CN106701946A - Kit for detecting genotype of gene JAG2 at SNP site rs2238286 - Google Patents
Kit for detecting genotype of gene JAG2 at SNP site rs2238286 Download PDFInfo
- Publication number
- CN106701946A CN106701946A CN201611244592.7A CN201611244592A CN106701946A CN 106701946 A CN106701946 A CN 106701946A CN 201611244592 A CN201611244592 A CN 201611244592A CN 106701946 A CN106701946 A CN 106701946A
- Authority
- CN
- China
- Prior art keywords
- restructuring
- jag2
- plasmid
- genotype
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a kit for detecting the genotype of a gene JAG2 at an SNP site rs2238286. The kit comprises a primer pair and a PCR detection reaction reagent, wherein the primer pair is one of (1) and (2): (1) an upstream primer: JAG2-F 5'-AGGAGCTAGGGGGAGAGAAGAC-3' and a downstream primer: JAG2-R 5'-AGGGGTCACCTTGGTGGTTA-3'; (2) complementary sequences for the sequences in (1). The kit disclosed by the invention can accurately detect the genotype of the gene JAG2 at the SNP site rs2238286, and is high in sensitivity, high in specificity and quick in detection. By the application of the kit, the parting result and the sequencing result of the genotype of the gene JAG2 at the SNP site rs2238286 are completely consistent, so that the kit can be used for analysis of liability of the non-syndromic cleft lip with cleft palate.
Description
Technical field
Kit the present invention relates to be used to detect JAG2 gene mutations, and in particular to for detecting JAG2 gene SNPs position
The method of point rs2238286 genotype.
Background technology
JAG2 genes are one of parts of NOTCH signal paths, its Main Function be take part in secondary palate formation and
Growth course, it is considered to be one of candidate gene of harelip.JAG2 genes rs2238286（n.66+11354A>G）Site position
Near 5 ' ends of the gene, site AG, GG genotypic expression goes out under study for action has conspicuousness with non-syndromic cleft lip with cleft palate
Correlation.
Used as common inborn defect and Craniofacial growth defect, harelip is a kind of complicated different substantiality disease, in the world
It is classified as syndromic（Syndromic cleft lip or palate, SCLP）And non-syndromic cleft lip with cleft palate（non-
Syndromic cleft lip or palate, NSCLP）.The incidence of global harelip is 3-22/10000, and China
Incidence is about 1.82/1000.The pathogenic factor of NSCLP has a lot, and the influence of wherein h and E occupies Main Function.
Research finds that many signal paths take part in the development of lip palate, and coloured differently body is interval to have one to be set in harelip morbidity
With.The NSCLP area of liability being currently known has Iq32,2p, 2q, 3q27-28,4q, 6p23-p25,8q24,9q21,12p11,
14q21-24,16q24 and 19q13, possible tumor susceptibility gene have IRF6, SATB2, TP63, FQXE1, PVRL1, MSX1,
GABRB3, CRISPLD2, MAFB and ABCA4 etc..
High-resolution melting curve（High resolution melting, HRM) analysis principle be in typical polymerization
PCR（PCR）During saturated fluorescence dye Tu combined with double-stranded DNA, when making DNA double chain dissociate by heat temperature raising,
Fluorescent dye discharges from the local DNA molecular for unwinding, and due to being mismatched between mutation, SNP site double-strand base double-stranded DNA can be made to exist
This site is untied first, by the fluorescence intensity in real-time monitoring temperature-rise period, just can be sentenced from fluorescence intensity with time axial curve
It is disconnected with the presence or absence of mutation or SNP, and different loci, heterozygote whether, G/C content, amplicon length etc. can all influence melting curve
Peak shape.So, HRM analyses can effectively distinguish different mutational sites, SNP site and possess the amplified fragments of different G/C contents.
The content of the invention
The invention provides the kit for detecting JAG2 gene mutations, specifically provide for detecting JAG2 genes
The kit of SNP site rs2238286 genotype, the kit can be used for the assistant analysis of non-comprehensive harelip liability.
