）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested
DNA uses same primers, and enters performing PCR amplification and HRM analyses under identical conditions, collects data；
The condition of HRM analysis is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, temperature rate-of-rise is 0.06
℃/s；
（2）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent
Line judges the genotype of sample to be tested GATA4 gene SNP sites rs867858：
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring positive plasmid is CC；
The genotype of the then GATA4 gene SNP sites rs867858 between the negative plasmid of restructuring and restructuring positive plasmid is AC.
Fourth object of the present invention is to provide mentioned reagent box and is preparing the auxiliary diagnosis congenital atrial septal defect type heart
Application in the reagent of popular name for.
Kit of the invention can accurately detect the genotype of GATA4 gene SNP sites rs867858, and sensitivity is high,
Specificity is good, and detection is rapid；Using kit of the invention to the parting of GATA4 gene SNP site rs867858 genotype with
Sequencing result is completely the same, can be used in the cardiopathic auxiliary judgment of ventricular septal defect type.
Brief description of the drawings
Accompanying drawing is used for providing a further understanding of the present invention, and constitutes a part for specification, with reality of the invention
Applying example is used to explain the present invention together, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is HRM methods sensitivity experiment result of the invention.
Fig. 2 is sample HRM methods analysis result of the invention.
Fig. 3 is the GATA4 rs867858 of sample（c.*354A>C）The sequencing result in site；Wherein a is homozygous mutant
Sequence, b is heterozygous mutant sequence, and c is wild-type sequence.
Specific embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment side in following embodiments
Method, unless otherwise specified, is conventional method.Test material used in following embodiments, unless otherwise specified, is commercially available.
Primer used herein and sequent synthesis used and examining order are by raw work bioengineering（Shanghai）Limited company completes.
The preparation of the GATA4rs867858 standard items of embodiment 1
Set up HRM analysis methods it may first have to the external standards needed for preparation method, standard items should comprising highly conserved and
Specific sequence, it is ensured that the high specific of reaction.Present invention synthesis includes GATA4 rs867858（c.*354A>C）Site
Wild type and homozygous mutant DNA sequence dna, be cloned into pMD18-T carriers using gene recombination technology, construct
The wild type and homozygous mutant recombinant plasmid of pMD18-T-rs867858, and corresponding PCR identifications and sequencing identification are carried out, most
By quantitatively rear as the standard items for treating method for building up：Wild type recombinant plasmid is the negative plasmid of restructuring, homozygous mutant restructuring
Plasmid is restructuring positive plasmid, is that the method for next step and assessment lay the foundation.
First, structure and the conversion of negative and positive plasmid pMD18-T-rs867858 are recombinated
1. GATA4 rs867858 are synthesized（c.*354A>C）Wild type and homozygous mutant DNA sequence dna, the sequence of present invention synthesis
400bp, sequence is as follows：
（1）Wild-type sequence
TGCATCTCTCCTGTGAGTTGGAGACTTCTTTCCCAAGATGTCCTTGTCCCCTGCGTTCCCCACTGTGGCCTAG
ACCGTGGGTTTTGCATTGTGTTTCTAGCACCGAGGATCTGAGAACAAGCGGAGGGCCGGGCCCTGGGACCCCTGCTC
CAGCCCGAATGACGGCATCTGTTTGCCATGTACCTGGATGCGACGGGCCCCTGGGGACAGGCCCTTGCCCCATCCAT
CCGCTTGAGGCATGGCACCGCCCTGCATCCCTAATACCAAATCTGACTCCAAAATTGTGGGGTGTGACATACAAGTG
ACTGAACACTTCCTGGGGAGCTACAGGGGCACTTAACCCACCACAGCACAGCCTCATCAAAATGCAGCTGGCAACTT
CTCCCCCAGGTGCCTTCCC
（2）Homozygous mutant sequence
TGCATCTCTCCTGTGAGTTGGAGACTTCTTTCCCAAGATGTCCTTGTCCCCTGCGTTCCCCACTGTGGCCTAG
ACCGTGGGTTTTGCATTGTGTTTCTAGCACCGAGGATCTGAGAACCAGCGGAGGGCCGGGCCCTGGGACCCCTGCTC
CAGCCCGAATGACGGCATCTGTTTGCCATGTACCTGGATGCGACGGGCCCCTGGGGACAGGCCCTTGCCCCATCCAT
CCGCTTGAGGCATGGCACCGCCCTGCATCCCTAATACCAAATCTGACTCCAAAATTGTGGGGTGTGACATACAAGTG
ACTGAACACTTCCTGGGGAGCTACAGGGGCACTTAACCCACCACAGCACAGCCTCATCAAAATGCAGCTGGCAACTT
CTCCCCCAGGTGCCTTCCC
The base being wherein underlined is gene mutation site.
