CN107227290A - Promote the method for Momordica grosvenori CYP81Q67 gene expressions - Google Patents
Promote the method for Momordica grosvenori CYP81Q67 gene expressions Download PDFInfo
- Publication number
- CN107227290A CN107227290A CN201710629817.9A CN201710629817A CN107227290A CN 107227290 A CN107227290 A CN 107227290A CN 201710629817 A CN201710629817 A CN 201710629817A CN 107227290 A CN107227290 A CN 107227290A
- Authority
- CN
- China
- Prior art keywords
- cyp81q67
- momordica grosvenori
- gene expressions
- methyl jasmonate
- promote
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/001—Culture apparatus for tissue culture
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/0018—Culture media for cell or tissue culture
- C12N5/0025—Culture media for plant cell or plant tissue culture
Abstract
The invention discloses a kind of method of promotion Momordica grosvenori CYP81Q67 gene expressions, Luohanguo With Plantlets of Tissue Culture is inoculated in Fiber differentiation at least 30 days in inducing culture, wherein, the concentration of methyl jasmonate is 50 400 μm of ol/L in inducing culture.The method of the present invention has the accumulation for promoting the expression of Momordica grosvenori CYP81Q67 genes with momordica glycoside V content.
Description
Technical field
The present invention relates to plant biotechnology field.It is more particularly related to which a kind of promote Momordica grosvenori
The method of CYP81Q67 gene expressions.
Background technology
Momordica glycoside V belongs to cucurbitane type tetracyclic triterpenes material, and this seminar early stage is according to Momordica grosvenori transcript profile number
According to having derived the possible biosynthesis pathways of sweet tea glycosides V.The precursor substance of momordica glycoside V biosynthesis is the phosphorus of iso-amylene two
Base pyrophosphoric acid (DMAPP) in sour (IPP) and 3,3- dimethyl alkene, the two is by mevalonic acid (MVA) and methylerythritol
Two approach of phosphorylation (MEP) are formed, and MVA approach occurs in kytoplasm, and MEP approach occurs in plastid.From above-mentioned two
The IPP or DMAPP of approach form Mang ox base pyrophosphoric acid (GPP), IPP and GPP through Mang ox base pyrophosphate synthase (GPS) catalysis
Under farnesyl pyrophosphate synthase (FPS) catalytic action so formed farnesyl pyrophosphate (FPP), then through squalene synthase
(SS), the catalysis of squalene epoxidase (SE) forms 2,3- oxidosqualenes, and cucurbit dienol synthase (CS) is further catalyzed
Cucurbit dienol is formed, finally in the presence of CYP450 enzymes and glucosyltransferase, momordica glycoside V is formed.
The generation of isoprenoid material is considered as on its biosynthesis way always by the strict regulation and control of speed limit enzymatic activity
Important regulating and controlling effect is played in footpath.As the rate-limiting enzyme in isoprene approach, the expression of CYP450 enzyme genes is to Momordica grosvenori
Sweet tea glycosides V biosynthesis plays decisive role.CYP450 enzyme genes are overexpressed, the accumulation of momordica glycoside V can be promoted；Phase
Instead, if suppressing the expression of CYP450 enzyme genes, the yield of momordica glycoside V will be significantly reduced.However, CYP450 enzyme genes are
Individual supergene family, this seminar early-stage Study finds that the route of synthesis of CYP81Q67 and momordica glycoside V has certain association.
Promotion Momordica grosvenori CYP81Q67 gene expressions are there are no in the prior art to improve the report of sweet tea glycosides V content in Momordica grosvenori.
The content of the invention
It is an object of the invention to solve at least the above, and provide the advantage that at least will be described later.
It is a still further object of the present invention to provide one kind by methyl jasmonate treatment Luohanguo With Plantlets of Tissue Culture or its fruit come
Promote the method for Momordica grosvenori CYP81Q67 gene expressions, foundation stone is established to effectively facilitate sweet tea glycosides V content accumulation in Momordica grosvenori.
It is a still further object of the present invention to provide one kind by being handled with pollen into one the processing of Luohanguo With Plantlets of Tissue Culture root system
The method that step promotes Momordica grosvenori CYP81Q67 gene expressions to improve momordica glycoside V content.
Momordica grosvenori CYP81Q67 bases are promoted there is provided one kind according to object of the present invention and further advantage in order to realize
Because of the method for expression, Luohanguo With Plantlets of Tissue Culture is inoculated in Fiber differentiation at least 30 days in inducing culture, wherein, inducing culture
The concentration of middle methyl jasmonate is 50-400 μm of ol/L.
Preferably, also wrapped in the method for described promotion Momordica grosvenori CYP81Q67 gene expressions, the inducing culture
Basal medium is included, its formula is：MS+1.5mg/L 6-BA+0.3mg/L IBA+3.5g/L agar+30g/l sucrose+1.0g/L
Activated carbon.