First purpose of the invention is to provide the reagent for detecting JAG2 gene SNP site rs2238286 genotype
Box, the kit includes primer pair and PCR detection reaction reagents；Wherein, the primer pair is（1）Or（2）In one kind：
（1）Sense primer：JAG2-F 5'- AGGAGCTAGGGGGAGAGAAGAC-3'
Anti-sense primer：JAG2-R 5'- AGGGGTCACCTTGGTGGTTA-3'；
（2）With（1）In complementary series.
Preferably, the PCR detections reaction reagent includes the Green-2-Go qPCRMastermix containing EvaGreen.
Preferably, the reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Used as further preferred, the kit also includes standard items, and the standard items are the negative plasmid of restructuring and restructuring
Positive plasmid, the nucleotides sequence of the restructuring feminine gender plasmid is classified as sequence table SEQ ID No.1, the core of the restructuring positive plasmid
Nucleotide sequence is SEQ ID No.2 in sequence table.
Second object of the present invention is to provide a kind of method of detection JAG2 gene SNP site rs2238286 genotype,
Step is as follows：
（1）Build the negative plasmid of restructuring and restructuring positive plasmid：The nucleotides sequence of the negative plasmid of restructuring is classified as in sequence table
SEQ ID No.1, the nucleotide sequence of the restructuring positive plasmid is referring to SEQ ID No.2 in sequence table；
（2）Primer pair when PCR is expanded is built, the primer pair is the one kind in a or b：
A, sense primer：JAG2-F 5'- AGGAGCTAGGGGGAGAGAAGAC-3'
Anti-sense primer：JAG2-R 5'- AGGGGTCACCTTGGTGGTTA-3'；
Complementary series in b and a；
（3）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested
DNA uses step（2）The primer, and enter performing PCR amplification and HRM analyses under identical conditions, collect data；
Preferably, the condition of the HRM analyses is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, raising speed in temperature
Rate is 0.06 DEG C/s；
（4）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent
Line judges the genotype of sample to be tested JAG2 gene SNP sites rs2238286：
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring positive plasmid is GG；
The genotype of the then JAG2 gene SNP sites rs2238286 between the negative plasmid of restructuring and restructuring positive plasmid is AG.
Preferably, the reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Preferably, the reaction condition when PCR is expanded is：94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C are moved back
Fire/extend 20s；40 circulations.
Third object of the present invention is to provide the application method of mentioned reagent box, and step is as follows：
（1）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested
DNA uses same primers, and enters performing PCR amplification and HRM analyses under identical conditions, collects data；
The condition of HRM analysis is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, temperature rate-of-rise is 0.06
℃/s；
（2）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent
Line judges the genotype of sample to be tested JAG2 gene SNP sites rs2238286：
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring positive plasmid is GG；
The genotype of the then JAG2 gene SNP sites rs2238286 between the negative plasmid of restructuring and restructuring positive plasmid is AG.
Fourth object of the present invention is to provide mentioned reagent box and is preparing the reagent of auxiliary diagnosis non-syndrome harelip
Middle application.
Kit of the invention can accurately detect the genotype of JAG2 gene SNP sites rs2238286, and sensitivity is high,
Specificity is good, and detection is rapid；The parting to JAG2 gene SNP site rs2238286 genotype and survey using the method for the present invention
Sequence result is completely the same, can be used in the liability analysis of non-syndrome harelip.
Brief description of the drawings
Accompanying drawing is used for providing a further understanding of the present invention, and constitutes a part for specification, with reality of the invention
Applying example is used to explain the present invention together, is not construed as limiting the invention.In the accompanying drawings：
Fig. 1 is HRM methods sensitivity experiment result of the invention；
Fig. 2 is sample HRM methods analysis result of the invention；
Fig. 3 is the JAG2 rs2238286 of sample（n.66+11354A>G）The sequencing result in site；Wherein a represents wild type sequence
Row, b represents homozygous mutant sequence, and c is heterozygous mutant sequence.
