CN107278657A - Suppress the method for Momordica grosvenori CAS gene expressions - Google Patents
Suppress the method for Momordica grosvenori CAS gene expressions Download PDFInfo
- Publication number
- CN107278657A CN107278657A CN201710629254.3A CN201710629254A CN107278657A CN 107278657 A CN107278657 A CN 107278657A CN 201710629254 A CN201710629254 A CN 201710629254A CN 107278657 A CN107278657 A CN 107278657A
- Authority
- CN
- China
- Prior art keywords
- momordica grosvenori
- concentration
- methyl jasmonate
- suppress
- cas gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/001—Culture apparatus for tissue culture
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/008—Methods for regeneration to complete plants
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Engineering & Computer Science (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Biotechnology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Ecology (AREA)
- Forests & Forestry (AREA)
- Cell Biology (AREA)
- Wood Science & Technology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of method for suppressing Momordica grosvenori CAS gene expressions, Luohanguo With Plantlets of Tissue Culture is seeded in inducing culture of the methyl jasmonate concentration for 325 400 μm of ol/L and cultivates 28 30d.The present invention has the expression for suppressing Momordica grosvenori CAS genes, improves the effect of the content of momordica glycoside V.
Description
Technical field
The present invention relates to plant biological field.It is more particularly related to which a kind of suppress Momordica grosvenori CAS gene expressions
Method.
Background technology
Momordica glycoside V is extracted in Guangxi special product economic plants --- and Momordica grosvenori, its sugariness is 300 times of sucrose, its heat
Amount is zero, with clearing heat and moistening lung antibechic, relax bowel the effect of, to obesity, constipation, diabetes etc. have preventive and therapeutic effect, at present
Market is larger to the demand of momordica glycoside V, it is therefore desirable to improve plantation efficiency to improve the yield of momordica glycoside V with full
The need for sufficient market.Momordica glycoside V belongs to cucurbitane type tetracyclic triterpenes material, and this seminar early stage is transcribed according to Momordica grosvenori
Group data, have derived the possible biosynthesis pathways of sweet tea glycosides V.The precursor substance of momordica glycoside V biosynthesis is iso-amylene
Base pyrophosphoric acid (DMAPP) in diphosphonic acid (IPP) and 3,3- dimethyl alkene, the two is by mevalonic acid (MVA) and the red moss of methyl
Two approach of sugar alcohol phosphorylation (MEP) are formed, and MVA approach occurs in kytoplasm, and MEP approach occurs in plastid.From upper
The IPP or DMAPP for stating two approach form Mang ox base pyrophosphoric acid (GPP), IPP through Mang ox base pyrophosphate synthase (GPS) catalysis
With GPP under farnesyl pyrophosphate synthase (FPS) catalytic action so that formed farnesyl pyrophosphate (FPP), then through spiny dogfish
Alkene synthase (SS), the catalysis of squalene epoxidase (SE) form 2,3- oxidosqualenes, and 2,3- oxidosqualenes are through cucurbit two
Further catalysis forms cucurbit dienol to enol synthase (CS), finally in the presence of CYP450 enzymes and glucosyltransferase,
Form momordica glycoside V.2,3- oxidosqualenes can also be through cycloartenol synthase (CAS) formation cycloartenol, and this is to be formed
The precursor substance of different sterols.
The generation of isoprenoid material is considered as on its biosynthesis way always by the strict regulation and control of speed limit enzymatic activity
Important regulating and controlling effect is played in footpath.CAS competes CS substrate (2,3- oxidosqualene), its carbon skeleton is fought for, towards plant
The direction of sterol is developed, and the synthesis of momordica glycoside V is have impact on indirectly.Suppress the expression of CAS genes, arhat can be promoted indirectly
Fruit sweet tea glycosides V accumulation；If on the contrary, being overexpressed CAS genes, the accumulation of phytosterol will be promoted, and reduce momordica glycoside V
Yield.The report for suppressing Momordica grosvenori CAS gene expressions is there are no in the prior art.
The content of the invention
It is an object of the invention to solve tradition plantation momordica glycoside V yield it is not high the problem of, and provide extremely
The advantage that will be described later less.
