CN107360877A - Promote the method for Momordica grosvenori CYP26 gene expressions - Google Patents
Promote the method for Momordica grosvenori CYP26 gene expressions Download PDFInfo
- Publication number
- CN107360877A CN107360877A CN201710635571.6A CN201710635571A CN107360877A CN 107360877 A CN107360877 A CN 107360877A CN 201710635571 A CN201710635571 A CN 201710635571A CN 107360877 A CN107360877 A CN 107360877A
- Authority
- CN
- China
- Prior art keywords
- pollen
- cyp26
- promote
- momordica grosvenori
- liquid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/04—Electric or magnetic or acoustic treatment of plants for promoting growth
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G31/00—Soilless cultivation, e.g. hydroponics
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/02—Methods or apparatus for hybridisation; Artificial pollination ; Fertility
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/14—Measures for saving energy, e.g. in green houses
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Biodiversity & Conservation Biology (AREA)
- Ecology (AREA)
- Forests & Forestry (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention provides a kind of method for promoting Momordica grosvenori CYP26 gene expressions, including：The root system of Luohanguo With Plantlets of Tissue Culture is handled, carries out specially treated after plant blossom to pollen, 10 days after plant blossom pollination, increases certain density methyl jasmonate in the induction liquid of continuous sprinkling 7 days.The present invention can promote Momordica grosvenori CYP26 gene expressions, so as to promote the accumulation of momordica glycoside V content.
Description
Technical field
The present invention relates to plant biotechnology field.It is more particularly related to a kind of promote Momordica grosvenori CYP26 bases
Because of the method for expression.
Background technology
Momordica grosvenori is that the peculiar preciousness in China is medicinal and sweetener plant, is Curcurbitaceae (Cucurbitaceae) Momordica grosvenori category
(Siraitia) perennial liana, there is cough-relieving apophlegmatic, cool blood to relax stomach, the effect of relaxing bowel etc..Its main component sweet tea glycosides V
It is one of non-saccharide sweet substance most strong in the world, is 300-400 times of sweetness of cane sugar, is a kind of sweet tea low in calories, pure natural
Taste agent and preferable health products, acted in addition with anti-oxidant, immunological regulation, anticancer, hypoglycemic etc..
Sweet tea glycosides V at present can't chemical synthesis, rely primarily on extraction obtain.Momordica grosvenori requires harsh to habitat, is only suitable for
Grown in Guangxi, and continuous cropping is unable in cultivating, sweet tea glycosides V content is low in fruit, can not meet the market demand, therefore urgently explore and carry
New way, the new method of high sweet tea glycosides V content.
Momordica glycoside V belongs to cucurbitane type tetracyclic triterpenes material, and this seminar early stage is according to Momordica grosvenori transcript profile number
According to having derived the possible biosynthesis pathways of sweet tea glycosides V.The precursor substance of momordica glycoside V biosynthesis is the phosphorus of iso-amylene two
Base pyrophosphoric acid (DMAPP) in sour (IPP) and 3,3- dimethyl alkene, the two is by mevalonic acid (MVA) and methylerythritol
Two approach of phosphorylation (MEP) are formed, and MVA approach occurs in kytoplasm, and MEP approach occurs in plastid.From above-mentioned two
The IPP or DMAPP of approach form Mang ox base pyrophosphoric acid (GPP), IPP and GPP through Mang ox base pyrophosphate synthase (GPS) catalysis
Under farnesyl pyrophosphate synthase (FPS) catalytic action and then farnesyl pyrophosphate (FPP) is formed, then through squalene synthase
(SS), the catalysis of squalene epoxidase (SE) forms 2,3- oxidosqualenes, and cucurbit dienol synthase (CS) is further catalyzed
Cucurbit dienol is formed, finally in the presence of CYP450 enzymes and glucosyltransferase, forms momordica glycoside V.
The generation of isoprenoid material is considered as on its biosynthesis way always by the strict regulation and control of speed limit enzymatic activity
Important regulating and controlling effect is played in footpath.As the rate-limiting enzyme in isoprene approach, the expression of CYP450 enzyme genes is to Momordica grosvenori
Sweet tea glycosides V biosynthesis plays decisive role.CYP450 enzyme genes are overexpressed, the accumulation of momordica glycoside V can be promoted；Phase
Instead, if suppressing the expression of CYP450 enzyme genes, the yield of momordica glycoside V will significantly reduce.However, CYP450 enzyme genes are
Individual supergene family, this seminar early-stage Study find that the route of synthesis of CYP26 and momordica glycoside V has certain association.It is existing
It there are no in technology and promote Momordica grosvenori CYP26 gene expressions to improve the report of sweet tea glycosides V content in Momordica grosvenori.