Preferably, the method for described promotion Momordica grosvenori CYP81Q67 gene expressions, the condition of the Fiber differentiation is：
Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/d, 23 ± 2 DEG C of temperature.
Preferably, the method for described promotion Momordica grosvenori CYP81Q67 gene expressions, the compound method of inducing culture
It is as follows：Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%, 10000 μm of ol/L jasmonic first is configured to
Ester mother liquor, and sterilized with 0.22 μm of miillpore filter, the methyl jasmonate mother liquor after sterilizing is added in basal medium, extremely
Methyl jasmonate concentration is 50-400 μm of ol/L, sterilizes and is cooled to 24-26 DEG C.
Preferably, jasmine in the method for described promotion Momordica grosvenori CYP81Q67 gene expressions, the inducing culture
The concentration of sour methyl esters is 200-250 μm of ol/L.
Preferably, the method for described promotion Momordica grosvenori CYP81Q67 gene expressions, by the Momordica grosvenori through Fiber differentiation
It is early, middle and late daily to be dripped in Momordica grosvenori surface sprinkling induction liquid to surface 20-30 days after pollinating after tissue culture transplantation of seedlings, even
Contain the methyl jasmonate that concentration is 50-400 μm of ol/L in continuous sprinkling 5 days, the induction liquid.
Preferably, concentration is contained in the method for described promotion Momordica grosvenori CYP81Q67 gene expressions, the induction liquid
For 100-150 μm of ol/L methyl jasmonate.
Preferably, also wrapped in the method for described promotion Momordica grosvenori CYP81Q67 gene expressions, the inducing culture
The golden lactone of the plain sterol of 0.3mg/L rapes and the only angles of 0.04mg/L is included.
Preferably, the method for described promotion Momordica grosvenori CYP81Q67 gene expressions, the tissue-cultured seedling is through the induction
Handled before culture by root, the root processing is specifically included：
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy use sterile knife
2-3 wound is drawn respectively, and wound depth is less than 0.2mm, then the corn stigma handled with process pre-soaking coats the root system of tissue-cultured seedling,
Continuously intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment in 100-200 gauss magnetic fields
1h；
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in
5min is stored at 25 DEG C；
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion of 30-40 DEG C of water temperature
Handle 15min, the nano zine oxide containing 1mg/L in the pre-soaking solution, 2g/L citric acids, 5 μ g/L root of Chinese trichosanthes,
0.2g/L glucomannans, using magnetized water as solvent.
Preferably, the method for described promotion Momordica grosvenori CYP81Q67 gene expressions, after Luohanguo With Plantlets of Tissue Culture is transplanted, in
Full-bloom stage 6-7 in morning points win the flower on 2-3 grades of lateral bines of staminiferous plant, take pollen, pollen are first placed in pollen soak with frequency
Rate is stir process 2h in 3KHz ultrasonic oscillator, then after 400 mesh filtered through gauze, gauze is put down together with the upper thing of filter
Stand is placed in water glass with cover, covers provided with passage, glassware with cover is placed in into 40 DEG C of constant temperature together with pollen
8h is dried in drying machine, sealed storage is drawn off being placed in the environment that relative humidity is 85-90% in standby at 4 DEG C before pollination
Middle moisture absorption 24h；
Wherein, the plain sterol of the honey containing 25g/L, 0.1mg/L rapes, 0.05mg/L regard Huang in the pollen soak
The golden lactone in the only angle of acid, 0.02mg/L, solvent is magnetized water.