2. coupled reaction：The DNA fragmentation of above-mentioned synthesis is attached with pMD18-T, is prepared using following linked system：
pMD18-T 1μL
DNA 2μL
SolutionI 5μL
ddH2O 2μL
The μ L of cumulative volume 10
16 DEG C are placed in after the completion of preparation carries out overnight coupled reaction.
3. the conversion of pMD18-T-rs867858 plasmids and PCR are identified
（1）The DH5 α competent cells for freezing are taken out from -80 DEG C of ultra low temperature freezer, being placed on ice chest makes it thaw；
（2）Take in the DH5 α competent cells of the 50 μ L of the μ L of connection product 10 additions that step 2 is obtained, gently shake up rearmounted ice bath 30 minutes；
（3）42 DEG C of water-bath heat shocks 90 seconds, put cooled on ice 2min immediately after heat shock；
（4）After adding the piping and druming of the LB fluid nutrient mediums without resistance of the 1ml of precooling to mix in 1.5ml EP pipes, 37 DEG C 120
Rev/min jog culture 90min；
（5）After the of short duration centrifugation of above-mentioned nutrient solution is sucked into 900 μ l, take remaining 100 μ l and coat the LB flat boards containing Amp antibiotic
On, face up placement 30min, after bacterium solution is cultured base absorption completely, is inverted 37 DEG C of insulating box overnight incubations of culture dish；
（6）From 1.5ml EP pipe of the picking monoclonal bacterium colony on flat board in 500 μ L Amp resistance LB fluid nutrient mediums, 37 DEG C
220rpm shaken cultivations 5-6 hours；
（7）Take 1 μ L carries out bacterium solution PCR identifications as template.The bacterium solution that the positive will be accredited as is added to the LB Liquid Cultures of 20ml
Expansion is carried out in base to shake；
（8）Above-mentioned dilution bacterium solution is expanded with primer GATA4-F and GATA4-R, PCR primer uses 2% agarose gel electrophoresis, leads to
Cross detection PCR primer identification positive transformant.
Primer sequence is that HRM analyzes the primer, and sequence is as follows：
Sense primer：GATA4-F 5'- TTGCATTGTGTTTCTAGCACCGAG-3'
Anti-sense primer：GATA4-R 5'- AGATGCCGTCATTCGGGCTG-3' .
System is as follows：
10×PCR buffer 2μL
dNTP（2.5μM） 2μL
Primers F（5μM） 1.5μL
Primer R（5μM） 1.5μL
The μ L of template 2
Taq enzyme（5U） 0.5μL
ddH2O 10.5μL
The μ L of cumulative volume 20.
Amplification program/reaction condition：94 DEG C of predegeneration 5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30sec, 35 are followed
Ring；72℃ 10min.
（9）The negative plasmid of restructuring and restructuring positive plasmid are extracted
The Plasmid Preparation kit produced using the Imtech of Beijing hundred extracts recombinant plasmid, concentration and purity is determined, while taking 10
μ l plasmid purifications are delivered to Shanghai bioengineering Co., Ltd and are sequenced, and determine that the gene order of Insert Fragment is consistent with aim sequence.
