CN106755439A - Kit for detecting GATA4 gene SNP site rs904018 genotype - Google Patents

Kit for detecting GATA4 gene SNP site rs904018 genotype Download PDF

Info

Publication number
CN106755439A
CN106755439A CN201611245582.5A CN201611245582A CN106755439A CN 106755439 A CN106755439 A CN 106755439A CN 201611245582 A CN201611245582 A CN 201611245582A CN 106755439 A CN106755439 A CN 106755439A
Authority
CN
China
Prior art keywords
restructuring
gata4
plasmid
genotype
snp site
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201611245582.5A
Other languages
Chinese (zh)
Inventor
谢小冬
车团结
王莉
尤崇革
李琳
李亚鹏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Baiyuan Gene Technology Co Ltd
Original Assignee
Suzhou Baiyuan Gene Technology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Baiyuan Gene Technology Co Ltd filed Critical Suzhou Baiyuan Gene Technology Co Ltd
Priority to CN201611245582.5A priority Critical patent/CN106755439A/en
Publication of CN106755439A publication Critical patent/CN106755439A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Abstract

The present invention is provided to detectGATA4The kit of gene SNP site rs904018 genotype, including primer pair and PCR detection reaction reagents；The primer pair is（1）Or（2）In one kind：（1）Sense primer：5'CACCGCCCTGCATCCCTAAT 3', anti-sense primer：5'‑ GGTGGGTTAAGTGCCCCTG‑3'；（2）With（1）In complementary series.Kit of the invention can be detected accuratelyGATA4The genotype of gene SNP site rs904018, sensitivity is high, and specificity is good, and detection is rapid；Using kit pair of the inventionGATA4The parting of gene SNP site rs904018 genotype is completely the same with sequencing result, can be used in the cardiopathic auxiliary judgment of ventricular septal defect type, and the research to follow-up congenital heart disease is significant.