The method of the promotion Momordica grosvenori CYP81Q67 gene expressions of the present invention is simple to operate, and cost is low, environmentally friendly, fits
In large-scale production, with stronger practicality and promotional value, at least including following beneficial effect：
1) present invention before Luohanguo With Plantlets of Tissue Culture transplanting by being used the Fiber differentiation containing methyl jasmonate to it
Fiber differentiation in base, it is long-term interior to stimulate and induce the expression of CYP81Q67 genes in Momordica grosvenori, so as to promote CYP450 enzyme bases
Because being overexpressed, promote the biosynthesis of momordica glycoside V, improve its yield；
2) present invention is by the way that after Luohanguo With Plantlets of Tissue Culture is transplanted, luring containing methyl jasmonate is used in 20-30d after pollination
Drain processing Momordica grosvenori surface, further stimulates and induces the expression of CYP81Q67 genes in Momordica grosvenori, so as to promote in a short time
Enter to promote the biosynthesis of momordica glycoside V；
3) present invention is by the golden lactone of the plain sterol of rape of addition Sq and only angle in inducing culture, with jasmonic
Methyl esters plays coordinative role, and further induction stimulates Luohanguo With Plantlets of Tissue Culture to express CYP81Q67 genes；
4) present invention is by the way that to carrying out root system processing before Luohanguo With Plantlets of Tissue Culture Fiber differentiation, to remove weak, scratching stimulates
Qiang Gen, and combination is handled with continuous intermittent warming and magnetic field, stimulate and coerce sweet tea glycosides V biosynthesis in Luohanguo With Plantlets of Tissue Culture fruit
Key gene CYP81Q67 high expression in approach, so as to further improve the content of momordica glycoside V；
5) present invention is fully sent out by being handled using pollen soak combination sonic oscillation the staminiferous plant pollen for pollination
Wave the effect of main component in pollen soak, wherein the cavitation of honey, magnetized water combination ultrasonic wave is by pollen soak
In the plain sterol of rape, the golden lactone of retinoic acid and only angle fully wrap up staminiferous plant pollen, induced strong simultaneously regulates and controls Momordica grosvenori female plant and awarded
Enzyme gene CYP81Q67 height expression after powder, promotes the accumulation of CYP81Q67 gene expression amounts, so as to promote the high table of CYP450 enzyme genes
Reach, improve momordica glycoside V content.
Further advantage, target and the feature of the present invention embodies part by following explanation, and part will also be by this
The research and practice of invention and be understood by the person skilled in the art.
Embodiment
With reference to specific embodiment, the present invention is described in further detail, to make those skilled in the art's reference say
Bright book word can be implemented according to this.
It should be noted that experimental method described in following embodiments, is conventional method unless otherwise specified, institute
Reagent and material are stated, unless otherwise specified, is commercially obtained.
Obtained it should be noted that Luohanguo With Plantlets of Tissue Culture as described herein is conventional tissue culture method.6-BA is 6- benzyl amino
Adenine, IBA is indolebutyric acid.
Embodiment 1：
A kind of method of promotion Momordica grosvenori CYP81Q67 gene expressions, Luohanguo With Plantlets of Tissue Culture is inoculated in inducing culture
Fiber differentiation at least 30 days, wherein, the concentration of methyl jasmonate is 50 μm of ol/L in inducing culture.Wherein, the induction training
Supporting also includes basal medium in base, its formula is：MS+1.5mg/L 6-BA+0.3mg/L IBA+3.5g/L agar+30g/l
Sucrose+1.0g/L activated carbons.
Wherein, the condition of the Fiber differentiation is：Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/
23 ± 2 DEG C of d, temperature.
Wherein, the compound method of inducing culture is as follows：Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%
Solution, is configured to 10000 μm of ol/L methyl jasmonate mother liquor, and is sterilized with 0.22 μm of miillpore filter, by the jasmine after sterilizing
Jasmine acid methyl esters mother liquor is added in basal medium, is 50 μm of ol/L to methyl jasmonate concentration, sterilizes and is cooled to 24-26
℃。
Embodiment 2：
A kind of method of promotion Momordica grosvenori CYP81Q67 gene expressions, Luohanguo With Plantlets of Tissue Culture is inoculated in inducing culture
Fiber differentiation at least 30 days, wherein, the concentration of methyl jasmonate is 400 μm of ol/L in inducing culture.
Wherein, basal medium is also included in the inducing culture, its formula is：MS+1.5mg/L 6-BA+0.3mg/
L IBA+3.5g/L agar+30g/l sucrose+1.0g/L activated carbons.
Wherein, the condition of the Fiber differentiation is：Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/
23 ± 2 DEG C of d, temperature.
Wherein, the compound method of inducing culture is as follows：Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%
Solution, is configured to 10000 μm of ol/L methyl jasmonate mother liquor, and is sterilized with 0.22 μm of miillpore filter, by the jasmine after sterilizing
Jasmine acid methyl esters mother liquor is added in basal medium, is 400 μm of ol/L to methyl jasmonate concentration, sterilizes and is cooled to 24-26
℃。
Embodiment 3：
A kind of method of promotion Momordica grosvenori CYP81Q67 gene expressions, Luohanguo With Plantlets of Tissue Culture is inoculated in inducing culture
Fiber differentiation 30 days, wherein, the concentration of methyl jasmonate is 200 μm of ol/L in inducing culture.
Wherein, basal medium is also included in the inducing culture, its formula is：MS+1.5mg/L 6-BA+0.3mg/
L IBA+3.5g/L agar+30g/l sucrose+1.0g/L activated carbons.
Wherein, the condition of the Fiber differentiation is：Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/
23 ± 2 DEG C of d, temperature.