Momordica grosvenori CAS gene tables are suppressed there is provided one kind according to object of the present invention and further advantage in order to realize
The method reached, Luohanguo With Plantlets of Tissue Culture is seeded in methyl jasmonate concentration to cultivate in 325-400 μm of ol/L inducing culture
28-30d。
Preferably, it is configured to jasmine with volume fraction for 2% ethanol water dissolving methyl jasmonate in above-mentioned steps
Jasmine acid methyl esters mother liquor, and being sterilized with miillpore filter, is cooled to 24-26 DEG C after sterilizing, then by the methyl jasmonate mother liquor after cooling
It is added in solid medium, is 325-400 μm of ol/L to methyl jasmonate ultimate density, obtains inducing culture.
Preferably, the solid medium component is：MS+6-BA 1.5mg/L+ indolebutyric acid 0.3mg/L+ agar
3.5g/L+ sucrose 30g/l+ activated carbons 1.0g/L.
Preferably, Luohanguo With Plantlets of Tissue Culture is placed in humidity 60-66%, intensity of illumination 1400lux, light application time 8h/d,
Cultivated under the conditions of 23 ± 2 DEG C of temperature.
Preferably, methyl jasmonate is dissolved for 2% ethanol water with volume fraction, methyl jasmonate is made into
325-400 μm of ol/L methyl jasmonate solution, is sprayed on the Momordica grosvenori surface of 20-30d after pollination, Momordica grosvenori is sprayed to every time
Untill surface is dripped, sprinkling three times daily every 4-6h sprinklings once, continuously spray 4-6d.
Preferably, the mixed solution of abscisic acid and calcium chloride is prepared, the wherein concentration of abscisic acid is 10-20mg/L, chlorine
The concentration for changing calcium is 350-540mg/L, the mixed solution of abscisic acid and calcium chloride is carried out into magnetization treatment, magnetic field intensity is 150-
200mT, the magnetization treatment time is 8-12min, and the root of cultured tissue-cultured seedling is put in into the abscisic acid after magnetization treatment and chlorine
Change and immersion culture is carried out in the mixed solution of calcium, soak time is 8-12h；The 20th day after Momordica grosvenori Seeding planting, then use
The mixed solution drop of abscisic acid and calcium chloride after magnetization treatment imposes on Momordica grosvenori seedling root, and the drop amount of applying is 300- every time
500ml/ plants, applied once every 3 days drops, drop is applied 5 times altogether.
Preferably, in the Pollination of Luohanguo phase, the Ne-He laser for being daily 400-420nm with wavelength is to Momordica grosvenori pistil
It is irradiated, each irradiation time is 2-4min, is irradiated once daily, Continuous irradiation three days；Since pollination, first day with dense
Spend and spray Momordica grosvenori plant for 0.02-0.04mM Boratex, spray 50-100ml, second day is 0.02-0.05mM with concentration
Ammonium molybdate spray Momordica grosvenori plant, spray 50-100ml, the 3rd day be 0.01-0.02% with mass concentration glycine betaine spray
Momordica grosvenori plant, sprays 50-100ml, and every 5 days repetitive cyclings spray once three kinds of solution, and circulation altogether is sprayed 6 times.
Preferably, Lo Han Guo fruit is wrapped with kraft paper bag in the middle and later periods of Lo Han Guo fruit, and led into bag
Enter the carbon dioxide that concentration is 2-3%, remaining is nitrogen, each bagging 3-5h, altogether bagging 5-6 times.