Specific embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method, unless otherwise specified, is conventional method.Test material used in following embodiments, unless otherwise specified, is city
Sell.Primer used herein and sequent synthesis used and examining order are by raw work bioengineering（Shanghai）Limited company is complete
Into.
The preparation of the JAG2 rs2238286 standard items of embodiment 1
Set up HRM analysis methods it may first have to the external standards needed for preparation method, standard items should comprising highly conserved and
Specific sequence, it is ensured that the high specific of reaction.Present invention synthesis includes JAG2 rs2238286（n.66+11354A>G）
The wild type and homozygous mutant DNA sequence dna in site, are cloned into pMD18-T carriers using gene recombination technology, are built
Go out the wild type and homozygous mutant of recombinant plasmid pMD18-T-rs2238286, and carry out corresponding PCR identifications and sequencing mirror
Fixed, most afterwards after quantitative as the standard items for treating method for building up, wild type recombinant plasmid is the negative plasmid of restructuring, homozygous mutant
Recombinant plasmid is restructuring positive plasmid, is that the method for next step and assessment lay the foundation.
First, structure and the conversion of the negative plasmid of pMD18-T-rs2238286 restructuring and restructuring positive plasmid
1. JAG2 rs2238286 are synthesized（n.66+11354A>G）Wild type and homozygous mutant DNA sequence dna, present invention synthesis
Sequence 250bp long, sequence is as follows：
（1）Wild-type sequence
ACCCAGCTCCGGGCACAGGGCAAATTTGCGAGAGGAGCTAGGGGGAGAGAAGACAGCTCAGTTATCATGGGGA
TGGGTTGAGGACCCCTCTGGACCATATGGGGATCTTTAACCACCAAGGTGACCCCTAGCTCTGGAAAGGACCGTGCT
CACTGGAGGAGAGGAAGGTGCCATTGGTTTTGACCCTGTGGAGGAGCTGCGAGGTCACCCAGGGAGAGGGCAAGGAG
GTGACCGCAGAGGATGGGGTGTG
（2）Homozygous mutant sequence
ACCCAGCTCCGGGCACAGGGCAAATTTGCGAGAGGAGCTAGGGGGAGAGAAGACAGCTCAGTTATCATGGGGA
TGGGTTGAGGACCCCTCTGGACCATGTGGGGATCTTTAACCACCAAGGTGACCCCTAGCTCTGGAAAGGACCGTGCT
CACTGGAGGAGAGGAAGGTGCCATTGGTTTTGACCCTGTGGAGGAGCTGCGAGGTCACCCAGGGAGAGGGCAAGGAG
GTGACCGCAGAGGATGGGGTGTG
The base being wherein underlined is gene mutation site.
2. coupled reaction：The DNA fragmentation of above-mentioned synthesis is attached with pMD18-T, is prepared using following linked system：
pMD18-T 1μL
DNA 2μL
SolutionI 5μL
ddH2O 2μL
The μ L of cumulative volume 10.
16 DEG C are placed in after the completion of preparation carries out overnight coupled reaction.
3. the conversion of pMD18-T-rs2238286 plasmids and PCR are identified
（1）The DH5 α competent cells for freezing are taken out from -80 DEG C of ultra low temperature freezer, being placed on ice chest makes it thaw；
（2）Take in the DH5 α competent cells of the 50 μ L of the μ L of connection product 10 additions that step 2 is obtained, gently shake up rearmounted ice bath 30 minutes；
（3）42 DEG C of water-bath heat shocks 90 seconds, put cooled on ice 2min immediately after heat shock；
（4）After adding the piping and druming of the LB fluid nutrient mediums without resistance of the 1ml of precooling to mix in 1.5ml EP pipes, 37 DEG C 120
Rev/min jog culture 90min；
（5）The of short duration centrifugation of above-mentioned nutrient solution is sucked and take remaining 100 μ l after 900 μ l and coat the LB flat boards containing Amp antibiotic
On, face up placement 30min, after bacterium solution is cultured base absorption completely, is inverted 37 DEG C of insulating box overnight incubations of culture dish；
（6）From 1.5ml EP pipe of the picking monoclonal bacterium colony on flat board in 500 μ L Amp resistance LB fluid nutrient mediums, 37 DEG C
220rpm shaken cultivations 5-6 hours；
（7）Take 1 μ L carries out bacterium solution PCR identifications as template.The bacterium solution that the positive will be accredited as is added to the LB Liquid Cultures of 20ml
Expansion is carried out in base to shake；
（8）Above-mentioned dilution bacterium solution is expanded with primer JAG2-F and JAG2-R, PCR primer uses 2% agarose gel electrophoresis, passes through
Detection PCR primer identification positive transformant.