Wherein, the compound method of inducing culture is as follows：Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%
Solution, is configured to 10000 μm of ol/L methyl jasmonate mother liquor, and is sterilized with 0.22 μm of miillpore filter, by the jasmine after sterilizing
Jasmine acid methyl esters mother liquor is added in basal medium, is 200 μm of ol/L to methyl jasmonate concentration, sterilizes and is cooled to 24-26
℃。
Embodiment 4：
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions will be through Fiber differentiation
Luohanguo With Plantlets of Tissue Culture transplant after, it is early, middle and late daily to induce liquid to surface in the sprinkling of Momordica grosvenori surface 20-30 days after pollinating
Drip, continuous sprinkling 5 days is described to induce the methyl jasmonate for containing that concentration is 50 μm of ol/L in liquid.
Embodiment 5：
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions will be through Fiber differentiation
Luohanguo With Plantlets of Tissue Culture transplant after, it is early, middle and late daily to induce liquid to surface in the sprinkling of Momordica grosvenori surface 20-30 days after pollinating
Drip, continuous sprinkling 5 days is described to induce the methyl jasmonate for containing that concentration is 400 μm of ol/L in liquid.
Embodiment 6：
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions will be through Fiber differentiation
Luohanguo With Plantlets of Tissue Culture transplant after, it is early, middle and late daily to induce liquid to surface in the sprinkling of Momordica grosvenori surface 20-30 days after pollinating
Drip, continuous sprinkling 5 days is described to induce the methyl jasmonate for containing that concentration is 150 μm of ol/L in liquid.
Embodiment 7：
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions, the Fiber differentiation
Also include the golden lactone of the plain sterol of 0.3mg/L rapes and the only angles of 0.04mg/L in base.
Embodiment 8：
On the basis of embodiment 6, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions, the Fiber differentiation
Also include the golden lactone of the plain sterol of 0.3mg/L rapes and the only angles of 0.04mg/L in base.
Embodiment 9：
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions, the tissue-cultured seedling warp
Handled before the Fiber differentiation by root, the root processing is specifically included：
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy use sterile knife
2-3 wound is drawn respectively, and wound depth is less than 0.2mm, then the corn stigma handled with process pre-soaking coats the root system of tissue-cultured seedling,
Continuously intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment in 100-200 gauss magnetic fields
1h；
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in
5min is stored at 25 DEG C；
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion of 30-40 DEG C of water temperature
Handle 15min, the nano zine oxide containing 1mg/L in the pre-soaking solution, 2g/L citric acids, 5 μ g/L root of Chinese trichosanthes,
0.2g/L glucomannans, using magnetized water as solvent.
Embodiment 10：
On the basis of embodiment 6, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions, the tissue-cultured seedling warp
Handled before the Fiber differentiation by root, the root processing is specifically included：
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy use sterile knife
2-3 wound is drawn respectively, and wound depth is less than 0.2mm, then the corn stigma handled with process pre-soaking coats the root system of tissue-cultured seedling,
Continuously intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment in 100-200 gauss magnetic fields
1h；
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in
5min is stored at 25 DEG C；
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion of 30-40 DEG C of water temperature
Handle 15min, the nano zine oxide containing 1mg/L in the pre-soaking solution, 2g/L citric acids, 5 μ g/L root of Chinese trichosanthes,
0.2g/L glucomannans, using magnetized water as solvent.
Embodiment 11：
On the basis of embodiment 8, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions, the tissue-cultured seedling warp
Handled before the Fiber differentiation by root, the root processing is specifically included：
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy use sterile knife
2-3 wound is drawn respectively, and wound depth is less than 0.2mm, then the corn stigma handled with process pre-soaking coats the root system of tissue-cultured seedling,
Continuously intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment in 100-200 gauss magnetic fields
1h；
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in
5min is stored at 25 DEG C；
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion of 30-40 DEG C of water temperature
Handle 15min, the nano zine oxide containing 1mg/L in the pre-soaking solution, 2g/L citric acids, 5 μ g/L root of Chinese trichosanthes,
0.2g/L glucomannans, using magnetized water as solvent.
Embodiment 12：
On the basis of embodiment 6, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions, Luohanguo With Plantlets of Tissue Culture
After transplanting, the flower on 2-3 grades of lateral bines of staminiferous plant is won in full-bloom stage 6-7 in morning points, pollen is taken, pollen is first placed in pollen immersion
Stir process 2h in the ultrasonic oscillator for being 3KHz with frequency in liquid, then after 400 mesh filtered through gauze, by gauze together with filter
Thing is divided be placed in water glass with cover together, covers provided with passage, and glassware with cover is placed in together with pollen
8h is dried in 40 DEG C of freeze-day with constant temperature machines, sealed storage is drawn off being placed in relative humidity for 85- in standby at 4 DEG C before pollination
Moisture absorption 24h in 90% environment；
Wherein, the plain sterol of the honey containing 25g/L, 0.1mg/L rapes, 0.05mg/L regard Huang in the pollen soak
The golden lactone in the only angle of acid, 0.02mg/L, solvent is magnetized water.