The content of the invention
As the result of various extensive and careful research and experiment, it has been found by the inventor that in Momordica grosvenori
In planting process, the expression that the solution containing methyl jasmonate can stimulate and induce CYP26 genes in Momordica grosvenori is sprayed, so as to
Promote CYP450 enzyme gene expressions, promote the biosynthesis and accumulation of momordica glycoside V.Based on this discovery, this hair is completed
It is bright.
It is an object of the invention to solve at least the above and defect, and provide the advantages of at least will be described later.
It is a still further object of the present invention to provide one kind by methyl jasmonate to Momordica grosvenori tissue culture, nursery, fruit development
Interference treatment is carried out to promote the method that CYP26 Gene expression Genes are expressed, sweet tea glycosides V content in Momordica grosvenori can be effectively facilitated and accumulated
It is tired.
A further object of the invention is to promote the seed selection of elite plant and scale by tissue cultures and artificial pollination
Change plantation, further promote the yield of momordica glycoside V.
In order to realize according to object of the present invention and further advantage, there is provided one kind promotes Momordica grosvenori CYP26 genes
The method of expression, including：Root long in the root system of Luohanguo With Plantlets of Tissue Culture is less than into short of most long root long degree 1/2 to wipe out, then by 2~
3 sturdy is drawn 2~3 wounds respectively with sterile knife, then described in media packs tissue-cultured seedling root system, continuous intermittent warming 5
It is secondary, magnetization treatment is then carried out, finally the medium on the tissue-cultured seedling is removed in wherein processing procedure and adds jasmonic
Methyl acetate concentrations are 1.0~2.0mg/L；
Specially treated is carried out to pollen after plant blossom and obtains pollen liquid, is sprayed at the pollen liquid with power spraye
The female flower plant to bloom carries out artificial pollination, and the concentration of methyl jasmonate is 0.5~1.0mg/L wherein in pollen liquid；
10 days after plant blossom pollination, the induction liquid of continuous sprinkling 7 days, wherein methyl jasmonate is in the induction liquid
0.5~1.0mg/L.
Preferably, wherein, the medium is treated corn stigma, and the corn stigma is needed through clean dry, in 25
The pre-soaking solution immersion treatment 2h of DEG C water temperature, the Nano Silver containing 1mg/L, 0.5mg/L BA, 1g/ in the pre-soaking solution
L sodium citrates, 3 μ g/L root-inducing powder, 0.15g/L glucomannans, using deionized water as solvent.
Preferably, wherein, the intermittent warming is that the tissue-cultured seedling is first placed at 2 DEG C to store 1min, then is placed in
5min is stored at 25 DEG C, wherein treatment conditions are that humidity is 60~70%.
Preferably, wherein, for the tissue-cultured seedling is placed in magnetizer, setting magnetic field intensity is the magnetization treatment
200~250 Gausses, magnetizing time 1h, magnetize 25~27 DEG C of temperature.
Preferably, wherein, the tissue culture transplantation of seedlings includes：
Tissue-cultured seedling is soaked into sterilizing with 0.1% potassium permanganate or 10~50mg/L bromogeramine solution；
The tissue-cultured seedling of sterilizing is transplanted in the medium of sterilizing, wherein the medium by 20~30 parts by weight vermiculites, 15~
20 parts by weight perlites, 10~15 parts by weight glue sand, 15~20 parts by weight husks, 10~15 parts by weight wood sawdusts and 10~
15 parts by weight dried mushroom slags form；
After transplanting the mg/kg of foliage spray 10 ABT rooting powder solutions once, then carry out shading 5 days.
Preferably, wherein, by through the Luohanguo With Plantlets of Tissue Culture of Fiber differentiation transplanting after after 10~15 days in root drip irrigation
Lure nutrient solution, daily drip irrigation three times, every 5 days drip irrigations one day, is carried out 6 times, wherein methyl jasmonate is in the nutrient solution altogether
1.0~2.0mg/L.
Preferably, wherein, rutin element of the induction liquid also including 300mg/L, induction liquid 2 fountain height is every plant
500g/ times.
Preferably, wherein, the pollen is the pollen of the male flower just opened on the same day, and preparation method is：Work as in pollination day
My god, the male flower is plucked, after stamen post is cut into collection together with pollen, pours into the thin wire sieve of 100 mesh, is gently rubbed with hand,
Pollen is departed from from stamen post.
Preferably, wherein, the specially treated specifically includes：The pollen of collection is dried；Done using moisture absorption
Dry method, silica gel is placed in below pollen, 24h is dried in closing drying machine；The evening before that day that the flowers are in blossom will dry after, flower
Powder is spread in the smooth surface of blank sheet of paper, is placed in 12-20 hours progress moisture absorption activation process in the humidifying chamber that humidity is 60~80%；Inhale
Pollen after wet activation process mixes according to the ratio of 2 parts by weight pollen and 8 parts by weight spray liquids, and is the super of 3KHz with frequency
Ensure within 10 minutes in acoustic wave oscillator to mix stable homogeneous, obtain pollen liquid；
The formula of wherein described spray liquid is 0.1~0.3g/L boric acid, 0.2% amino acid liquid manure, 0.15g/L Portugals sweet dew gather
The sugar ,-D of 0.02~0.06mg/L 2,4,0.5~1.0mg/L methyl jasmonate, using magnetized water as solvent.