Primer sequence is that HRM analyzes the primer, and sequence is as follows：
Sense primer：JAG2-F 5'- AGGAGCTAGGGGGAGAGAAGAC-3'
Anti-sense primer：JAG2-R 5'- AGGGGTCACCTTGGTGGTTA-3'
System is as follows：
10×PCR buffer 2μL
dNTP（2.5μM） 2μL
Primers F（5μM） 1.5μL
Primer R（5μM） 1.5μL
The μ L of template 2
Taq enzyme（5U） 0.5μL
ddH2O 10.5μL
The μ L of cumulative volume 20.
Amplification program/reaction condition：94 DEG C of predegeneration 5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30sec, 35 are followed
Ring；72℃ 10min.
Extract the Plasmid Preparation kit of the negative plasmid of restructuring and restructuring positive plasmid using the production of the Imtech of Beijing hundred
Recombinant plasmid is extracted, concentration and purity is determined, entered while drawing a part of plasmid purification and delivering to Shanghai bioengineering Co., Ltd
Row sequencing, determines that the gene order of Insert Fragment is consistent with aim sequence.
2nd, the acquisition of standard items and quantitative
（1）The μ l of escherichia coli DH5a 100 containing recombinant plasmid pMD18-T-rs2238286 for freezing that step one is obtained
It is inoculated in the LB fluid nutrient mediums of 15ml ammonia benzyl resistances, 37 DEG C of 220rpm cultivate 14-16h；
（2）The Plasmid Preparation kit produced using the Tyke bio tech ltd of Beijing hundred extracts recombinant plasmid；
（3）Using the ultramicron ultraviolet-uisible spectrophotometer of the Tyke bio tech ltd of Beijing hundred（ND5000）To extracting
Plasmid determine concentration, according to A260/A280Judge the purity of plasmid.A260/A280=1.78。
The HRM-PCR of embodiment 2 detects the foundation of JAG2 rs2238286 methods
First, the preparation of sample to be tested DNA
30 peripheral blood genomic DNAs of sample are extracted, the template as the amplification of JAG2 gene PCRs.Specific extracting method is as follows：
（1）1ml whole bloods are taken, 3ml TE are added, 10min is stood after reverse mixing, 8000rpm is centrifuged 5 minutes, abandons supernatant；
（2）2-3 times is repeated the above steps to being precipitated as white；
（3）Add 900 μ l 10%SDS and 10 μ l 10mg/ml Proteinase Ks, 55 DEG C of water-bath 1h；
（4）Centrifuge tube is cooled to room temperature, isometric phenol/chloroform/isoamyl alcohol is added（25:24:1）Mix, 12000rpm from
Heart 10min；
（5）Isometric phenol/chloroform/isoamyl alcohol is added after careful absorption supernatant（25:24:1）Mix, 12000rpm centrifugations
10min；
（6）Supernatant is taken, adds the absolute ethyl alcohol of two volumes, mixing of turning upside down, 12000rpm centrifugation 10min to abandon supernatant；
（7）Plus 500 μ l 70% ethanol washing precipitation, abandon supernatant after of short duration centrifugation, uncap to dry to ethanol and volatilize completely；
（8）Plus 50 in μ l distilled waters or TE dissolving DNAs, -20 DEG C of preservations.