The present invention at least includes following beneficial effect：
(1) jasmonic formicester is added in the culture medium of Luohanguo With Plantlets of Tissue Culture, so in Luohanguo With Plantlets of Tissue Culture growth course
In, jasmonic formicester acts on tissue-cultured seedling always, so as to suppress the expression of CAS genes in Luohanguo With Plantlets of Tissue Culture, and then promotes sieve
Chinese fruit sweet tea glycosides V synthesis, and the applicant has found that methyl jasmonate concentration is 325-400 μm of ol/L optimum by lot of experiments
Suppress the CAS gene expressions in Luohanguo With Plantlets of Tissue Culture；(2) to spray jasmonic formicester molten on 20-30d Momordica grosvenori surface after pollination
Liquid, is gone to stimulate Momordica grosvenori with jasmonic formicester and then suppresses the expression of Momordica grosvenori CAS genes, improved in Lo Han Guo fruit expanding stage
The content of momordica glycoside V；
(2) mixed solution of abscisic acid and calcium chloride is carried out after magnetization treatment, magnetization treatment, contributes to the mixed solution
Ordered movement, improves its action effect in vivo, is sprayed with the abscisic acid and the mixed solution of calcium chloride after magnetization treatment
Momordica grosvenori seedling plants and drop apply the root of Momordica grosvenori so that Momordica grosvenori seedling fully absorbs abscisic acid and calcium chloride, abscisic acid
Momordica grosvenori seedling is worked in calcium chloride, metabolism in Momordica grosvenori plant can be coordinated, promotes metabolic balance, and plant can be regulated and controled
The synthetic quantity of thing sterol, so as to suppress the expression of CAS genes, promotes the synthesis of momordica glycoside V；
(3) laser treatment is carried out to Momordica grosvenori at the florescence, the Momordica grosvenori plant after pollination absorbs photon, and intramolecular occurs
Energy level transition, and then influence the total amount of DNA molecular, plays inhibitory action to the expression of Momordica grosvenori CAS genes, then one longer
Boratex, ammonium molybdate and glycine betaine are sprayed respectively to Momordica grosvenori in time, this three's collective effect to Momordica grosvenori aerobic respiration and
Energy metabolism has good protective effect, while cellular osmotic balance can be maintained, regulates and controls the activity of rate-limiting enzyme, limits plant
The generation of sterol, suppresses the expression of Momordica grosvenori CAS genes, improves the content of momordica glycoside V；By Boratex, ammonium molybdate and sweet tea
Dish alkali is separately sprayed daily, can so allow Momordica grosvenori preferably to absorb sprayed material, and gradually play a role；
(4) bagging processing is carried out in the Momordica grosvenori middle and later periods, momordica glycoside V accumulation can be improved.
Further advantage, target and the feature of the present invention embodies part by following explanation, and part will also be by this
The research and practice of invention and be understood by the person skilled in the art.
Embodiment
With reference to specific embodiment, the present invention is described in further detail, to make those skilled in the art's reference say
Bright book word can be implemented according to this.
It should be noted that experimental method described in following embodiments, is conventional method unless otherwise specified, institute
Reagent and material are stated, unless otherwise specified, is commercially obtained.
Embodiment 1：
A kind of method for suppressing Momordica grosvenori CAS gene expressions, Luohanguo With Plantlets of Tissue Culture is seeded in into methyl jasmonate concentration is
In 325 μm of ol/L inducing culture, humidity 60%, intensity of illumination 1200lux, light application time 8h/d, 23 ± 2 DEG C of temperature are placed in
Under the conditions of cultivate 30d.Wherein solid medium component is：MS+6-BA 1.5mg/L+ indolebutyric acid 0.3mg/L+ agar 3.5g/L
+ sucrose 30g/l+ activated carbons 1.0g/L；Add methyl jasmonate method be：It is molten for 2% ethanol water with volume fraction
Solution methyl jasmonate is configured to methyl jasmonate mother liquor, and is sterilized with 0.22 μm of miillpore filter, and 24-26 is cooled to after sterilizing
DEG C, then the methyl jasmonate mother liquor after cooling is added in above-mentioned solid medium, it is 325 to methyl jasmonate ultimate density
μm ol/L, obtains inducing culture.
Embodiment 2：
A kind of method for suppressing Momordica grosvenori CAS gene expressions, Luohanguo With Plantlets of Tissue Culture is seeded in into methyl jasmonate concentration is
In 375 μm of ol/L inducing culture, humidity 65%, intensity of illumination 1400lux, light application time 8h/d, 23 ± 2 DEG C of temperature are placed in
Under the conditions of cultivate 30d.Wherein solid medium component is：MS+6-BA 1.5mg/L+ indolebutyric acid 0.3mg/L+ agar 3.5g/L
+ sucrose 30g/l+ activated carbons 1.0g/L；Add methyl jasmonate method be：It is molten for 2% ethanol water with volume fraction
Solution methyl jasmonate is configured to methyl jasmonate mother liquor, and is sterilized with 0.22 μm of miillpore filter, and 24-26 is cooled to after sterilizing
DEG C, then the methyl jasmonate mother liquor after cooling is added in above-mentioned solid medium, it is 375 to methyl jasmonate ultimate density
μm ol/L, obtains inducing culture.