Description

For detectingGATA4The kit of gene SNP site rs904018 genotype
Technical field
The present invention relates to be used to detectGATA4The kit of gene SNP site rs904018 genotype.
Background technology
GATA4Positioned at chromosome 8q23.1, cDNA total length 3414bp, including 6 extrons, encode by 442 amino acid The protein of composition, it is highly conserved in evolution.Transcriptional activation domain, middle two neighbouring zinc finger knots of the GATA4 by N-terminal The transcriptional activation domain of structure domain and C-terminal is constituted, and Zinc finger domain Cys-X2-Cys-X17-Cys-X2-Cys therein can be with target The DNA sequence element 5 ' of gene promoter area-(A/T) GATA (A/G) -3 ' is combined, so that the transcription for adjusting downstream target gene is lived Property.
GATA4 is as zinc finger protein activating transcription factorGATAOne of gene family, to the heart early stage heart development The formation of pipe and the differentiation of heart primordial cell, regulating and controlling effect is shifted.In autosomal dominant inheritance,GATA4Gene Mutation is relevant with most of atrial septal defects, and some patientss merge ventricular septal defect, pulmonary stenosis etc., and with serious Diastolic dysfunction and chamber backflow lesion, explanationGATA4Gene also has important regulation and control in human heart growth course Effect,GATA4Genetic heterozygosis mutation may cause haplotype not enough or dominant negative effect, trigger congenital heart disease.
High-resolution melting curve（high resolution melting, HRM）It is in the reaction of Conventional polymerase chain formula （PCR）During saturated fluorescence dye Tu such as Eva Green combined with DNA double chain, when making DNA double chain dissociate by heat temperature raising When, fluorescent dye is discharged from the local DNA molecular for unwinding, and double-strand can be made due to being mismatched between mutation, SNP site double-strand base DNA is untied first in this site, by the fluorescence intensity in real-time monitoring temperature-rise period, from fluorescence intensity and time axial curve Just can determine whether there is mutation or SNP.Different loci, heterozygote whether, G/C content, amplicon length etc. can all influence to melt The peak shape of curve, so HRM analyses can effectively distinguish different mutational sites, SNP site and possess the amplification of different G/C contents Fragment.
The content of the invention
The invention provides for detectingGATA4The kit of gene SNP site rs904018 genotype, testing result can ForGATA4The gene SNP rs904018 related cardiopathic auxiliary diagnosis of congenital atrial septal defect type.
First purpose of the invention is to provide for detectingGATA4The reagent of gene SNP site rs904018 genotype Box, the kit includes primer pair and PCR detection reaction reagents；Wherein, the primer pair is（1）Or（2）In one kind：
（1）Sense primer：GATA4-F 5'- CACCGCCCTGCATCCCTAAT-3'
Anti-sense primer：GATA4-R 5'- GGTGGGTTAAGTGCCCCTG-3'；
（2）With（1）In complementary series.
Also in protection scope of the present invention, the derived sequence is to 5 ' ends and/or 3 ' ends to the derived sequence of above-mentioned primer Direction extends consistent several bases or deletes the sequence that consistent several bases are obtained.
Preferably, the PCR detections reaction reagent includes the Green-2-Go containing EvaGreen qPCRMastermix。
Preferably, the reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Preferably, the kit also includes standard items, the standard items are the negative plasmid of restructuring and the positive matter of restructuring Grain, the nucleotides sequence of the negative plasmid of restructuring is classified as sequence table SEQ ID No.1, the nucleotides sequence of the restructuring positive plasmid It is classified as SEQ ID No.2 in sequence table.
Second object of the present invention is to provide a kind of detectionGATA4The method of gene SNP site rs904018 genotype, Step is as follows：
（1）Build the negative plasmid of restructuring and restructuring positive plasmid：The nucleotides sequence of the negative plasmid of restructuring is classified as in sequence table SEQ ID No.1, the nucleotide sequence of the restructuring positive plasmid is referring to SEQ ID No.2 in sequence table；
（2）Primer pair when PCR is expanded is built, the primer pair is the one kind in a or b：
A, sense primer：GATA4-F 5'- CACCGCCCTGCATCCCTAAT-3'
Anti-sense primer：GATA4-R 5'- GGTGGGTTAAGTGCCCCTG-3'；
Complementary series in b and a；
（3）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested DNA uses step（2）The primer, and enter performing PCR amplification and HRM analyses under identical conditions, collect data；
Preferably, the condition of the HRM analyses is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, raising speed in temperature Rate is 0.06 DEG C/s；
（4）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent Line judges sample to be testedGATA4The genotype of gene SNP site rs904018：
Melting curve with the negative plasmid of restructuring overlaps thenGATA4The genotype of gene SNP site rs904018 is TT；
Melting curve with restructuring positive plasmid overlaps thenGATA4The genotype of gene SNP site rs904018 is CC；
Between the negative plasmid of restructuring and restructuring positive plasmid thenGATA4The genotype of gene SNP site rs904018 is TC.
Preferably, the reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Preferably, the reaction condition when PCR is expanded is：94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C are moved back Fire/extend 20s；40 circulations.