2nd, the design of specific primer and synthesis
The present invention is retrieved by JAG2rs2238286 gene orders in ncbi database, is chosen and is adapted to design primer
Fragment sequence is target, devises one group of HRM-PCR primer.
The extension increasing sequence that the present invention chooses is as follows：
The base being wherein underlined is gene mutation site.
The primer sequence of design is as follows：
Sense primer：JAG2-F 5'- AGGAGCTAGGGGGAGAGAAGAC-3'
Anti-sense primer：JAG2-R 5'- AGGGGTCACCTTGGTGGTTA-3'
Amplified fragments size is：97bp.The nucleotides sequence of amplification is classified as：
3rd, HRM-PCR reaction systems and reaction condition
Respectively with sample to be tested DNA, the negative plasmid of restructuring and restructuring positive plasmid as template, with above-mentioned primer JAG2-F and
JAG2-R is amplimer, enters performing PCR amplification using following systems and reaction condition and HRM is analyzed.
PCR system：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
Wherein primer is biological using raw work using JAG2-F and JAG2-R, HRM-PCR（Shanghai）, Green-2-Go
QPCRMastermix kits.HRM analyzers are hundred source Gene A SA-9600 real-time fluorescence quantitative PCR instrument.
PCR amplification programs：
94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations；
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise is 0.06 DEG C/s.
4th, interpretation of result
High-resolution melting curve is drawn according to data are collected, according to the negative plasmid of restructuring, the melting curve of restructuring positive plasmid
Judge the genotype of sample to be tested JAG2 gene SNP sites rs2238286：
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring positive plasmid is GG；
The genotype of the then JAG2 gene SNP sites rs2238286 between the negative plasmid of restructuring and restructuring positive plasmid is AG.
5th, sensitivity experiment
After restructuring positive plasmid and the negative plasmid of restructuring are diluted into 50ng/ μ l, the two mixing is carried out into gradient dilution, recombinated
Positive plasmid ratio is followed successively by 50%, 25%, 12.5%, 5%, 2% and 1%, is expanded according to above-mentioned HRM-PCR reaction systems and parameter
Increase, analysis mutation inspection range, i.e. sensitivity.
Reaction system is as follows：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
PCR amplification programs：
94 DEG C of predegeneration 3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s
HRM is analyzed：
94℃ 90s
60℃ 30sec
83-94 DEG C of collection data, temperature rate-of-rise is 0.06 DEG C/s.
Result shows referring to Fig. 1, experimental data, when the negative plasmid volume ratio of restructuring positive plasmid and restructuring is respectively 1:1、
1:3、1:7、1:19、1:49、1:When 99, restructuring positive plasmid can be detected, so HRM detection methods of the invention is sensitive
Spend is 1%.
The application detection kit of the invention of embodiment 3 detects sample gene mutation
With detection kit and detection method in the step of embodiment 2, HRM analyses are carried out to 30 samples, with the positive matter of restructuring
The melting curve of grain and the negative plasmid of restructuring is compared, and the mutation type in sample is determined according to this, and according to HRM analysis results
It is biological in raw work that 1 sample is selected at random for every kind of genotype（Shanghai）Carry out Sanger sequence verifications.
, referring to table 1 and Fig. 2, JAG2 gene SNP sites rs2238286 is wild in 30 samples of data display for HRM analysis results
Raw type has 21, A>G heterozygous mutants have 6, A>G homozygous mutants 3.
Sanger sequencing results are referring to Fig. 3：Wherein a is the sequencing result of sample number 5, and b is the sequencing knot of sample number 9
Really, c is the sequencing result of sample number 20；It is completely the same with the result that the inventive method is detected.
Analysis result of the application method of the present invention of table 1 to sample
Embodiment 4 is used to detect the kit of JAG2 gene SNP site rs2238286 genotype
Kit for detecting JAG2 gene SNP site rs2238286 genotype of the invention includes following components：
（1）JAG2 rs2238286 standard items：The negative plasmid of restructuring and restructuring positive plasmid, prepare according to the method in embodiment 1；
（2）Primer：The primer sequence is：
Sense primer：JAG2-F 5'- AGGAGCTAGGGGGAGAGAAGAC-3'
Anti-sense primer：JAG2-R 5'- AGGGGTCACCTTGGTGGTTA-3'
（3）PCR amplifing reagents containing saturated fluorescence dyestuff Eva Green.