Embodiment 13：
On the basis of embodiment 11, the described method for promoting Momordica grosvenori CYP81Q67 gene expressions, Momordica grosvenori tissue culture
After transplantation of seedlings, the flower on 2-3 grades of lateral bines of staminiferous plant is won in full-bloom stage 6-7 in morning points, pollen is taken, pollen is first placed in pollen leaching
Stir process 2h in the ultrasonic oscillator for being 3KHz with frequency in liquid is steeped, then after 400 mesh filtered through gauze, by gauze together with filter
Upper thing is divided together to be placed in water glass with cover, is covered provided with passage, and glassware with cover is put together with pollen
8h is dried in 40 DEG C of freeze-day with constant temperature machines, sealed storage is drawn off being placed in relative humidity for 85- in standby at 4 DEG C before pollination
Moisture absorption 24h in 90% environment；
Wherein, the plain sterol of the honey containing 25g/L, 0.1mg/L rapes, 0.05mg/L regard Huang in the pollen soak
The golden lactone in the only angle of acid, 0.02mg/L, solvent is magnetized water.
In order to illustrate the technique effect of the present invention, applicant of the present invention is directed to the arhat that distinct methods or embodiment are obtained
Fruits, are measured, specific method and result are as follows for CYP81Q67 gene expression amounts and sweet tea glycosides V content.
1st, CYP81Q67 gene expressions quantity measuring method：Using ABI7500 real-time fluorescence quantitative PCR instrument, using qRT-PCR
Detect the expression of CYP81Q67 genes.
Step 1: sample pre-treatments：Collecting fruit, picking pulp is cut into 2-4mm fritters and wrapped respectively with masking foil,
Be immediately placed on it is quick-frozen in liquid nitrogen, be stored in -80 DEG C it is standby.
Step 2: first extracting Lo Han Guo fruit total serum IgE using improved Trizol method；
Step 3: the reaction system for being cDNA by RNA reverse transcriptions is μ L, the PrimeScript RT Enzyme of RNA 10.0
μ L, the RNase Free dH of 1.0 μ L, RT Primer Mix of Mix I, 1.0 μ L, 5 × PrimeScript Buffer 2 4.02O
4.0μL；Reaction condition is 37 DEG C of (15min) → 85 DEG C (5s) → 4 DEG C；
Step 4: using the software Design primers of Primer Premier 5.0, being had by raw work bioengineering (Shanghai) share
Limit company synthesizes, wherein, CYP81Q67 primer sequences are：
FP：GATAAGAATGCGGCCGCATGGACTTCTTCTCTGCTTTCT,
RP：CGAGCTCTTAGATCTTGTCCAAAGCGTTC；
Reference gene UBQ5, sequence is FP：ATAAAAGACCCAGCACCACATTC, RP：
CCCTTGCCGACTACAACATCC；
Step 5: qRT-PCR reaction systems (20 μ L) are SYBR Premix Ex Taq II (Tli RNaseH Plus)
(2 ×) 10.0 μ L, PCR Forward Primer (10 μM) 0.8 μ L, PCR Reverse Primer (10 μM) 0.8 μ L, ROX
Reference Dye of Dye II (50 ×) 0.4 μ L, Template 2.0 μ L, dH2O 6.0μL；Reaction condition is 95 DEG C
(30s), then carries out 40 cycles [95 DEG C (5s), 95 DEG C (34s)].
2nd, momordica glycoside V content：Using high performance liquid chromatography, specific method reference《Colleges Of Traditional Chinese Medicine Of Guangxi's journal》The
" HPLC determines the content of momordica glycoside V in Momordica grosvenori " one text delivered on 04 phase in 2007.
Comparative example 1：In the method for embodiment 1-3 promotion Momordica grosvenori CYP81Q67 gene expressions, by inducing culture
The concentration of methyl jasmonate is set as successively：0th, 50,100,150,200,250,300,400 μm of ol/L, are contrasted in Fiber differentiation
The concentration of methyl jasmonate in inducing culture is studied when time is 30 days to Momordica grosvenori CYP81Q67 gene expression amounts and sweet tea glycosides V
The influence of content (mass percent), the results are shown in Table 1.