Third object of the present invention is to provide the application method of mentioned reagent box, and step is as follows：
（1）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested DNA uses same primers, and enters performing PCR amplification and HRM analyses under identical conditions, collects data；
The condition of HRM analysis is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, temperature rate-of-rise is 0.06 ℃/s；
（2）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent Line judges sample to be testedGATA4The genotype of gene SNP site rs904018：
Melting curve with the negative plasmid of restructuring overlaps thenGATA4The genotype of gene SNP site rs904018 is TT；
Melting curve with restructuring positive plasmid overlaps thenGATA4The genotype of gene SNP site rs904018 is CC；
Between the negative plasmid of restructuring and restructuring positive plasmid thenGATA4The genotype of gene SNP site rs904018 is TC.
It is cardiopathic in preparation auxiliary diagnosis ventricular septal defect type that fourth object of the present invention is to provide mentioned reagent box Application in reagent.
Kit of the invention can be detected accuratelyGATA4The genotype of gene SNP site rs904018, sensitivity is high, Specificity is good, and detection is rapid；Using kit pair of the inventionGATA4The parting of gene SNP site rs904018 genotype with Sequencing result is completely the same, can be used in the cardiopathic auxiliary judgment of ventricular septal defect type, and follow-up congenital heart disease is ground Study carefully significant.
Brief description of the drawings
Accompanying drawing is used for providing a further understanding of the present invention, and constitutes a part for specification, with reality of the invention Applying example is used to explain the present invention together, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is HRM methods sensitivity experiment result of the invention.
Fig. 2 is sample HRM methods analysis result of the invention：Wherein a represents homozygous mutant sequence, and b represents wild Type sequence, c is heterozygous mutant sequence.
Fig. 3 is sampleGATA4 rs904018（c.*532T>C）The sequencing result in site；Wherein a represents homozygous mutation Type sequence, b represents heterozygous mutant sequence, and c is wild-type sequence.
Specific embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, unless otherwise specified, is conventional method.Test material used in following embodiments, unless otherwise specified, is city Sell.Primer used herein and sequent synthesis used and examining order are by raw work bioengineering（Shanghai）Limited company is complete Into.
Embodiment 1GATA4 The preparation of rs904018 standard items
Set up HRM analysis methods it may first have to the external standards needed for preparation method, standard items should comprising highly conserved and Specific sequence, it is ensured that the high specific of reaction.Present invention synthesis is includedGATA4 rs904018（c.*532T>C）Site Wild type and homozygous mutant DNA sequence dna, be cloned into pMD18-T carriers using gene recombination technology, construct The wild type and homozygous mutant recombinant plasmid of pMD18-T-rs904018, and corresponding PCR identifications and sequencing identification are carried out, most By quantitatively rear as the standard items for treating method for building up：Wild type recombinant plasmid is the negative plasmid of restructuring, homozygous mutant restructuring Plasmid is restructuring positive plasmid, is that the method for next step and assessment lay the foundation.
First, structure and the conversion of negative and positive plasmid pMD18-T-rs904018 are recombinated
1. synthesizeGATA4 rs904018（c.*532T>C）Wild type and homozygous mutant DNA sequence dna, the sequence of present invention synthesis 400bp, sequence is as follows：
（1）Wild-type sequence
TGCATCTCTCCTGTGAGTTGGAGACTTCTTTCCCAAGATGTCCTTGTCCCCTGCGTTCCCCACTGTGGCCTAG ACCGTGGGTTTTGCATTGTGTTTCTAGCACCGAGGATCTGAGAACAAGCGGAGGGCCGGGCCCTGGGACCCCTGCTC CAGCCCGAATGACGGCATCTGTTTGCCATGTACCTGGATGCGACGGGCCCCTGGGGACAGGCCCTTGCCCCATCCAT CCGCTTGAGGCATGGCACCGCCCTGCATCCCTAATACCAAATCTGACTCCAAAATTGTGGGGTGTGACATACAAGTG ACTGAACACTTCCTGGGGAGCTACAGGGGCACTTAACCCACCACAGCACAGCCTCATCAAAATGCAGCTGGCAACTT CTCCCCCAGGTGCCTTCCC
（2）Homozygous mutant sequence
TGCATCTCTCCTGTGAGTTGGAGACTTCTTTCCCAAGATGTCCTTGTCCCCTGCGTTCCCCACTGTGGCCTAG ACCGTGGGTTTTGCATTGTGTTTCTAGCACCGAGGATCTGAGAACCAGCGGAGGGCCGGGCCCTGGGACCCCTGCTC CAGCCCGAATGACGGCATCTGTTTGCCATGTACCTGGATGCGACGGGCCCCTGGGGACAGGCCCTTGCCCCATCCAT CCGCTTGAGGCATGGCACCGCCCTGCATCCCTAATACCAAATCTGACTCCAAAATTGTGGGGTGTGACACACAAGTG ACTGAACACTTCCTGGGGAGCTACAGGGGCACTTAACCCACCACAGCACAGCCTCATCAAAATGCAGCTGGCAACTT CTCCCCCAGGTGCCTTCCC
The base being wherein underlined is gene mutation site.
2. coupled reaction：The DNA fragmentation of above-mentioned synthesis is attached with pMD18-T, is carried out using following linked system Prepare：
pMD18-T 1μL
DNA 2μL
SolutionI 5μL
ddH2O 2μL
The μ L of cumulative volume 10
16 DEG C are placed in after the completion of preparation carries out overnight coupled reaction.
3. the conversion of pMD18-T-rs904018 plasmids and PCR are identified
（1）The DH5 α competent cells for freezing are taken out from -80 DEG C of ultra low temperature freezer, being placed on ice chest makes it thaw；
（2）Take in the DH5 α competent cells that the μ L of connection product 10 add 50 μ L, gently shake up rearmounted ice bath 30 minutes；