Preferably, wherein, the only angle gold lactones of 0.05mg/L are also included in the root system processing.
The present invention comprises at least following beneficial effect：
Root system processing and culture drip irrigation before being transplanted due to tissue-cultured seedling so that jasmonic first is constantly in growth course
It is long-term interior to stimulate and induce the expression of CYP26 genes in Momordica grosvenori in the atmosphere of the solution of ester, so as to promote CYP450 enzyme bases
Because of expression, promote the biosynthesis of momordica glycoside V, improve its yield；
Due to spraying the induction liquid containing methyl jasmonate after result, the expression of CYP26 genes in Momordica grosvenori is induced to increase
By force, so as to promote CYP450 enzyme gene expressions, promote the biosynthesis of momordica glycoside V, improve its yield；
Due to the increase in liquid is induced and rutin element, therefore aid in collaboration of the methyl jasmonate for CYP26 gene expressions
Stimulate, so as to which the accumulation to sweet tea glycosides V in Momordica grosvenori has facilitation.
Due to unified artificial pollination so that when fruit can induce liquid sprinkling in the later stage, while receive stimulation, it is effective to promote
Enter the concentration expression of CYP26 genes, so as to further improve the content of momordica glycoside V, and be advantageous to unified harvesting management
Deng；
Further advantage, target and the feature of the present invention embodies part by following explanation, and part will also be by this
The research and practice of invention and be understood by the person skilled in the art.
Embodiment
With reference to specific embodiment, the present invention is described in further detail, to make those skilled in the art's reference say
Bright book word can be implemented according to this.
It should be noted that experimental method described in following embodiments, is conventional method unless otherwise specified, institute
Reagent and material are stated, unless otherwise specified, is commercially obtained.
<Example 1>
Root long in the root system of Luohanguo With Plantlets of Tissue Culture is less than into most long root long degree 1/2 short wipes out, then sturdy by 2~3
Root draws 2~3 wounds respectively with sterile knife, then described in media packs tissue-cultured seedling root system, continuous intermittent warming 5 times, then
Magnetization treatment is carried out, finally the medium on the tissue-cultured seedling is removed in wherein root system processing procedure and adds methyl jasmonate
Concentration is 1.0mg/L；
Wherein described medium is treated corn stigma, and the corn stigma is needed through clean dry, in the pre- of 25 DEG C of water temperatures
Soaking solution immersion treatment 2h, the Nano Silver containing 1mg/L in the pre-soaking solution, 0.5mg/L BA, 1g/L sodium citrates,
3 μ g/L root-inducing powder, 0.15g/L glucomannans, using deionized water as solvent；
The intermittent warming is that the tissue-cultured seedling is first placed at 2 DEG C to store 1min, then is placed at 25 DEG C and stores 5min,
Wherein treatment conditions are that humidity is 60~70%.
The tissue-cultured seedling is is placed in magnetizer by the magnetization treatment, and setting magnetic field intensity is 200~250 Gausses, magnetic
The change time is 1h, magnetizes 25~27 DEG C of temperature.
Specially treated is carried out to pollen after plant blossom and obtains pollen liquid, is sprayed at the pollen liquid with power spraye
The female flower plant to bloom carries out artificial pollination, and the concentration of methyl jasmonate is 0.5mg/L wherein in pollen liquid；
The pollen is the pollen of the male flower just opened on the same day, and preparation method is：On the day of day of pollinating, the hero is plucked
Flower, after stamen post is cut into collection together with pollen, pour into the thin wire sieve of 100 mesh, gently rubbed with hand, by pollen from stamen post
Depart from.
The specially treated specifically includes：The pollen of collection is dried；Using hygroscopic desiccation method, silica gel is placed in
Below pollen, 24h is dried in closing drying machine；The evening before that day that the flowers are in blossom will dry after, pollen spread in blank sheet of paper
In smooth surface, 12-20 hours progress moisture absorption activation process in the humidifying chamber that humidity is 60~80% is placed in；After moisture absorption activation process
Pollen mixes according to the ratio of 2 parts by weight pollen and 8 parts by weight spray liquids, and 10 in the ultrasonic oscillator for being 3KHz with frequency
Minute ensures mixing stable homogeneous, obtains pollen liquid；The formula of wherein described spray liquid is 0.1~0.3g/L boric acid, 0.2% ammonia
Base sour water fertilizer, 0.15g/L the glucomannans ,-D of 0.02~0.06mg/L 2,4,0.5mg/L methyl jasmonate, with magnetized water
For solvent.