Methyl jasmonate concentration is to Momordica grosvenori CYP81Q67 gene expression amounts and sweet tea glycosides V content in the inducing culture of table 1
Influence
| The concentration μm ol/L of methyl jasmonate | 0 | 50 | 100 | 150 | 200 | 250 | 300 | 400 |
| CYP81Q67 gene expression amounts | 1 | 5.1 | 9.5 | 12.4 | 16.6 | 15.9 | 15.2 | 15.0 |
| Sweet tea glycosides V content/(w/w%) | 0.66 | 0.92 | 1.44 | 1.78 | 2.11 | 2.04 | 1.99 | 1.96 |
Note：In inducing culture the Lo Han Guo fruit CYP81Q67 gene expression amounts of different methyl jasmonate concentration processing with
The Lo Han Guo fruit CYP81Q67 gene expression amounts obtained without methyl jasmonate concentration processing method be 1 be reference；Above-mentioned reality
It is the Momordica grosvenori fruit obtained on 20 Momordica grosvenori fruit trees that each above-mentioned embodiment is obtained in optionally wherein 5 to test data
It is real to carry out what parallel test was obtained.
As shown in Table 1, Lo Han Guo fruit CYP81Q67 can be effectively facilitated by methyl jasmonate being added in inducing culture
The expression of gene, and using during 200-250 μm of ol/L as optimum concentration.
Comparative example 2：In the method for embodiment 4-6 promotion Momordica grosvenori CYP81Q67 gene expressions, by jasmine in induction liquid
The concentration of sour methyl esters is set as successively：0th, 50 jasmine in, 100,150,200,250,300,400 μm of ol/L, comparative study induction liquid
Influence of the concentration of jasmine acid methyl esters to Momordica grosvenori CYP81Q67 gene expression amounts and sweet tea glycosides V content, the results are shown in Table 2.
Influence of the methyl jasmonate concentration to Momordica grosvenori CYP81Q67 gene expression amounts and sweet tea glycosides V content in the induction liquid of table 2
| The concentration μm ol/L of methyl jasmonate | 0 | 50 | 100 | 150 | 200 | 250 | 300 | 400 |
| CYP81Q67 gene expression amounts | 16.6 | 17.3 | 19.2 | 19.5 | 18.7 | 18.1 | 17.7 | 17.4 |
| Sweet tea glycosides V content/(w/w%) | 2.11 | 2.24 | 2.50 | 2.55 | 2.47 | 2.41 | 2.37 | 2.30 |
Note：In inducing culture the Lo Han Guo fruit CYP81Q67 gene expression amounts of different methyl jasmonate concentration processing with
The Lo Han Guo fruit CYP81Q67 gene expression amounts obtained without methyl jasmonate concentration processing method be 1 be reference；Above-mentioned reality
It is the Momordica grosvenori fruit obtained on 20 Momordica grosvenori fruit trees that each above-mentioned embodiment is obtained in optionally wherein 5 to test data
It is real to carry out what parallel test was obtained.
As shown in Table 2, methyl jasmonate is added in induction liquid, in Momordica grosvenori nursery stock 20-30 days after pollinating, daily
It is early, middle and late further to effectively facilitate the expression of Lo Han Guo fruit CYP81Q67 genes in the sprinkling of Momordica grosvenori surface, and with
It is optimum concentration to induce when methyl jasmonate concentration is 100-150 μm of ol/L in liquid.
Comparative example 3：Comparative example 3, embodiment 6, embodiment 7, embodiment 8, embodiment 9, embodiment 10, embodiment
11st, embodiment 12, the method for the promotion Momordica grosvenori CYP81Q67 gene expressions of embodiment 13, determine Momordica grosvenori CYP81Q67 genes
Expression quantity and sweet tea glycosides V content, the results are shown in Table 3.Control group is set as：On the basis of embodiment 3, by jasmine in inducing culture
Sour methyl acetate concentrations are set to 0 μm of ol/L, other be the same as Examples 3.
Not influence of the be the same as Example method to Momordica grosvenori CYP81Q67 gene expression amounts and sweet tea glycosides V content of table 3
Note：In inducing culture the Lo Han Guo fruit CYP81Q67 gene expression amounts of different methyl jasmonate concentration processing with
The Lo Han Guo fruit CYP81Q67 gene expression amounts obtained without methyl jasmonate concentration processing method be 1 be reference；Above-mentioned reality
It is the Momordica grosvenori fruit obtained on 20 Momordica grosvenori fruit trees that each above-mentioned embodiment is obtained in optionally wherein 5 to test data
It is real to carry out what parallel test was obtained.
Embodiment 7 is on the basis of embodiment 3 and embodiment 6, to be added in inducing culture respectively with embodiment 8
The golden lactone of the plain sterol of appropriate rape and only angle, as can be seen from Table 3, embodiment 7 and embodiment 8 respectively relative embodiment 3 and
CYP81Q67 gene expression amounts are substantially increased with sweet tea glycosides V content in the Lo Han Guo fruit that embodiment 6 is obtained；
Embodiment 9, embodiment 10, embodiment 11 be respectively on the basis of embodiment 3, embodiment 6 and embodiment 8, in
Tissue-cultured seedling is handled by root before Fiber differentiation, as can be seen from Table 3, embodiment 9, embodiment 10, embodiment 11 are distinguished
CYP81Q67 gene expression amounts and sweet tea glycosides V content are in the Lo Han Guo fruit obtained with respect to embodiment 3, embodiment 6 with embodiment 8
Dramatically increase.