（3）42 DEG C of water-bath heat shocks 90 seconds, put cooled on ice 2min immediately after heat shock；
（4）After adding the piping and druming of the LB fluid nutrient mediums without resistance of the 1ml of precooling to mix in 1.5ml EP pipes, 37 DEG C 120 Rev/min jog culture 90min；
（5）The of short duration centrifugation of above-mentioned nutrient solution is sucked and take remaining 100 μ l after 900 μ l and coat the LB flat boards containing Amp antibiotic On, face up placement 30min, after bacterium solution is cultured base absorption completely, is inverted 37 DEG C of insulating box overnight incubations of culture dish；
（6）From 1.5ml EP pipe of the picking monoclonal bacterium colony on flat board in 500 μ L Amp resistance LB fluid nutrient mediums, 37 DEG C 220rpm shaken cultivations 5-6 hours；
（7）Take 1 μ L carries out bacterium solution PCR identifications as template.The bacterium solution that the positive will be accredited as is added to the LB Liquid Cultures of 20ml Expansion is carried out in base to shake；
（8）Above-mentioned dilution bacterium solution is expanded with primer GATA4-F and GATA4-R, PCR primer uses 2% agarose gel electrophoresis, leads to Cross detection PCR primer identification positive transformant.
Primer sequence is that HRM analyzes the primer, and sequence is as follows：
Sense primer：GATA4-F 5'- CACCGCCCTGCATCCCTAAT-3'
Anti-sense primer：GATA4-R 5'- GGTGGGTTAAGTGCCCCTG-3' .
System is as follows：
10×PCR buffer 2μL
dNTP（2.5μM） 2μL
Primers F（5μM） 1.5μL
Primer R（5μM） 1.5μL
The μ L of template 2
Taq enzyme（5U） 0.5μL
ddH2O 10.5μL
The μ L of cumulative volume 20.
Amplification program/reaction condition：94 DEG C of predegeneration 5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30sec, 35 are followed Ring；72℃ 10min.
Restructuring is negative and restructuring positive plasmid is extracted
The Plasmid Preparation kit produced using the Imtech of Beijing hundred extracts recombinant plasmid, concentration and purity is determined, while taking 10ul plasmid purifications are delivered to Shanghai bioengineering Co., Ltd and are sequenced, and determine the gene order and aim sequence of Insert Fragment Unanimously.
2nd, the acquisition of standard items and quantitative
（1）The μ l of bacillus coli DH 5 alpha 100 containing recombinant plasmid pMD18-T-rs904018 for freezing that step one is obtained are connect Plant in the LB fluid nutrient mediums of 15ml ammonia benzyl resistances, 37 DEG C of 220rpm cultivate 14-16h；
（2）The Plasmid Preparation kit produced using the Tyke bio tech ltd of Beijing hundred extracts recombinant plasmid；
（3）Using the ultramicron ultraviolet-uisible spectrophotometer of the Tyke bio tech ltd of Beijing hundred（ND5000）To extracting Plasmid determine concentration, according to A260/A280Judge the purity of plasmid.A260/A280=1.79。
The HRM-PCR of embodiment 2 is detectedGATA4 The foundation of rs904018 methods
First, the preparation of sample to be tested
30 peripheral blood genomic DNAs of sample are extracted, is used asGATA4The template of gene PCR amplification.Specifically extraction step is：
（1）1ml whole bloods are taken, 3ml TE are added, 10min is stood after reverse mixing, 8000rpm is centrifuged 5 minutes, abandons supernatant；
（2）2-3 times is repeated the above steps to being precipitated as white；
（3）Add 900 μ l 10%SDS and 10 μ l 10mg/ml Proteinase Ks, 55 DEG C of water-bath 1h；
（4）Centrifuge tube is cooled to room temperature, isometric phenol/chloroform/isoamyl alcohol is added（25:24:1）Mix, 12000rpm from Heart 10min；
（5）Isometric phenol/chloroform/isoamyl alcohol is added after careful absorption supernatant（25:24:1）Mix, 12000rpm centrifugations 10min；
（6）Supernatant is taken, adds the absolute ethyl alcohol of two volumes, mixing of turning upside down, 12000rpm centrifugation 10min to abandon supernatant；
（7）Plus 500 μ l 70% ethanol washing precipitation, abandon supernatant after of short duration centrifugation, uncap to dry to ethanol and volatilize completely；
（8）Plus 50 in μ l distilled waters or TE dissolving DNAs, -20 DEG C of preservations.
2nd, the design of specific primer and synthesis
The present invention is by ncbi databaseGATA4 Rs904018 gene orders are retrieved, and are chosen and are adapted to design primer Fragment sequence is target, devises one group of HRM-PCR primer.
The extension increasing sequence that the present invention chooses is as follows：
The base being wherein underlined is gene mutation site.
The primer sequence is as follows：
Sense primer：GATA4-F 5'- CACCGCCCTGCATCCCTAAT-3'
Anti-sense primer：GATA4-R 5'- GGTGGGTTAAGTGCCCCTG-3'
Amplified fragments size is：104bp.The nucleotides sequence of amplification is classified as：
3rd, HRM-PCR reaction systems and reaction condition
Respectively with sample to be tested DNA, the negative plasmid of restructuring and restructuring positive plasmid as template, with above-mentioned primer GATA4-F and GATA4-R is amplimer, and entering performing PCR using following systems and reaction condition expands.
PCR system：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Wherein primer is biological using raw work using GATA4-F and GATA4-R, HRM-PCR（Shanghai）, Green-2-Go QPCRMastermix kits.HRM analyzers are hundred source Gene A SA-9600 real-time fluorescence quantitative PCR instrument.
PCR amplification programs：
94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations；
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise is 0.06 DEG C/s.
4th, interpretation of result