Embodiment 3：
A kind of method for suppressing Momordica grosvenori CAS gene expressions, Luohanguo With Plantlets of Tissue Culture is seeded in dense containing methyl jasmonate
Spend in the solid medium for 400 μm of ol/L, be placed in humidity 66%, intensity of illumination 1400lux, light application time 8h/d, temperature 23
30d is cultivated under the conditions of ± 2 DEG C.Wherein solid medium component is：MS+6-BA 1.5mg/L+ indolebutyric acid 0.3mg/L+ agar
3.5g/L+ sucrose 30g/l+ activated carbons 1.0g/L；Add methyl jasmonate method be：With the ethanol water that volume fraction is 2%
Solution dissolving methyl jasmonate is configured to methyl jasmonate mother liquor, and is sterilized with 0.22 μm of miillpore filter, is cooled to after sterilizing
24-26 DEG C, then the methyl jasmonate mother liquor after cooling is added in above-mentioned solid medium, to methyl jasmonate ultimate density
For 400 μm of ol/L, inducing culture is obtained.
Embodiment 4：
On the basis of embodiment 3, methyl jasmonate is dissolved for 2% ethanol water with volume fraction, by jasmonic
Methyl esters is made into methyl jasmonate solution of the concentration for 365 μm of ol/L, is sprayed on the Momordica grosvenori surface of 30d after pollination, every time sprinkling
Untill Momordica grosvenori surface is dripped, sprinkling three times daily every 4h sprinklings once, continuously spray 6d.
Embodiment 5：
On the basis of embodiment 3, methyl jasmonate is dissolved for 2% ethanol water with volume fraction, by jasmonic
Methyl esters is made into methyl jasmonate solution of the concentration for 325 μm of ol/L, is sprayed on the Momordica grosvenori surface of 25d after pollination, every time sprinkling
Untill Momordica grosvenori surface is dripped, sprinkling three times daily every 6h sprinklings once, continuously spray 5d.
Embodiment 6：
On the basis of embodiment 3, methyl jasmonate is dissolved for 2% ethanol water with volume fraction, by jasmonic
Methyl esters is made into methyl jasmonate solution of the concentration for 400 μm of ol/L, is sprayed on the Momordica grosvenori surface of 20d after pollination, every time sprinkling
Untill Momordica grosvenori surface is dripped, sprinkling three times daily every 5h sprinklings once, continuously spray 4d.
Embodiment 7：
On the basis of embodiment 3, the mixed solution of abscisic acid and calcium chloride is prepared, the concentration of wherein abscisic acid is
10mg/L, the concentration of calcium chloride is 350mg/L, and the mixed solution of abscisic acid and calcium chloride is carried out into magnetization treatment, magnetic field intensity
For 150mT, the magnetization treatment time is 12min, and the root of cultured tissue-cultured seedling is put in into the abscisic acid after magnetization treatment and chlorine
Change and immersion culture is carried out in the mixed solution of calcium, soak time is 12h；The 20th day after Momordica grosvenori Seeding planting, then use magnetic
The mixed solution drop of abscisic acid and calcium chloride after change processing imposes on Momordica grosvenori seedling root, and the drop amount of applying is 500ml/ plants every time,
Applied once every 3 days drops, drop is applied 5 times altogether.
Embodiment 8：
On the basis of embodiment 3, the mixed solution of abscisic acid and calcium chloride is prepared, the concentration of wherein abscisic acid is
20mg/L, the concentration of calcium chloride is 435mg/L, and the mixed solution of abscisic acid and calcium chloride is carried out into magnetization treatment, magnetic field intensity
For 200mT, the magnetization treatment time is 8min, and the root of cultured tissue-cultured seedling is put in into the abscisic acid after magnetization treatment and chlorination
Immersion culture is carried out in the mixed solution of calcium, soak time is 10h；The 20th day after Momordica grosvenori Seeding planting, then with magnetization
The mixed solution drop of abscisic acid and calcium chloride after processing imposes on Momordica grosvenori seedling root, and the drop amount of applying is 300ml/ plants every time, often
Applied once every 3 days drops, drop is applied 5 times altogether.