2nd, the acquisition of standard items and quantitative
（1）The μ l of bacillus coli DH 5 alpha 100 containing recombinant plasmid pMD18-T-rs867858 for freezing that step one is obtained are connect
Plant in the LB fluid nutrient mediums of 15ml ammonia benzyl resistances, 37 DEG C of 220rpm cultivate 14-16h；
（2）The Plasmid Preparation kit produced using the Tyke bio tech ltd of Beijing hundred extracts recombinant plasmid；
（3）Using the ultramicron ultraviolet-uisible spectrophotometer of the Tyke bio tech ltd of Beijing hundred（ND5000）To extracting
Plasmid determine concentration, according to A260/A280Judge the purity of plasmid.A260/A280=1.81。
The HRM-PCR of embodiment 2 detects the foundation of GATA4 rs867858 methods
First, the preparation of sample to be tested
30 peripheral blood genomic DNAs of sample are extracted, the template as the amplification of GATA4 gene PCRs.Specifically extraction step is：
（1）1ml whole bloods are taken, 3ml TE are added, 10min is stood after reverse mixing, 8000rpm is centrifuged 5 minutes, abandons supernatant；
（2）2-3 times is repeated the above steps to being precipitated as white；
（3）Add 900 μ l 10%SDS and 10 μ l 10mg/ml Proteinase Ks, 55 DEG C of water-bath 1h；
（4）Centrifuge tube is cooled to room temperature, isometric phenol/chloroform/isoamyl alcohol is added（25:24:1）Mix, 12000rpm from
Heart 10min；
（5）Isometric phenol/chloroform/isoamyl alcohol is added after careful absorption supernatant（25:24:1）Mix, 12000rpm centrifugations
10min；
（6）Supernatant is taken, adds the absolute ethyl alcohol of two volumes, mixing of turning upside down, 12000rpm centrifugation 10min to abandon supernatant；
（7）Plus 500 μ l 70% ethanol washing precipitation, abandon supernatant after of short duration centrifugation, uncap to dry to ethanol and volatilize completely；
（8）Plus 50 in μ l distilled waters or TE dissolving DNAs, -20 DEG C of preservations.
2nd, the design of specific primer and synthesis
The present invention is retrieved by GATA4rs867858 gene orders in Ensemble databases, is chosen suitable design and is drawn
The fragment sequence of thing is target, devises one group of HRM-PCR primer.
The extension increasing sequence that the present invention chooses is as follows：
The base being wherein underlined is gene mutation site.
The primer sequence is as follows：
Sense primer：GATA4-F 5'- TTGCATTGTGTTTCTAGCACCGAG-3'
Anti-sense primer：GATA4-R 5'- AGATGCCGTCATTCGGGCTG-3'
Amplified fragments size is：87bp.The nucleotides sequence of amplification is classified as：
3rd, HRM-PCR reaction systems and reaction condition
With DNA as template, with above-mentioned primer GATA4-F and GATA4-R as amplimer, entered using following systems and reaction condition
Performing PCR is expanded.
PCR reaction systems：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Wherein primer is biological using raw work using GATA4-F and GATA4-R, HRM-PCR（Shanghai）, Green-2-Go
QPCRMastermix kits.HRM analyzers are hundred source Gene A SA-9600 real-time fluorescence quantitative PCR instrument.
PCR amplification programs：
94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations；
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise is 0.06 DEG C/s.
4th, interpretation of result
High-resolution melting curve is drawn according to data are collected, according to the negative plasmid of restructuring, the melting curve of restructuring positive plasmid
Judge the genotype of sample to be tested GATA4 gene SNP sites rs867858：
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring positive plasmid is CC；
The genotype of the then GATA4 gene SNP sites rs867858 between the negative plasmid of restructuring and restructuring positive plasmid is AC.
5th, sensitivity experiment
Restructuring positive plasmid and the negative plasmid of restructuring are diluted to 50ng/ μ l, then the two mixing carries out gradient dilution, recombinates
Positive plasmid accounting is followed successively by 50%, 25%, 12.5%, 5%, 2% and 1%, is expanded according to above-mentioned HRM-PCR reaction systems and parameter
Increase, analysis mutation inspection range, i.e. sensitivity.
Reaction system is as follows：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
PCR amplification programs：
94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations；
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise is 0.06 DEG C/s.
As a result reference picture 1, experimental data shows, when the negative plasmid volume ratio of restructuring positive plasmid and restructuring is respectively 1:1、
1:3、1:7、1:19、1:When 49, positive plasmid can be detected, so the sensitivity of present invention HRM detection methods used is 2%.
The application detection method of the invention of embodiment 3 detects sample gene mutation
With detection kit and detection method in the step of embodiment 2, HRM analyses are carried out to 30 samples, with the positive matter of restructuring
The melting curve of grain and the negative plasmid of restructuring is compared, and the mutation type in sample is determined according to this.According to HRM analysis result pins
It is biological in raw work that 1 sample is selected every kind of genotype at random（Shanghai）Carry out Sanger sequence verifications.