High-resolution melting curve is drawn according to data are collected, according to the negative plasmid of restructuring, the melting curve of restructuring positive plasmid Judge sample to be testedGATA4The genotype of gene SNP site rs904018：
Melting curve with the negative plasmid of restructuring overlaps thenGATA4The genotype of gene SNP site rs904018 is TT；
Melting curve with restructuring positive plasmid overlaps thenGATA4The genotype of gene SNP site rs904018 is CC；
Between the negative plasmid of restructuring and restructuring positive plasmid thenGATA4The genotype of gene SNP site rs904018 is TC.
5th, sensitivity experiment
Restructuring positive plasmid and the negative plasmid of restructuring are diluted to 50ng/ μ l, then the two mixing carries out gradient dilution, recombinates Positive plasmid ratio is followed successively by 50%, 25%, 12.5%, 5%, 2% and 1%, is expanded according to above-mentioned HRM-PCR reaction systems and parameter Increase, analysis mutation inspection range, i.e. sensitivity.
Reaction system is as follows：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
PCR amplification programs：
94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations；
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise is 0.06 DEG C/s.
As a result reference picture 1, experimental data shows, when the negative plasmid volume ratio of restructuring positive plasmid and restructuring is respectively 1:1、 1:3、1:7、1:19、1:When 49, positive plasmid can be detected, so the sensitivity of present invention HRM detection methods used is 2%.
The application detection method of the invention of embodiment 3 detects sample gene mutation
With detection kit and detection method in the step of embodiment 2, HRM analyses are carried out to 30 samples, with the positive matter of restructuring The melting curve of grain and the negative plasmid of restructuring is compared, and the mutation type in sample is determined according to this.HRM analyses are carried out after terminating Agarose gel electrophoresis is detected, and selects 1 sample in raw work biology for every kind of genotype is random according to HRM analysis results （Shanghai）Carry out Sanger sequence verifications.
HRM analysis results referring to table 1 and Fig. 2, in 30 samples of data displayGATA4Gene rs904018 is T>C heterozygosis Saltant type has 6, T>C homozygous mutants 5, remaining 19 is wild type.
Sanger sequencing results are referring to Fig. 3：Wherein a is the sequencing result of sample number 1, and b is the sequencing knot of sample number 9 Really, c is the sequencing result of sample number 22；It is completely the same with the result that the inventive method is detected.
Analysis result of the application method of the present invention of table 1 to sample
Embodiment 4 is used to detectGATA4The kit of gene SNP site rs904018 genotype
It is of the invention for detectingGATA4The kit of gene SNP site rs904018 genotype includes following components：
（1）GATA4Rs904018 standard items：The negative plasmid of restructuring and restructuring positive plasmid, according to the method system in embodiment 1 It is standby；
（2）Primer：The primer sequence is：
Sense primer：GATA4-F 5'- CACCGCCCTGCATCCCTAAT-3'
Anti-sense primer：GATA4-R 5'- GGTGGGTTAAGTGCCCCTG-3'；
（3）PCR reagent containing Eva Green.
Detected using the kitGATA4The method of gene SNP site rs904018 genotype is same as Example 2.
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention, Although being described in detail to the present invention with reference to the foregoing embodiments, for a person skilled in the art, it still may be used Modified with to the technical scheme described in foregoing embodiments, or equivalent is carried out to which part technical characteristic. All any modification, equivalent substitution and improvements within the spirit and principles in the present invention, made etc., should be included in of the invention Within protection domain.
Sequence table
<110>Suzhou Bai Yuan gene technology Co., Ltd
<120>Kit for detecting GATA4 gene SNP site rs904018 genotype
<170> PatentIn version 3.5
<210> 1
<211> 400
<212> DNA
<213>Artificial sequence
<400> 1
tgcatctctc ctgtgagttg gagacttctt tcccaagatg tccttgtccc ctgcgttccc 60
cactgtggcc tagaccgtgg gttttgcatt gtgtttctag caccgaggat ctgagaacaa 120
gcggagggcc gggccctggg acccctgctc cagcccgaat gacggcatct gtttgccatg 180
tacctggatg cgacgggccc ctggggacag gcccttgccc catccatccg cttgaggcat 240
ggcaccgccc tgcatcccta ataccaaatc tgactccaaa attgtggggt gtgacataca 300
agtgactgaa cacttcctgg ggagctacag gggcacttaa cccaccacag cacagcctca 360
tcaaaatgca gctggcaact tctcccccag gtgccttccc 400
<210> 2
<211> 400
<212> DNA
<213>Artificial sequence
<400> 2
tgcatctctc ctgtgagttg gagacttctt tcccaagatg tccttgtccc ctgcgttccc 60
cactgtggcc tagaccgtgg gttttgcatt gtgtttctag caccgaggat ctgagaacca 120
gcggagggcc gggccctggg acccctgctc cagcccgaat gacggcatct gtttgccatg 180
tacctggatg cgacgggccc ctggggacag gcccttgccc catccatccg cttgaggcat 240
ggcaccgccc tgcatcccta ataccaaatc tgactccaaa attgtggggt gtgacacaca 300
agtgactgaa cacttcctgg ggagctacag gggcacttaa cccaccacag cacagcctca 360
tcaaaatgca gctggcaact tctcccccag gtgccttccc 400
<210> 3
<211> 137
<212> DNA
<213>Artificial sequence
<400> 3
tgaggcatgg caccgccctg catccctaat accaaatctg actccaaaat tgtggggtgt 60
gacatacaag tgactgaaca cttcctgggg agctacaggg gcacttaacc caccacagca 120
cagcctcatc aaaatgc 137
<210> 4
<211> 104
<212> DNA
<213>Artificial sequence
<400> 4
caccgccctg catccctaat accaaatctg actccaaaat tgtggggtgt gacatacaag 60
tgactgaaca cttcctgggg agctacaggg gcacttaacc cacc 104