10 days after plant blossom pollination, the induction liquid of continuous sprinkling 7 days, wherein methyl jasmonate is in the induction liquid
0.5mg/L。
<Example 2>
Root long in the root system of Luohanguo With Plantlets of Tissue Culture is less than into most long root long degree 1/2 short wipes out, then sturdy by 2~3
Root draws 2~3 wounds respectively with sterile knife, then described in media packs tissue-cultured seedling root system, continuous intermittent warming 5 times, then
Magnetization treatment is carried out, finally the medium on the tissue-cultured seedling is removed methyl jasmonate concentration is added in wherein processing procedure
For 2.0mg/L；
Wherein described medium is treated corn stigma, and the corn stigma is needed through clean dry, in the pre- of 25 DEG C of water temperatures
Soaking solution immersion treatment 2h, the Nano Silver containing 1mg/L in the pre-soaking solution, 0.5mg/L BA, 1g/L sodium citrates,
3 μ g/L root-inducing powder, 0.15g/L glucomannans, using deionized water as solvent；
The intermittent warming is that the tissue-cultured seedling is first placed at 2 DEG C to store 1min, then is placed at 25 DEG C and stores 5min,
Wherein treatment conditions are that humidity is 60~70%.
The tissue-cultured seedling is is placed in magnetizer by the magnetization treatment, and setting magnetic field intensity is 200~250 Gausses, magnetic
The change time is 1h, magnetizes 25~27 DEG C of temperature.
Specially treated is carried out to pollen after plant blossom and obtains pollen liquid, is sprayed at the pollen liquid with power spraye
The female flower plant to bloom carries out artificial pollination, and the concentration of methyl jasmonate is 1.0mg/L wherein in pollen liquid；
The pollen is the pollen of the male flower just opened on the same day, and preparation method is：On the day of day of pollinating, the hero is plucked
Flower, after stamen post is cut into collection together with pollen, pour into the thin wire sieve of 100 mesh, gently rubbed with hand, by pollen from stamen post
Depart from.
The specially treated specifically includes：The pollen of collection is dried；Using hygroscopic desiccation method, silica gel is placed in
Below pollen, 24h is dried in closing drying machine；The evening before that day that the flowers are in blossom will dry after, pollen spread in blank sheet of paper
In smooth surface, 12-20 hours progress moisture absorption activation process in the humidifying chamber that humidity is 60~80% is placed in；After moisture absorption activation process
Pollen mixes according to the ratio of 2 parts by weight pollen and 8 parts by weight spray liquids, and 10 in the ultrasonic oscillator for being 3KHz with frequency
Minute ensures mixing stable homogeneous, obtains pollen liquid；The formula of wherein described spray liquid is 0.1~0.3g/L boric acid, 0.2% ammonia
Base sour water fertilizer, 0.15g/L the glucomannans ,-D of 0.02~0.06mg/L 2,4,100mg/L methyl jasmonate, with magnetized water
For solvent.
10 days after plant blossom pollination, the induction liquid of continuous sprinkling 7 days, wherein methyl jasmonate is in the induction liquid
1.0mg/L。
<Example 3>
Root long in the root system of Luohanguo With Plantlets of Tissue Culture is less than into most long root long degree 1/2 short wipes out, then sturdy by 2~3
Root draws 2~3 wounds respectively with sterile knife, then described in media packs tissue-cultured seedling root system, continuous intermittent warming 5 times, then
Magnetization treatment is carried out, finally the medium on the tissue-cultured seedling is removed methyl jasmonate concentration is added in wherein processing procedure
For 1.5mg/L；
Wherein described medium is treated corn stigma, and the corn stigma is needed through clean dry, in the pre- of 25 DEG C of water temperatures
Soaking solution immersion treatment 2h, the Nano Silver containing 1mg/L in the pre-soaking solution, 0.5mg/L BA, 1g/L sodium citrates,
3 μ g/L root-inducing powder, 0.15g/L glucomannans, using deionized water as solvent；
The intermittent warming is that the tissue-cultured seedling is first placed at 2 DEG C to store 1min, then is placed at 25 DEG C and stores 5min,
Wherein treatment conditions are that humidity is 60~70%.
The tissue-cultured seedling is is placed in magnetizer by the magnetization treatment, and setting magnetic field intensity is 200~250 Gausses, magnetic
The change time is 1h, magnetizes 25~27 DEG C of temperature.
Specially treated is carried out to pollen after plant blossom and obtains pollen liquid, is sprayed at the pollen liquid with power spraye
The female flower plant to bloom carries out artificial pollination, and the concentration of methyl jasmonate is 0.75mg/L wherein in pollen liquid；
The pollen is the pollen of the male flower just opened on the same day, and preparation method is：On the day of day of pollinating, the hero is plucked
Flower, after stamen post is cut into collection together with pollen, pour into the thin wire sieve of 100 mesh, gently rubbed with hand, by pollen from stamen post
Depart from.