Method using kit detection JAG2 gene SNP site rs2238286 genotype is same as Example 2.
Finally it should be noted that：The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention,
Although being described in detail to the present invention with reference to the foregoing embodiments, for a person skilled in the art, it still may be used
Modified with to the technical scheme described in foregoing embodiments, or equivalent is carried out to which part technical characteristic.
All any modification, equivalent substitution and improvements within the spirit and principles in the present invention, made etc., should be included in of the invention
Within protection domain.
Sequence table
<110>Suzhou Bai Yuan gene technology Co., Ltd
<120>Kit for detecting JAG2 gene SNP site rs2238286 genotype
<170> PatentIn version 3.5
<210> 1
<211> 250
<212> DNA
<213>Artificial sequence
<400> 1
acccagctcc gggcacaggg caaatttgcg agaggagcta gggggagaga agacagctca 60
gttatcatgg ggatgggttg aggacccctc tggaccatat ggggatcttt aaccaccaag 120
gtgaccccta gctctggaaa ggaccgtgct cactggagga gaggaaggtg ccattggttt 180
tgaccctgtg gaggagctgc gaggtcaccc agggagaggg caaggaggtg accgcagagg 240
atggggtgtg 250
<210> 2
<211> 250
<212> DNA
<213>Artificial sequence
<400> 2
acccagctcc gggcacaggg caaatttgcg agaggagcta gggggagaga agacagctca 60
gttatcatgg ggatgggttg aggacccctc tggaccatgt ggggatcttt aaccaccaag 120
gtgaccccta gctctggaaa ggaccgtgct cactggagga gaggaaggtg ccattggttt 180
tgaccctgtg gaggagctgc gaggtcaccc agggagaggg caaggaggtg accgcagagg 240
atggggtgtg 250
<210> 3
<211> 200
<212> DNA
<213>Artificial sequence
<400> 3
gctccgggca cagggcaaat ttgcgagagg agctaggggg agagaagaca gctcagttat 60
catggggatg ggttgaggac ccctctggac catatgggga tctttaacca ccaaggtgac 120
ccctagctct ggaaaggacc gtgctcactg gaggagagga aggtgccatt ggttttgacc 180
ctgtggagga gctgcgaggt 200
<210> 4
<211> 97
<212> DNA
<213>Artificial sequence
<400> 4
aggagctagg gggagagaag acagctcagt tatcatgggg atgggttgag gacccctctg 60
gaccatatgg ggatctttaa ccaccaaggt gacccct 97
Claims (9)
1. it is used to detect the kit of JAG2 gene SNP site rs2238286 genotype, it is characterised in that：The kit bag
Include primer pair and PCR detection reaction reagents；Wherein, the primer pair is（1）Or（2）In one kind：
（1）Sense primer：JAG2-F 5'- AGGAGCTAGGGGGAGAGAAGAC-3'
Anti-sense primer：JAG2-R 5'- AGGGGTCACCTTGGTGGTTA-3'；
（2）With（1）In complementary series.
2. kit according to claim 1, it is characterised in that：The PCR detections reaction reagent includes containing EvaGreen
Green-2-Go qPCRMastermix.
3. kit according to claim 2, it is characterised in that：The reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
4. according to any described kits of claim 1-3, it is characterised in that：The kit also includes standard items, described
Standard items are the negative plasmid of restructuring and restructuring positive plasmid, and the nucleotides sequence of the restructuring feminine gender plasmid is classified as sequence table SEQ ID
No.1, the nucleotides sequence of the restructuring positive plasmid is classified as SEQ ID No.2 in sequence table.