Claims (9)

1. it is used to detectGATA4The kit of gene SNP site rs904018 genotype, it is characterised in that：The kit bag Include primer pair and PCR detection reaction reagents；Wherein, the primer pair is（1）Or（2）In one kind：
（1）Sense primer：GATA4-F 5'- CACCGCCCTGCATCCCTAAT-3'
Anti-sense primer：GATA4-R 5'- GGTGGGTTAAGTGCCCCTG-3'；
（2）With（1）In complementary series.
2. kit according to claim 1, it is characterised in that：The PCR detections reaction reagent includes containing EvaGreen Green-2-Go qPCRMastermix.
3. kit according to claim 2, it is characterised in that：The reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
4. according to any described kits of claim 1-3, it is characterised in that：The kit also includes standard items, described Standard items are the negative plasmid of restructuring and restructuring positive plasmid, and the nucleotides sequence of the restructuring feminine gender plasmid is classified as sequence table SEQ ID No.1, the nucleotides sequence of the restructuring positive plasmid is classified as SEQ ID No.2 in sequence table.
5. a kind of detectionGATA4The method of gene SNP site rs904018 genotype, it is characterised in that：Step is as follows：
（1）Build the negative plasmid of restructuring and restructuring positive plasmid：The nucleotides sequence of the negative plasmid of restructuring is classified as in sequence table SEQ ID No.1, the nucleotide sequence of the restructuring positive plasmid is referring to SEQ ID No.2 in sequence table；
（2）Primer pair when PCR is expanded is built, the primer pair is the one kind in a or b：
A, sense primer：GATA4-F 5'- CACCGCCCTGCATCCCTAAT-3'
Anti-sense primer：GATA4-R 5'- GGTGGGTTAAGTGCCCCTG-3'；
Complementary series in b and a；
（3）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested DNA uses step（2）The primer, and enter performing PCR amplification and HRM analyses under identical conditions, collect data；
Preferably, the condition of the HRM analyses is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, raising speed in temperature Rate is 0.06 DEG C/s；
（4）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent Line judges sample to be testedGATA4The genotype of gene SNP site rs904018：
Melting curve with the negative plasmid of restructuring overlaps thenGATA4The genotype of gene SNP site rs904018 is TT；
Melting curve with restructuring positive plasmid overlaps thenGATA4The genotype of gene SNP site rs904018 is CC；
Between the negative plasmid of restructuring and restructuring positive plasmid thenGATA4The genotype of gene SNP site rs904018 is TC.
6. method according to claim 5, it is characterised in that：The reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
7. method according to claim 6, it is characterised in that：The reaction condition when PCR is expanded is：94 DEG C of predegenerations 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations.
8. the application method of any described kits of claim 1-4, it is characterised in that：Step is as follows：
（1）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested DNA uses same primers, and enters performing PCR amplification and HRM analyses under identical conditions, collects data；
The condition of HRM analysis is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, temperature rate-of-rise is 0.06 ℃/s；
（2）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent Line judges sample to be testedGATA4The genotype of gene SNP site rs904018：
Melting curve with the negative plasmid of restructuring overlaps thenGATA4The genotype of gene SNP site rs904018 is TT；
Melting curve with restructuring positive plasmid overlaps thenGATA4The genotype of gene SNP site rs904018 is CC；
Between the negative plasmid of restructuring and restructuring positive plasmid thenGATA4The genotype of gene SNP site rs904018 is TC.
9. any described kits of claim 1-4 in the auxiliary diagnosis cardiopathic reagent of ventricular septal defect type is prepared should With.
CN201611245582.5A 2016-12-29 2016-12-29 Kit for detecting GATA4 gene SNP site rs904018 genotype Pending CN106755439A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201611245582.5A CN106755439A (en) 2016-12-29 2016-12-29 Kit for detecting GATA4 gene SNP site rs904018 genotype