Embodiment 12 is on the basis of embodiment 6 and embodiment 11, in transplanting before pollination, to sieve respectively with embodiment 13
Chinese fruit male flower pollen is handled, as can be seen from Table 3, and embodiment 12 is with embodiment 13 respectively with respect to embodiment 6 and embodiment
CYP81Q67 gene expression amounts are dramatically increased with sweet tea glycosides V content in 11 obtained Lo Han Guo fruits.
Although embodiment of the present invention is disclosed as above, it is not restricted in specification and embodiment listed
With it can be applied to various suitable the field of the invention completely, can be easily for those skilled in the art
Other modification is realized, therefore under the universal limited without departing substantially from claim and equivalency range, the present invention is not limited
In specific details and shown here as the embodiment with description.
Claims (10)
1. a kind of method of promotion Momordica grosvenori CYP81Q67 gene expressions, it is characterised in that Luohanguo With Plantlets of Tissue Culture is inoculated in and lured
Fiber differentiation at least 30 days in culture medium are led, wherein, the concentration of methyl jasmonate is 50-400 μm of ol/L in inducing culture.
2. promote the method for Momordica grosvenori CYP81Q67 gene expressions as claimed in claim 1, it is characterised in that the induction training
Supporting also includes basal medium in base, its formula is：MS+1.5mg/L 6-BA+0.3mg/L IBA+3.5g/L agar+30g/l
Sucrose+1.0g/L activated carbons.
3. promote the method for Momordica grosvenori CYP81Q67 gene expressions as claimed in claim 2, it is characterised in that the induction training
Foster condition is：Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/d, 23 ± 2 DEG C of temperature.
4. promote the method for Momordica grosvenori CYP81Q67 gene expressions as claimed in claim 2, it is characterised in that inducing culture
Compound method it is as follows：Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%, 10000 μm of ol/L are configured to
Methyl jasmonate mother liquor, and sterilized with 0.22 μm of miillpore filter, the methyl jasmonate mother liquor after sterilizing be added to basis
It is 50-400 μm of ol/L to methyl jasmonate concentration in culture medium, sterilizes and be cooled to 24-26 DEG C.
5. promote the method for Momordica grosvenori CYP81Q67 gene expressions as claimed in claim 1, it is characterised in that the induction training
It is 200-250 μm of ol/L to support the concentration of methyl jasmonate in base.
6. promote the method for Momordica grosvenori CYP81Q67 gene expressions as claimed in claim 1, it is characterised in that will be trained through induction
It is early, middle and late daily in Momordica grosvenori surface sprinkling induction liquid to table 20-30 days after pollinating after foster Luohanguo With Plantlets of Tissue Culture is transplanted
Face is dripped, continuous sprinkling 5 days, contains the methyl jasmonate that concentration is 50-400 μm of ol/L in the induction liquid.
7. promote the method for Momordica grosvenori CYP81Q67 gene expressions as claimed in claim 6, it is characterised in that the induction liquid
In contain the methyl jasmonate that concentration is 100-150 μm of ol/L.
8. the method for the promotion Momordica grosvenori CYP81Q67 gene expressions as described in claim 5 or 6, it is characterised in that described to lure
Lead and also include the golden lactone of the plain sterol of 0.3mg/L rapes and the only angles of 0.04mg/L in culture medium.
9. promote the method for Momordica grosvenori CYP81Q67 gene expressions as claimed in claim 1, it is characterised in that the tissue-cultured seedling
Through being handled before the Fiber differentiation by root, the root processing is specifically included：
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy distinguished with sterile knife
2-3 wound is drawn, wound depth is less than 0.2mm, then the root system of tissue-cultured seedling is coated with the corn stigma handled by pre-soaking, continuously
Intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment 1h in 100-200 gauss magnetic fields；
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in 25 DEG C
Lower storage 5min；
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion treatment of 30-40 DEG C of water temperature
Nano zine oxide containing 1mg/L, 2g/L citric acids, 5 μ g/L root of Chinese trichosanthes, 0.2g/L Portugals in 15min, the pre-soaking solution
Mannosan, using magnetized water as solvent.