The specially treated specifically includes：The pollen of collection is dried；Using hygroscopic desiccation method, silica gel is placed in
Below pollen, 24h is dried in closing drying machine；The evening before that day that the flowers are in blossom will dry after, pollen spread in blank sheet of paper
In smooth surface, 12-20 hours progress moisture absorption activation process in the humidifying chamber that humidity is 60~80% is placed in；After moisture absorption activation process
Pollen mixes according to the ratio of 2 parts by weight pollen and 8 parts by weight spray liquids, and 10 in the ultrasonic oscillator for being 3KHz with frequency
Minute ensures mixing stable homogeneous, obtains pollen liquid；The formula of wherein described spray liquid is 0.1~0.3g/L boric acid, 0.2% ammonia
Base sour water fertilizer, 0.15g/L the glucomannans ,-D of 0.02~0.06mg/L 2,4,0.75mg/L methyl jasmonate, with magnetized water
For solvent.
10 days after plant blossom pollination, the induction liquid of continuous sprinkling 7 days, wherein methyl jasmonate is in the induction liquid
0.75mg/L。
<Example 4>
On the basis of embodiment 3, by through the Luohanguo With Plantlets of Tissue Culture of Fiber differentiation transplanting after after 10~15 days in root
Drip irrigation lures nutrient solution, and daily drip irrigation three times, every 5 days drip irrigations one day, is carried out 6 times, wherein jasmonic first in the nutrient solution altogether
Ester is 1.0mg/L.
<Example 5>
On the basis of embodiment 3, by through the Luohanguo With Plantlets of Tissue Culture of Fiber differentiation transplanting after after 10~15 days in root
Drip irrigation lures nutrient solution, and daily drip irrigation three times, every 5 days drip irrigations one day, is carried out 6 times, wherein jasmonic first in the nutrient solution altogether
Ester is 2.0mg/L.
<Example 6>
On the basis of embodiment 3, by through the Luohanguo With Plantlets of Tissue Culture of Fiber differentiation transplanting after after 10~15 days in root
Drip irrigation lures nutrient solution, and daily drip irrigation three times, every 5 days drip irrigations one day, is carried out 6 times, wherein jasmonic first in the nutrient solution altogether
Ester is 1.5mg/L.
<Example 7>
On the basis of embodiment 3, the method for described promotion Momordica grosvenori CYP26 gene expressions is described to induce in liquid also
Include 300mg/L rutin element.
<Example 8>
On the basis of embodiment 3, the method for described promotion Momordica grosvenori CYP26 gene expressions, in the root system processing
Also include the only angle gold lactones of 0.05mg/L.
In order to illustrate the effect of the present invention, it is as follows that inventor provides comparative experiments：
<Comparative example 1>
In root system processing procedure, methyl jasmonate is not added, remaining parameter is with identical in example 3, technique mistake
Journey is also identical.
<Comparative example 2>
In artificial pollination, the content of methyl jasmonate is 0mg/L in spray liquid, remaining parameter with it is complete in example 3
Identical, technical process is also identical.
<Comparative example 3>
After pollination, sprinkling induction liquid middle methyl jasmonate content be 0, remaining parameter with it is complete in example 3
Identical, technical process is also identical.
<Blank group>
With reference to embodiment 1, wherein not adding remaining parameter of methyl jasmonate and the complete phase in example 1 in each step
Together, technical process is also identical.
Measuring method：
1st, CYP26 gene expressions quantity measuring method：Using ABI7500 real-time fluorescence quantitative PCR instrument, examined using qRT-PCR
Survey the expression of CYP26 genes.
Step 1：Sample pre-treatments：Lo Han Guo fruit is gathered, picking pulp, 2-4mm fritters is cut into and uses masking foil respectively
Wrap, be immediately placed on it is quick-frozen in liquid nitrogen, be stored in -80 DEG C it is standby.
Step 2：First using improved Trizol method extraction Lo Han Guo fruit total serum IgE；
Step 3：It is μ L, the PrimeScript RT Enzyme of RNA 10.0 by the reaction system that RNA reverse transcriptions are cDNA
μ L, the RNase Free dH2O of 1.0 μ L, RT Primer Mix of Mix I, 1.0 μ L, 5 × PrimeScript Buffer 2 4.0
4.0μL；Reaction condition is 37 DEG C of (15min) → 85 DEG C (5s) → 4 DEG C；
Step 4：Using the software Design primers of Primer Premier 5.0, wherein, CYP26 primer sequences are：
FP：TTTGTACTGCTGTCTTTGCTTCA,
RP：GTTTGGAAGAGCATGGTTTTATT；
Reference gene UBQ5,
Sequence is FP：ATAAAAGACCCAGCACCACATTC,
RP：CCCTTGCCGACTACAACATCC；
Step 5：QRT-PCR reaction systems (20 μ L) are SYBR Premix Ex Taq II (Tli RNaseH Plus)
(2 ×) 10.0 μ L, PCR Forward Primer (10 μM) 0.8 μ L, PCR Reverse Primer (10 μM) 0.8 μ L, ROX
The 2.0 6.0 μ L of μ L, dH2O of μ L, Template of Reference Dye of Dye II (50 ×) 0.4；Reaction condition is 95 DEG C
(30s), then carry out 40 cycles [95 DEG C (5s), 95 DEG C (34s)].