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201611245582.5A CN106755439A (en) 2016-12-29 2016-12-29 Kit for detecting GATA4 gene SNP site rs904018 genotype

Publications (1)

Publication Number Publication Date
CN106755439A true CN106755439A (en) 2017-05-31

Family

ID=58929067

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201611245582.5A Pending CN106755439A (en) 2016-12-29 2016-12-29 Kit for detecting GATA4 gene SNP site rs904018 genotype

Country Status (1)

Country Link
CN (1) CN106755439A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108048557A (en) * 2018-01-18 2018-05-18 昆山市第人民医院 Congenital heart disease susceptible person's screening-gene marker and its application and kit
CN108300722A (en) * 2018-02-11 2018-07-20 南京市妇幼保健院 Gene panel for detecting congenital heart disease and application

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110244449A1 (en) * 2008-10-31 2011-10-06 Raphael Kopan Methods of determining copy number of a genetic locus
CN103374628A (en) * 2012-04-27 2013-10-30 中国科学院上海生命科学研究院 Congenital heart defect (CHD)-related gene family with sequence similarity 71, member A (FAM71A) and application thereof
CN103667440A (en) * 2013-09-05 2014-03-26 谢小冬 Application of SNP loci of GATA4 genes
CN105441545A (en) * 2015-12-17 2016-03-30 苏州百源基因技术有限公司 Method for detecting FOXH1 gene SNP locus rs750472 genotype