5. a kind of method of detection JAG2 gene SNP site rs2238286 genotype, it is characterised in that：Step is as follows：
（1）Build the negative plasmid of restructuring and restructuring positive plasmid：The nucleotides sequence of the negative plasmid of restructuring is classified as in sequence table
SEQ ID No.1, the nucleotide sequence of the restructuring positive plasmid is referring to SEQ ID No.2 in sequence table；
（2）Primer pair when PCR is expanded is built, the primer pair is the one kind in a or b：：
A, sense primer：JAG2-F 5'- AGGAGCTAGGGGGAGAGAAGAC-3'
Anti-sense primer：JAG2-R 5'- AGGGGTCACCTTGGTGGTTA-3'；
Complementary series in b and a；
（3）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested
DNA uses step（2）The primer, and enter performing PCR amplification and HRM analyses under identical conditions, collect data；
Preferably, the condition of the HRM analyses is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, raising speed in temperature
Rate is 0.06 DEG C/s；
（4）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent
Line judges the genotype of sample to be tested JAG2 gene SNP sites rs2238286：
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring positive plasmid is GG；
The genotype of the then JAG2 gene SNP sites rs2238286 between the negative plasmid of restructuring and restructuring positive plasmid is AG.
6. method according to claim 5, it is characterised in that：The reaction system when PCR is expanded is：
Green-2-Go qPCRMastermix（Containing EvaGreen） 5μl
Primers F（10μM） 0.1μl
Primer R（10μM） 0.1μl
Template（50ng/μl） 0.5μl
ddH2O 4.3μl
The μ l of cumulative volume 10.
7. method according to claim 6, it is characterised in that：The reaction condition when PCR is expanded is：94 DEG C of predegenerations
3min；94 DEG C of denaturation 10s；60 DEG C of annealing/extension 20s；40 circulations.
8. the application method of any described kits of claim 1-4, it is characterised in that：Step is as follows：
（1）The peripheral blood genomic DNA of sample to be tested is extracted, to the negative plasmid of restructuring, restructuring positive plasmid and sample to be tested
DNA uses same primers, and enters performing PCR amplification and HRM analyses under identical conditions, collects data；
The condition of HRM analysis is：94℃ 90s；60℃ 30s；83-94 DEG C of collection data, temperature rate-of-rise is 0.06
℃/s；
（2）High-resolution melting curve is drawn according to data are collected, the melting according to the negative plasmid of restructuring, restructuring positive plasmid is bent
Line judges the genotype of sample to be tested JAG2 gene SNP sites rs2238286：
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring negative plasmid is AA；
The genotype of then JAG2 gene SNP sites rs2238286 of being overlapped with the melting curve of restructuring positive plasmid is GG；
The genotype of the then JAG2 gene SNP sites rs2238286 between the negative plasmid of restructuring and restructuring positive plasmid is AG.
9. any described kits of claim 1-4 are applied in the reagent for preparing auxiliary diagnosis non-syndrome harelip.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611244592.7A CN106701946A (en) | 2016-12-29 | 2016-12-29 | Kit for detecting genotype of gene JAG2 at SNP site rs2238286 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611244592.7A CN106701946A (en) | 2016-12-29 | 2016-12-29 | Kit for detecting genotype of gene JAG2 at SNP site rs2238286 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106701946A true CN106701946A (en) | 2017-05-24 |
Family
ID=58903885
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611244592.7A Pending CN106701946A (en) | 2016-12-29 | 2016-12-29 | Kit for detecting genotype of gene JAG2 at SNP site rs2238286 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106701946A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111334513A (en) * | 2020-02-13 | 2020-06-26 | 南京医科大学附属口腔医院 | Non-syndromic cleft lip related low-frequency/rare mutation and detection method thereof |