2nd, momordica glycoside V content：Using high performance liquid chromatography, specific method reference《Colleges Of Traditional Chinese Medicine Of Guangxi's journal》The
" content of momordica glycoside V in the HPLC measure Momordica grosvenoris " text delivered on 04 phase in 2007.
Lo Han Guo fruit is gathered, is dried for standby.Sample is extracted through 70% methanol solution and dissolved, using C18 reverse-phase chromatographies
Post separation, it is that mobile phase is eluted with the phosphoric acid solution of acetonitrile -0.1% (22: 78), Detection wavelength 203nm, flow velocity lmL/
Min, qualitative with chromatographic peak retention time and uv-vis spectra progress, external standard method is quantified.
The influence of 1 different embodiments of table and comparative example method to Momordica grosvenori CYP24 gene expression amounts and sweet tea glycosides V content
| CYP24 gene expression amounts | Sweet tea glycosides V content/(w/w%) | |
| Blank group | 1 | 0.69 |
| Embodiment 1 | 10.8 | 1.31 |
| Embodiment 2 | 12.1 | 1.49 |
| Embodiment 3 | 14.2 | 1.67 |
| Embodiment 4 | 15.1 | 1.89 |
| Embodiment 5 | 16.2 | 2.11 |
| Embodiment 6 | 18.0 | 2.37 |
| Embodiment 7 | 15.8 | 2.05 |
| Embodiment 8 | 16.9 | 2.21 |
| Comparative example 1 | 4.7 | 0.97 |
| Comparative example 2 | 9.8 | 1.20 |
| Comparative example 3 | 10.3 | 1.29 |
Note：The Lo Han Guo fruit CYP24 gene expression amounts of different methyl jasmonate concentration processing are not with inducing culture
It 1 is reference that the Lo Han Guo fruit CYP24 gene expression amounts obtained through methyl jasmonate concentration processing method, which are,；Above-mentioned experimental data
It is that the Lo Han Guo fruit obtained on 20 Momordica grosvenori fruit trees that each above-mentioned embodiment obtains in optionally wherein 5 is carried out
What parallel test obtained.
From upper table 1, it can be seen that due to the addition of jasmine in the processing of tissue-cultured seedling root system, induction liquid and nutrient solution in example
Jasmine acid methyl esters, its CYP26 gene expression amount and sweet tea glycosides V content are significantly higher than un-added situation.And jasmonic first in example
The ratio of ester composition is controlled between certain limit, if it does, its facilitation unobvious.
Comparative example 1 is not added with methyl jasmonate, its CYP26 gene expression amount and sweet tea glycosides compared with example 3 in root system processing
V content is decreased obviously, but contrasting blank still has increase.
For comparative example 2 compared with example 3, pollination is not added with methyl jasmonate in the stage, its CYP26 gene expression amount and sweet tea glycosides
V content is decreased obviously, but contrasting blank still has increase.
Comparative example 3 is not added with methyl jasmonate compared with example 3 in the as a result stage, its CYP26 gene expression amount and sweet tea glycosides
V content is decreased obviously, but contrasting blank still has increase.
It can be seen that the effect that root system processing stage of the invention is stimulated is the most notable；
Embodiment 4 increases nutrient solution compared with example 3 after transplanting, methyl jasmonate concentration is 1.0mg/L, its CYP26 base
Because of expression quantity and the increase of sweet tea glycosides V content.
Embodiment 5 increases nutrient solution compared with example 3 after transplanting, methyl jasmonate concentration is 2.0mg/L, its CYP26 base
Because of expression quantity and the increase of sweet tea glycosides V content.
Embodiment 6 increases nutrient solution compared with example 3 after transplanting, methyl jasmonate concentration is 1.5mg/L, its CYP26 base
Because of expression quantity and the increase of sweet tea glycosides V content, and increasing degree is maximum.
It can be seen that the present invention increases the nutrient solution containing methyl jasmonate and can promote CYP26 gene expression amounts after the transfer
It is accumulative with sweet tea glycosides V, and concentration has relatively good effect in 1.0~2mg/L.
Embodiment 7 induces the rutin element for also including 300mg/L in liquid compared with example 3, its CYP26 gene expression amount
With the increase of sweet tea glycosides V content.