Referring to table 1 and Fig. 2, GATA4 genes rs867858 is A to HRM analysis results in 30 samples of data display>C heterozygosis
Saltant type has 8, A>C homozygous mutants 5, remaining 17 is wild type.
Sanger sequencing results are referring to Fig. 3：Wherein a is the sequencing result of sample number 18, and b is the sequencing of sample number 25
As a result, c is the sequencing result of sample number 3；It is completely the same with the result that the inventive method is detected.
Analysis result of the application method of the present invention of table 1 to sample
Embodiment 4 is used to detect the kit of GATA4 gene SNP site rs867858 genotype
Kit for detecting GATA4 gene SNP site rs867858 genotype of the invention includes following components：
（1）GATA4 rs867858 standard items：The negative plasmid of restructuring and restructuring positive plasmid, prepare according to the method in embodiment 1；
（2）Primer：The primer sequence is：
Sense primer：GATA4-F 5'- TTGCATTGTGTTTCTAGCACCGAG-3'
Anti-sense primer：GATA4-R 5'- AGATGCCGTCATTCGGGCTG-3'
（3）The PCR amplifing reagents of the Green of Eva containing saturated fluorescence dyestuff
Method using kit detection GATA4 gene SNP site rs867858 genotype is same as Example 2.
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention,
Although being described in detail to the present invention with reference to the foregoing embodiments, for a person skilled in the art, it still may be used
Modified with to the technical scheme described in foregoing embodiments, or equivalent is carried out to which part technical characteristic.
All any modification, equivalent substitution and improvements within the spirit and principles in the present invention, made etc., should be included in of the invention
Within protection domain.
Sequence table
<110>Suzhou Bai Yuan gene technology Co., Ltd
<120>Kit for detecting GATA4 gene SNP site rs867858 genotype
<170> PatentIn version 3.5
<210> 1
<211> 400
<212> DNA
<213>Artificial sequence
<400> 1
tgcatctctc ctgtgagttg gagacttctt tcccaagatg tccttgtccc ctgcgttccc 60
cactgtggcc tagaccgtgg gttttgcatt gtgtttctag caccgaggat ctgagaacaa 120
gcggagggcc gggccctggg acccctgctc cagcccgaat gacggcatct gtttgccatg 180
tacctggatg cgacgggccc ctggggacag gcccttgccc catccatccg cttgaggcat 240
ggcaccgccc tgcatcccta ataccaaatc tgactccaaa attgtggggt gtgacataca 300
agtgactgaa cacttcctgg ggagctacag gggcacttaa cccaccacag cacagcctca 360
tcaaaatgca gctggcaact tctcccccag gtgccttccc 400
<210> 2
<211> 400
<212> DNA
<213>Artificial sequence
<400> 2
tgcatctctc ctgtgagttg gagacttctt tcccaagatg tccttgtccc ctgcgttccc 60
cactgtggcc tagaccgtgg gttttgcatt gtgtttctag caccgaggat ctgagaacca 120
gcggagggcc gggccctggg acccctgctc cagcccgaat gacggcatct gtttgccatg 180
tacctggatg cgacgggccc ctggggacag gcccttgccc catccatccg cttgaggcat 240
ggcaccgccc tgcatcccta ataccaaatc tgactccaaa attgtggggt gtgacataca 300
agtgactgaa cacttcctgg ggagctacag gggcacttaa cccaccacag cacagcctca 360
tcaaaatgca gctggcaact tctcccccag gtgccttccc 400
<210> 3
<211> 164
<212> DNA
<213>Artificial sequence
<400> 3
ccttgtcccc tgcgttcccc actgtggcct agaccgtggg ttttgcattg tgtttctagc 60
accgaggatc tgagaacaag cggagggccg ggccctggga cccctgctcc agcccgaatg 120
acggcatctg tttgccatgt acctggatgc gacgggcccc tggg 164
<210> 4
<211> 87
<212> DNA
<213>Artificial sequence
<400> 4
ttgcattgtg tttctagcac cgaggatctg agaacaagcg gagggccggg ccctgggacc 60
cctgctccag cccgaatgac ggcatct 87
Claims (9)
1. the kit of GATA4 gene SNP site rs867858 genotype is used for, it is characterised in that：The kit includes drawing
Thing pair and PCR detection reaction reagents；Wherein, the primer pair is（1）Or（2）In one kind：
（1）Sense primer：GATA4-F 5'- TTGCATTGTGTTTCTAGCACCGAG-3'
Anti-sense primer：GATA4-R 5'- AGATGCCGTCATTCGGGCTG-3'；
（2）With（1）In complementary series.