10. promote the method for Momordica grosvenori CYP81Q67 gene expressions as claimed in claim 6, it is characterised in that Momordica grosvenori group
Train after transplantation of seedlings, win the flower on 2-3 grades of lateral bines of staminiferous plant in full-bloom stage 6-7 in morning points, take pollen, pollen is first placed in pollen
Stir process 2h in the ultrasonic oscillator for being 3KHz with frequency in soak, then after 400 mesh filtered through gauze, by gauze together with
Thing is divided be placed in water glass with cover together in filter, covers provided with passage, by glassware with cover together with pollen
Be placed in 40 DEG C of freeze-day with constant temperature machines and dry 8h, sealed storage in standby at 4 DEG C, be drawn off being placed in relative humidity before pollination be
Moisture absorption 24h in 85-90% environment；
Wherein, the plain sterol of the honey containing 25g/L in the pollen soak, 0.1mg/L rapes, 0.05mg/L retinoic acids,
The golden lactone in the only angles of 0.02mg/L, solvent is magnetized water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710629817.9A CN107227290A (en) | 2017-07-28 | 2017-07-28 | Promote the method for Momordica grosvenori CYP81Q67 gene expressions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710629817.9A CN107227290A (en) | 2017-07-28 | 2017-07-28 | Promote the method for Momordica grosvenori CYP81Q67 gene expressions |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107227290A true CN107227290A (en) | 2017-10-03 |
Family
ID=59956290
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710629817.9A Withdrawn CN107227290A (en) | 2017-07-28 | 2017-07-28 | Promote the method for Momordica grosvenori CYP81Q67 gene expressions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107227290A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111279915A (en) * | 2018-12-07 | 2020-06-16 | 广西作物遗传改良生物技术重点开放实验室 | Method for inducing amphoteric flowers of momordica grosvenori |
-
2017
- 2017-07-28 CN CN201710629817.9A patent/CN107227290A/en not_active Withdrawn
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111279915A (en) * | 2018-12-07 | 2020-06-16 | 广西作物遗传改良生物技术重点开放实验室 | Method for inducing amphoteric flowers of momordica grosvenori |
| CN111279915B (en) * | 2018-12-07 | 2021-09-28 | 广西作物遗传改良生物技术重点开放实验室 | Method for inducing amphoteric flowers of momordica grosvenori |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104920227A (en) | Stem cell tissue culture seedling raising technique | |
| BRPI0619656A2 (en) | method for isolating a single cell clone derived from a plant cambium, resulting clone, method of producing biologically active plant substances, and method of preserving a plant cell line | |
| CN104206417A (en) | Method for promoting paeonia suffruticosa seedling growth and application thereof | |
| CN106797974A (en) | The method for improving Simon glycosides I contents in Momordica grosvenori | |
| CN101622955B (en) | Culture medium composition suitable for germ-free germination of orchid seeds and method thereof | |
| CN104737761B (en) | The cuttage breeding method of sinojackia xylocarpa | |
| Harris et al. | Regeneration from leaf squares of Peperomia sandersii A. DC: a relationship between rooting and budding | |
| CN107227290A (en) | Promote the method for Momordica grosvenori CYP81Q67 gene expressions | |
| CN103766039B (en) | Method for breaking dormancy of nervilis fordii schlecht bulb | |
| Son et al. | Large-scale culture of plant cell and tissue by bioreactor system | |
| CN107258541A (en) | Promote the method for Momordica grosvenori UGT7 gene expressions | |
| CN102994544A (en) | Method for cultivating transgenetic gloxinia plant through agrobacterium-mediated transformation | |
| WO2023155855A1 (en) | Application of 2-amino-3-indole butyric acid in promoting plant growth | |
| CN107306792A (en) | Promote the method for Momordica grosvenori CYP87D17 gene expressions | |
| CN107278900A (en) | Promote the method for Momordica grosvenori CYP87D18 gene expressions | |
| CN107258542A (en) | Promote the method for Momordica grosvenori CYP749A36 gene expressions | |
| CN107223568A (en) | Promote the method for Momordica grosvenori CYP89A143 gene expressions | |
| CN107360877A (en) | Promote the method for Momordica grosvenori CYP26 gene expressions | |
| CN107295971A (en) | Promote the method for Momordica grosvenori CYP4 gene expressions | |
| CN108034681A (en) | Utilize the method for the stem of Radix Codonopsis lanceolatae forming layer stem cell production Catalpol for the culture that suspends | |
| CN107232063A (en) | Promote the method for Momordica grosvenori CYP24 gene expressions | |
| CN107278658A (en) | Promote the method for Momordica grosvenori UGT1 gene expressions | |
| CN107278657A (en) | Suppress the method for Momordica grosvenori CAS gene expressions | |
| CN107318654A (en) | Promote the method for Momordica grosvenori CS gene expressions | |
| CN107232064A (en) | Promote the method for Momordica grosvenori CYP23 gene expressions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20171003 |
|
| WW01 | Invention patent application withdrawn after publication |