It can be seen that increasing rutin element in liquid is induced methyl jasmonate can be cooperateed with to promote CYP26 gene expression amounts and sweet tea glycosides V
Content increase.
Embodiment 8 also includes the only angle gold lactones of 0.05mg/L, its CYP26 gene table compared with example 3 in root system processing
Up to amount and the increase of sweet tea glycosides V content.
It can be seen that additionally increasing enoxolone in root system processing stage methyl jasmonate can be cooperateed with to promote CYP26 gene expressions
Amount and the increase of sweet tea glycosides V content.
Although embodiment of the present invention is disclosed as above, it is not restricted in specification and embodiment listed
With.It can be applied to various suitable the field of the invention completely., can be easily for those skilled in the art
Realize other modification.Therefore it is of the invention and unlimited under the universal limited without departing substantially from claim and equivalency range
In specific details and shown here as the example with description.
Claims (10)
- A kind of 1. method for promoting Momordica grosvenori CYP26 gene expressions, it is characterised in that including：Root long in the root system of Luohanguo With Plantlets of Tissue Culture is less than into short of most long root long degree 1/2 to wipe out, then by 2~3 sturdy with Sterile knife draws 2~3 wounds respectively, then described in media packs tissue-cultured seedling root system, continuous intermittent warming 5 times, then carry out Magnetization treatment, finally the medium on the tissue-cultured seedling is removed methyl jasmonate concentration is added in wherein root system processing procedure For 1.0~2.0mg/L；Specially treated is carried out to pollen after plant blossom and obtains pollen liquid, the pollen liquid is sprayed at power spraye and bloomed Female flower plant carry out artificial pollination, the concentration of methyl jasmonate is 0.5~1.0mg/L wherein in pollen liquid；10 days after plant blossom pollination, the induction liquid of continuous sprinkling 7 days, wherein in the induction liquid methyl jasmonate be 0.5~ 1.0mg/L。
- 2. promote the method for Momordica grosvenori CYP26 gene expressions as claimed in claim 1, it is characterised in that the medium is place The corn stigma managed, the corn stigma are needed through clean dry, described pre- in the pre-soaking solution immersion treatment 2h of 25 DEG C of water temperatures The Nano Silver containing 1mg/L, 0.5mg/L BA, 1g/L sodium citrates, 3 μ g/L root-inducing powder, 0.15g/L Portugals are sweet in soaking solution Reveal glycan, using deionized water as solvent.
- 3. promote the method for Momordica grosvenori CYP26 gene expressions as claimed in claim 1, it is characterised in that the intermittent warming It is that the tissue-cultured seedling is first placed at 2 DEG C to store 1min, then is placed at 25 DEG C and stores 5min, wherein treatment conditions is that humidity is 60~70%.
- 4. promote the method for Momordica grosvenori CYP26 gene expressions as claimed in claim 1, it is characterised in that the magnetization treatment For the tissue-cultured seedling is placed in magnetizer, setting magnetic field intensity is 200~250 Gausses, magnetizing time 1h, magnetizes temperature 25 ~27 DEG C.
- 5. promote the method for Momordica grosvenori CYP26 gene expressions as claimed in claim 1, it is characterised in that the tissue-cultured seedling moves Cultivation includes：Tissue-cultured seedling is soaked into sterilizing with 0.1% potassium permanganate or 10~50mg/L bromogeramine solution；The tissue-cultured seedling of sterilizing is transplanted in the medium of sterilizing, wherein the medium is by 20~30 parts by weight vermiculites, 15~20 weights Measure part perlite, 10~15 parts by weight glue sand, 15~20 parts by weight husks, 10~15 parts by weight wood sawdusts and 10~15 weights Measure part dried mushroom slag composition；After transplanting the mg/kg of foliage spray 10 ABT rooting powder solutions once, then carry out shading 5 days.
- 6. promote the method for Momordica grosvenori CYP26 gene expressions as claimed in claim 1, it is characterised in that will be through Fiber differentiation Luohanguo With Plantlets of Tissue Culture transplanting after after 10~15 days in root drip irrigation nutrient solution, daily drip irrigation three times, every 5 days drip irrigations one My god, carry out 6 times altogether, wherein methyl jasmonate is 1.0~2.0mg/L in the nutrient solution.
- 7. promote the method for Momordica grosvenori CYP26 gene expressions as claimed in claim 1, it is characterised in that the induction liquid is also Rutin element including 300mg/L, induction liquid 2 fountain height be every plant 500g/ times.
- 8. promote the method for Momordica grosvenori CYP26 gene expressions as claimed in claim 1, it is characterised in that the pollen is to work as The pollen for the male flower that day has just opened, preparation method are：On the day of day of pollinating, the male flower is plucked, stamen post is cut together with pollen After collection, pour into the thin wire sieve of 100 mesh, gently rubbed with hand, pollen is departed from from stamen post.