Embodiment 9：
On the basis of embodiment 3, the mixed solution of abscisic acid and calcium chloride is prepared, the concentration of wherein abscisic acid is
15mg/L, the concentration of calcium chloride is 540mg/L, and the mixed solution of abscisic acid and calcium chloride is carried out into magnetization treatment, magnetic field intensity
For 180mT, the magnetization treatment time is 10min, and the root of cultured tissue-cultured seedling is put in into the abscisic acid after magnetization treatment and chlorine
Change and immersion culture is carried out in the mixed solution of calcium, soak time is 8h；The 20th day after Momordica grosvenori Seeding planting, then with magnetization
The mixed solution drop of abscisic acid and calcium chloride after processing imposes on Momordica grosvenori seedling root, and the drop amount of applying is 410ml/ plants every time, often
Applied once every 3 days drops, drop is applied 5 times altogether.
Embodiment 10：
On the basis of embodiment 9, in the Pollination of Luohanguo phase, the Ne-He laser for being daily 400nm with wavelength is to Momordica grosvenori
Pistil is irradiated, and each irradiation time is 2min, is irradiated once daily, Continuous irradiation three days；Since pollination, first day use
Concentration sprays Momordica grosvenori plant for 0.02mM Boratex, sprays 100ml, second day be 0.05mM with concentration ammonium molybdate spray
Momordica grosvenori plant, sprays 50ml, sprays Momordica grosvenori plant for 0.02% glycine betaine with mass concentration within the 3rd day, sprays 50ml,
Every 5 days repetitive cyclings spray once three kinds of solution, and circulation altogether is sprayed 6 times.In the middle and later periods kraft paper bag of Lo Han Guo fruit
Lo Han Guo fruit is wrapped, and the carbon dioxide that concentration is 3% is passed through into bag, remaining is nitrogen, each bagging 3h,
It is total to bagging 5 times.
Embodiment 11：
On the basis of embodiment 9, in the Pollination of Luohanguo phase, the Ne-He laser for being daily 420nm with wavelength is to Momordica grosvenori
Pistil is irradiated, and each irradiation time is 4min, is irradiated once daily, Continuous irradiation three days；Since pollination, first day use
Concentration sprays Momordica grosvenori plant for 0.04mM Boratex, sprays 50ml, second day be 0.02mM with concentration ammonium molybdate spray
Momordica grosvenori plant, sprays 100ml, sprays Momordica grosvenori plant for 0.01% glycine betaine with mass concentration within the 3rd day, sprays
100ml, every 5 days repetitive cyclings spray once three kinds of solution, and circulation altogether is sprayed 6 times.Ox is used in the middle and later periods of Lo Han Guo fruit
Mulberry paper bag wraps Lo Han Guo fruit, and is passed through the carbon dioxide that concentration is 2% into bag, and remaining is nitrogen, every time
Bagging 5h, is total to bagging 6 times.
Embodiment 12：
On the basis of embodiment 9, in the Pollination of Luohanguo phase, the Ne-He laser for being daily 420nm with wavelength is to Momordica grosvenori
Pistil is irradiated, and each irradiation time is 3min, is irradiated once daily, Continuous irradiation three days；Since pollination, first day use
Concentration sprays Momordica grosvenori plant for 0.03mM Boratex, sprays 70ml, second day be 0.04mM with concentration ammonium molybdate spray
Momordica grosvenori plant, sprays 60ml, sprays Momordica grosvenori plant for 0.02% glycine betaine with mass concentration within the 3rd day, sprays 80ml,
Every 5 days repetitive cyclings spray once three kinds of solution, and circulation altogether is sprayed 6 times.In the middle and later periods kraft paper bag of Lo Han Guo fruit
Lo Han Guo fruit is wrapped, and the carbon dioxide that concentration is 3% is passed through into bag, remaining is nitrogen, each bagging 4h,
It is total to bagging 6 times.
In order to illustrate beneficial effects of the present invention, applicant of the present invention is directed to the arhat that distinct methods or embodiment are obtained
Fruits, are measured, specific method and result are as follows for CAS gene expression amounts and sweet tea glycosides V content：
1st, CAS gene expressions quantity measuring method：Using ABI7500 real-time fluorescence quantitative PCR instrument, detected using qRT-PCR
The expression of CAS genes.