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110244449A1 (en) * 2008-10-31 2011-10-06 Raphael Kopan Methods of determining copy number of a genetic locus
CN103374628A (en) * 2012-04-27 2013-10-30 中国科学院上海生命科学研究院 Congenital heart defect (CHD)-related gene family with sequence similarity 71, member A (FAM71A) and application thereof
CN103667440A (en) * 2013-09-05 2014-03-26 谢小冬 Application of SNP loci of GATA4 genes
CN105441545A (en) * 2015-12-17 2016-03-30 苏州百源基因技术有限公司 Method for detecting FOXH1 gene SNP locus rs750472 genotype

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
SAIDULU MATTAPALLY ET AL.: ""c.620C>T mutation in GATA4 is associated with congenital heart disease in South India"", 《BMC MEDICAL GENETICS》 *
STELLA MARIE REAMON-BUETTNER ET AL.: ""Mutations in the 3’-untranslated region of GATA4 as molecular hotspots for congenital heart disease (CHD)"", 《BMC MEDICAL GENETICS》 *
李静: ""GATA4基因多态性与中国西北人群室间隔缺损的关联研究"", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108048557A (en) * 2018-01-18 2018-05-18 昆山市第人民医院 Congenital heart disease susceptible person's screening-gene marker and its application and kit
CN108048557B (en) * 2018-01-18 2021-09-03 昆山市第一人民医院 Gene marker for screening congenital heart disease susceptible person and application and kit thereof
CN108300722A (en) * 2018-02-11 2018-07-20 南京市妇幼保健院 Gene panel for detecting congenital heart disease and application

Similar Documents

Publication Publication Date Title
CN107058594A (en) A kind of method, primer and kit for detecting gout tumor susceptibility gene SNP genotype
KR101598262B1 (en) Identification of group of hypertension-susceptibility genes
CN106701945A (en) Kit used for detecting genotype of GATA4 gene SNP site rs867858
CN106755439A (en) Kit for detecting GATA4 gene SNP site rs904018 genotype
CN108588235B (en) Genetic marker related to velvet production and velvet layer height of meridian-ridge black goats and application of genetic marker
CN114381463A (en) Application of BraA08g039212E gene from European turnip ECD04 in improvement of plasmodiophora tumefaciens resistance
CN112322768A (en) Method for diagnosing hippophae rhamnoides branch wilt and rapidly detecting RPA (resilient root antigen) of pathogenic bacteria
CN109468330B (en) Barley yellow mosaic disease resistance gene eIF4EHOR3298And identification method and application thereof
CN106701946A (en) Kit for detecting genotype of gene JAG2 at SNP site rs2238286
CN101245393B (en) Method and reagent kit for forecasting outbreak age of carcinoma of colon
CN106701947A (en) Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893
KR101566472B1 (en) Method for identifying of Mulberry tree
CN114717352A (en) Molecular marker of rice high temperature resistance regulation gene Hsp70 and application thereof
CN101974618A (en) Transformant specific polymerase chain reaction (PCR) detection method for transgenic rice strain T1c-19 with cry1C gene
CN106755440A (en) Kit for detecting NOTCH3 gene SNP site rs12082 genotype
CN111996274B (en) Large-scale quantitative detection method for plant pathogenic fungi by high-throughput sequencing
CN111549137B (en) Genetic molecular marker related to gastric cancer auxiliary diagnosis and application thereof
CN109234435B (en) Method for identifying wheat straw wall thickness and primer thereof
CN107058509A (en) Kit and its detection method for detecting SLC2A9 gene SNP site rs3775948 genotype
CN108103166A (en) A kind of method for detecting NLRP3 gene SNP site rs3806268 genotype
CN113718054B (en) Indel molecular marker of barley CBF4 gene and application thereof
CN108707674A (en) The method that brown paddy plant hopper group confrontation worm rice varieties IR36 causes evil power level is predicted by single nucleotide polymorphism
CN112899364B (en) Primer probe composition for detecting LMNA gene mutation and application thereof
CN111733276B (en) Salt-tolerant gene and application thereof
CN116622888B (en) KASP (KASP-related protein) mark related to soybean glutamic acid and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20170531

RJ01 Rejection of invention patent application after publication