2. kit according to claim 1, it is characterised in that：The PCR detections reaction reagent includes containing EvaGreen
Green-2-Go qPCRMastermix.
3. kit according to claim 2, it is characterised in that：The reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
4. according to any described kits of claim 1-3, it is characterised in that：The kit also includes standard items, described
Standard items are the negative plasmid of restructuring and restructuring positive plasmid, and the nucleotides sequence of the restructuring feminine gender plasmid is classified as sequence table SEQ ID
No.1, the nucleotides sequence of the restructuring positive plasmid is classified as SEQ ID No.2 in sequence table.
5. a kind of method of detection GATA4 gene SNP site rs867858 genotype, it is characterised in that：Step is as follows：
（1）Build the negative plasmid of restructuring and restructuring positive plasmid：The nucleotides sequence of the negative plasmid of restructuring is classified as in sequence table
SEQ ID No.1, the nucleotide sequence of the restructuring positive plasmid is referring to SEQ ID No.2 in sequence table；
（2）Primer pair when PCR is expanded is built, the primer pair is the one kind in a or b：
A, sense primer：GATA4-F 5'- TTGCATTGTGTTTCTAGCACCGAG-3'
Anti-sense primer：GATA4-R 5'- AGATGCCGTCATTCGGGCTG-3'；
Complementary series in b and a；
（3）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested
DNA uses step（2）The primer, and enter performing PCR amplification and HRM analyses under identical conditions, collect data；
Preferably, the condition of the HRM analyses is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, raising speed in temperature
Rate is 0.06 DEG C/s；
（4）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent
Line judges the genotype of sample to be tested GATA4 gene SNP sites rs867858：
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring positive plasmid is CC；
The genotype of the then GATA4 gene SNP sites rs867858 between the negative plasmid of restructuring and restructuring positive plasmid is AC.
6. method according to claim 5, it is characterised in that：The reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
7. method according to claim 6, it is characterised in that：The reaction condition when PCR is expanded is：94 DEG C of predegenerations
3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations.
8. the application method of any described kits of claim 1-4, it is characterised in that：Step is as follows：
（1）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested
DNA uses same primers, and enters performing PCR amplification and HRM analyses under identical conditions, collects data；
The condition of HRM analysis is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, temperature rate-of-rise is 0.06
℃/s；
（2）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent
Line judges the genotype of sample to be tested GATA4 gene SNP sites rs867858：
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then GATA4 gene SNP sites rs867858 of being overlapped with the melting curve of restructuring positive plasmid is CC；
The genotype of the then GATA4 gene SNP sites rs867858 between the negative plasmid of restructuring and restructuring positive plasmid is AC.
9. any described kits of claim 1-4 are preparing the auxiliary diagnosis cardiopathic reagent of congenital atrial septal defect type
In application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611244552.2A CN106701945A (en) | 2016-12-29 | 2016-12-29 | Kit used for detecting genotype of GATA4 gene SNP site rs867858 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611244552.2A CN106701945A (en) | 2016-12-29 | 2016-12-29 | Kit used for detecting genotype of GATA4 gene SNP site rs867858 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106701945A true CN106701945A (en) | 2017-05-24 |
Family
ID=58903876
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611244552.2A Pending CN106701945A (en) | 2016-12-29 | 2016-12-29 | Kit used for detecting genotype of GATA4 gene SNP site rs867858 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701945A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108048557A (en) * | 2018-01-18 | 2018-05-18 | 昆山市第人民医院 | Congenital heart disease susceptible person's screening-gene marker and its application and kit |
| CN109182476A (en) * | 2018-09-10 | 2019-01-11 | 广州益养生物科技有限公司 | A kind of method of quick detection heredity skin sensitivity gene |