- 9. promote the method for Momordica grosvenori CYP4 gene expressions as claimed in claim 8, it is characterised in that the specially treated Specifically include：The pollen of collection is dried；Using hygroscopic desiccation method, silica gel is placed in below pollen, closing drying machine is dried 24h；After the evening before that day that the flowers are in blossom will be dried, pollen spread in the smooth surface of blank sheet of paper, it is 60~80% to be placed in humidity 12-20 hours carry out moisture absorption activation process in humidifying chamber；Pollen after moisture absorption activation process is according to 2 parts by weight pollen and 8 weight The ratio mixing of part spray liquid, and ensure within 10 minutes in the ultrasonic oscillator for being 3KHz with frequency to mix stable homogeneous, obtain Pollen liquid；The formula of wherein described spray liquid be 0.1~0.3g/L boric acid, 0.2% amino acid liquid manure, 0.15g/L glucomannans, 0.02~0.06mg/L 2,4-D, 0.5~1.0mg/L methyl jasmonate, using magnetized water as solvent.
- 10. promote the method for Momordica grosvenori CYP4 gene expressions as claimed in claim 1, it is characterised in that the root system processing In also include the only angle gold lactones of 0.05mg/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710635571.6A CN107360877A (en) | 2017-07-28 | 2017-07-28 | Promote the method for Momordica grosvenori CYP26 gene expressions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710635571.6A CN107360877A (en) | 2017-07-28 | 2017-07-28 | Promote the method for Momordica grosvenori CYP26 gene expressions |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107360877A true CN107360877A (en) | 2017-11-21 |
Family
ID=60307498
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710635571.6A Withdrawn CN107360877A (en) | 2017-07-28 | 2017-07-28 | Promote the method for Momordica grosvenori CYP26 gene expressions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107360877A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110447414A (en) * | 2019-08-22 | 2019-11-15 | 桂林莱茵生物科技股份有限公司 | A method of improving Momordica grosvenori mogroside V content |
-
2017
- 2017-07-28 CN CN201710635571.6A patent/CN107360877A/en not_active Withdrawn
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110447414A (en) * | 2019-08-22 | 2019-11-15 | 桂林莱茵生物科技股份有限公司 | A method of improving Momordica grosvenori mogroside V content |
| CN110447414B (en) * | 2019-08-22 | 2022-04-05 | 桂林莱茵生物科技股份有限公司 | Method for increasing content of mogroside V in momordica grosvenori |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105359796A (en) | Middle maturing cantaloupe plantation method in northern part of Anhui province | |
| CN110402769B (en) | Seedling raising method of industrial hemp with high CBD content | |
| CN106613986A (en) | Method for improving content of mogroside III | |
| CN106577300B (en) | The method for improving squalene content in Siraitia grosvenorii | |
| CN108718591B (en) | Seedling growing method for lavender | |
| CN104705072A (en) | Iodine-containing pepper grafting and planting method | |
| CN102640705A (en) | Fast propagation method for aquatic plant lotus flowers | |
| CN106856719A (en) | A kind of seed accelerating germination method of Snakegourd Fruit | |
| CN106613987B (en) | The method for improving mogroside ⅡE content | |
| CN107258541A (en) | Promote the method for Momordica grosvenori UGT7 gene expressions | |
| CN107360877A (en) | Promote the method for Momordica grosvenori CYP26 gene expressions | |
| CN104585040B (en) | A kind of method utilizing Rhizoma Ardisiae Gigantifoliae plumelet plumular axis its seedling of Fast-propagation | |
| CN107006167A (en) | A kind of method for culturing seedlings of soya seeds bud rate occurred frequently | |
| CN104335886A (en) | Cultivation method of blueberry before transplantation | |
| WO2023155855A1 (en) | Application of 2-amino-3-indole butyric acid in promoting plant growth | |
| CN111685125A (en) | Plant growth regulator and application thereof | |
| CN106258080B (en) | A method of utilizing biotechnology vernalization Chinese yew seed | |
| CN107232064A (en) | Promote the method for Momordica grosvenori CYP23 gene expressions | |
| CN107295971A (en) | Promote the method for Momordica grosvenori CYP4 gene expressions | |
| CN107278658A (en) | Promote the method for Momordica grosvenori UGT1 gene expressions | |
| CN107232063A (en) | Promote the method for Momordica grosvenori CYP24 gene expressions | |
| CN105557527B (en) | A kind of hybrid cymbidium artificial seed production method | |
| KR20070066461A (en) | Method of producing a plant growth activator for the cultivation of sprout seed plants as a property of chlorella culture by diluting and diluting nutrients expressed in seeds | |
| CN106305054A (en) | High-yield and high-quality culture method of Kunlun snow daisy in Nanjing area | |
| CN107227290A (en) | Promote the method for Momordica grosvenori CYP81Q67 gene expressions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20171121 |
|
| WW01 | Invention patent application withdrawn after publication |