| CN111910001A (en) * | 2020-07-16 | 2020-11-10 | 河南金泰生物技术股份有限公司 | Primer group and kit for detecting SNP site rs1799950 genotyping of BRCA1 gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103589785A (en) * | 2013-09-05 | 2014-02-19 | 谢小冬 | Application of NOTCH3 and JAG2 gene SNP ((Single Nucleotide Polymorphism)) loci |
| CN105441545A (en) * | 2015-12-17 | 2016-03-30 | 苏州百源基因技术有限公司 | Method for detecting FOXH1 gene SNP locus rs750472 genotype |
-
2016
- 2016-12-29 CN CN201611244592.7A patent/CN106701946A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103589785A (en) * | 2013-09-05 | 2014-02-19 | 谢小冬 | Application of NOTCH3 and JAG2 gene SNP ((Single Nucleotide Polymorphism)) loci |
| CN105441545A (en) * | 2015-12-17 | 2016-03-30 | 苏州百源基因技术有限公司 | Method for detecting FOXH1 gene SNP locus rs750472 genotype |
Non-Patent Citations (1)
| Title |
|---|
| 张婷婷: "中国西北人群NOTCH3，JAG2基因多态性与非综合征性唇腭裂的关联研", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111334513A (en) * | 2020-02-13 | 2020-06-26 | 南京医科大学附属口腔医院 | Non-syndromic cleft lip related low-frequency/rare mutation and detection method thereof |
| CN111910001A (en) * | 2020-07-16 | 2020-11-10 | 河南金泰生物技术股份有限公司 | Primer group and kit for detecting SNP site rs1799950 genotyping of BRCA1 gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR101095220B1 (en) | DNA marker associated with resistance of cabbage clubroot disease and uses thereof | |
| CN107058594A (en) | A kind of method, primer and kit for detecting gout tumor susceptibility gene SNP genotype | |
| CN105331714B (en) | A kind of peronophythora litchi LAMP primer and its rapid detection method | |
| CN107488711A (en) | The method and its kit of the genotype detection of point mutation | |
| CN110066883A (en) | With the molecular labeling R112146 of Rice Bacterial Blight Xa23 close linkage | |
| CN106701946A (en) | Kit for detecting genotype of gene JAG2 at SNP site rs2238286 | |
| CN108456743B (en) | SNP (Single nucleotide polymorphism) marker related to flowering period and mature period of soybean as well as detection primer, method and application thereof | |
| CN108192965B (en) | Method for detecting heterogeneity of mitochondrial genome A3243G locus | |
| CN106701945A (en) | Kit used for detecting genotype of GATA4 gene SNP site rs867858 | |
| CN102057055B (en) | The rapid detection of mycobacterium | |
| CN112280876A (en) | Primer, probe, kit and application for recombinase-mediated isothermal amplification detection | |
| CN111378781A (en) | Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application | |
| CN106755439A (en) | Kit for detecting GATA4 gene SNP site rs904018 genotype | |
| CN116287391A (en) | RPA primer for detecting tobacco target spot disease, primer/probe combination and application thereof | |
| CN111996274B (en) | Large-scale quantitative detection method for plant pathogenic fungi by high-throughput sequencing | |
| CN110714093B (en) | SCAR molecular marker related to banana wilt resistance and detection method and application thereof | |
| CN110669859B (en) | SRAP molecular marker related to banana wilt resistance and detection method and application thereof | |
| CN106701947A (en) | Kit for detecting genotype of gene CYP2C19 at SNP site rs4986893 | |
| CN111394491B (en) | Mushroom mating type molecular marker and application thereof in identification of mushroom mating type | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof | |
| CN108642199B (en) | SNP (Single nucleotide polymorphism) marker related to growth of millet flag leaves as well as detection primer and application thereof | |
| CN108707684B (en) | SNP (Single nucleotide polymorphism) marker related to millet flag leaf length and detection primer and application thereof | |
| CN106755440A (en) | Kit for detecting NOTCH3 gene SNP site rs12082 genotype | |
| CN107058509A (en) | Kit and its detection method for detecting SLC2A9 gene SNP site rs3775948 genotype | |
| CN109797235A (en) | With the molecular labeling R112823 of resistance gene of rice blast Pi1 close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170524 |
|
| RJ01 | Rejection of invention patent application after publication |