| CN109554457A (en) * | 2018-09-21 | 2019-04-02 | 广州益养生物科技有限公司 | A kind of method of quick detection heredity skin anti-acne gene |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010051464A1 (en) * | 2008-10-31 | 2010-05-06 | Washington University | Methods of determining copy number of a genetic locus |
| CN103667440A (en) * | 2013-09-05 | 2014-03-26 | 谢小冬 | Application of SNP loci of GATA4 genes |
| CN105441545A (en) * | 2015-12-17 | 2016-03-30 | 苏州百源基因技术有限公司 | Method for detecting FOXH1 gene SNP locus rs750472 genotype |
-
2016
- 2016-12-29 CN CN201611244552.2A patent/CN106701945A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010051464A1 (en) * | 2008-10-31 | 2010-05-06 | Washington University | Methods of determining copy number of a genetic locus |
| CN103667440A (en) * | 2013-09-05 | 2014-03-26 | 谢小冬 | Application of SNP loci of GATA4 genes |
| CN105441545A (en) * | 2015-12-17 | 2016-03-30 | 苏州百源基因技术有限公司 | Method for detecting FOXH1 gene SNP locus rs750472 genotype |
Non-Patent Citations (1)
| Title |
|---|
| 李静: "GATA4基因多态性与中国西北人群室间隔缺损的关联研究", 《硕士学位论文》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108048557A (en) * | 2018-01-18 | 2018-05-18 | 昆山市第人民医院 | Congenital heart disease susceptible person's screening-gene marker and its application and kit |
| CN108048557B (en) * | 2018-01-18 | 2021-09-03 | 昆山市第一人民医院 | Gene marker for screening congenital heart disease susceptible person and application and kit thereof |
| CN109182476A (en) * | 2018-09-10 | 2019-01-11 | 广州益养生物科技有限公司 | A kind of method of quick detection heredity skin sensitivity gene |
| CN109554457A (en) * | 2018-09-21 | 2019-04-02 | 广州益养生物科技有限公司 | A kind of method of quick detection heredity skin anti-acne gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107058594A (en) | A kind of method, primer and kit for detecting gout tumor susceptibility gene SNP genotype | |
| CN107058538B (en) | Primer composition, kit composed of primer composition and application of kit | |
| KR101598262B1 (en) | Identification of group of hypertension-susceptibility genes | |
| CN105441545A (en) | Method for detecting FOXH1 gene SNP locus rs750472 genotype | |
| CN106701945A (en) | Kit used for detecting genotype of GATA4 gene SNP site rs867858 | |
| CN106755439A (en) | Kit for detecting GATA4 gene SNP site rs904018 genotype | |
| CN109468330B (en) | Barley yellow mosaic disease resistance gene eIF4EHOR3298And identification method and application thereof | |
| CN111471787A (en) | PCR/L DR molecular marker and method for identifying rice high temperature resistant TT1 genotype | |
| CN111197103A (en) | Cotton leaf honey gland related molecular marker InDel-GaNEC1, primer pair and application thereof | |
| CN106701946A (en) | Kit for detecting genotype of gene JAG2 at SNP site rs2238286 | |
| CN106701947A (en) | Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893 | |
| CN114717352A (en) | Molecular marker of rice high temperature resistance regulation gene Hsp70 and application thereof | |
| CN111549137B (en) | Genetic molecular marker related to gastric cancer auxiliary diagnosis and application thereof | |
| CN109234435B (en) | Method for identifying wheat straw wall thickness and primer thereof | |
| CN106755440A (en) | Kit for detecting NOTCH3 gene SNP site rs12082 genotype | |
| CN109554462B (en) | PCR primer group, kit, amplification system and detection method of gene CYP11B1 exon | |
| CN107058509A (en) | Kit and its detection method for detecting SLC2A9 gene SNP site rs3775948 genotype | |
| CN116622888B (en) | KASP (KASP-related protein) mark related to soybean glutamic acid and application thereof | |
| CN108103166A (en) | A kind of method for detecting NLRP3 gene SNP site rs3806268 genotype | |
| CN112899364B (en) | Primer probe composition for detecting LMNA gene mutation and application thereof | |
| CN111733276B (en) | Salt-tolerant gene and application thereof | |
| CN116590458B (en) | KASP (KASP-related protein) mark related to glycine and application thereof | |
| CN113718054B (en) | Indel molecular marker of barley CBF4 gene and application thereof | |
| KR101080129B1 (en) | Specific primers for Chungpoong distinction in MLP genes of Panax ginseng C.A. Meyer, analysis kit using its primers, and Chunpoong distinciton method using them | |
| CN113444791B (en) | ARMS-PCR kit for assisting in screening familial papillary thyroid carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170524 |