Step 1: sample pre-treatments：Lo Han Guo fruit is gathered, picking pulp is cut into 2-4mm fritters and uses masking foil respectively
Wrap, be immediately placed on it is quick-frozen in liquid nitrogen, be stored in -80 DEG C it is standby.
Step 2: first extracting Lo Han Guo fruit total serum IgE using improved Trizol method；
Step 3: the reaction system for being cDNA by RNA reverse transcriptions is μ L, the PrimeScript RT Enzyme of RNA 10.0
μ L, the RNase Free dH2O of 1.0 μ L, RT Primer Mix of Mix I, 1.0 μ L, 5 × PrimeScript Buffer 2 4.0
4.0μL；Reaction condition is 37 DEG C of (15min) → 85 DEG C (5s) → 4 DEG C；
Step 4: the step 3 uses the software Design primers of Primer Premier 5.0, by raw work bioengineering (on
Sea) limited company's synthesis, wherein, CAS primer sequences are：
FP：TGCTGTTGGGTGGAGGAT, RP：GCTTAGTTGACATGATGGCTTG；
Reference gene UBQ5, sequence is：
FP：ATAAAAGACCCAGCACCACATTC, RP：CCCTTGCCGACTACAACATCC；
Step 5: qRT-PCR reaction systems (20 μ L) are SYBR Premix Ex Taq II (Tli RNaseH Plus)
(2 ×) 10.0 μ L, PCR Forward Primer (10 μM) 0.8 μ L, PCR Reverse Primer (10 μM) 0.8 μ L, ROX
The 2.0 6.0 μ L of μ L, dH2O of μ L, Template of Reference Dye of Dye II (50 ×) 0.4.Reaction condition is 95 DEG C
(30s), then carries out 40 cycles [95 DEG C (5s), 95 DEG C (34s)].
2nd, momordica glycoside V content：Using high performance liquid chromatography, specific method reference《Colleges Of Traditional Chinese Medicine Of Guangxi's journal》The
" HPLC determines the content of momordica glycoside V in Momordica grosvenori " one text delivered on 04 phase in 2007.
Momordica grosvenori, routine side are planted with the method for conventional method, embodiment 3, embodiment 5, embodiment 9 and embodiment 12
Method is planted as a control group, wins 30 pieces of Momordica grosvenoris altogether on the different Momordica grosvenori plants that every kind of method is planted, and is carried out experiment and is asked
The CAS gene expression amounts and momordica glycoside V content being averagely worth to are as shown in table 1：
Table 1
As can be seen from Table 1, the Momordica grosvenori CAS gene expression amounts and momordica glycoside V content of embodiment 3 are apparently higher than right
According to group, it can be seen that Momordica grosvenori CAS bases can substantially be suppressed by increasing jasmonic formicester in the solid medium in Momordica grosvenori tissue culture face
The expression of cause, so as to significantly improve the content of momordica glycoside V.
Embodiment 5 is that jasmonic formicester solution is sprayed on the Momordica grosvenori on the basis of embodiment 3 after pollination, from table 1
In as can be seen that embodiment 5 Momordica grosvenori CAS gene expression amounts and momordica glycoside V content be significantly lower than embodiment 3, therefore
It can illustrate that spraying jasmonic formicester solution to Momordica grosvenori after pollination also can effectively suppress Momordica grosvenori CAS gene expressions, enter
And improve momordica glycoside V content.
Embodiment 9 is that on the basis of embodiment 3, Momordica grosvenori seedling is entered with the abscisic acid and calcium chloride after magnetization treatment
Row is sprayed and drop is applied, and table 1 is as can be seen that the Momordica grosvenori CAS gene expression amounts of embodiment 9 are less than embodiment 3, and mogroside
V content can suppress the expression of Momordica grosvenori CAS genes and improve arhat apparently higher than embodiment 3, the method for this explanation embodiment 9
Fruit sweet tea glycosides V content.
Embodiment 12 be on the basis of embodiment 9, to Momordica grosvenori carry out laser treatment with irradiation, while spray Boratex,
Ammonium molybdate and glycine betaine, and bagging processing has been carried out to Momordica grosvenori, as can be seen from Table 1, the Momordica grosvenori CAS bases of embodiment 12
Because expression quantity is less than embodiment 9, and momordica glycoside V content is apparently higher than embodiment 3, and the method for this explanation embodiment 9 is to suppression
The expression of Momordica grosvenori CAS genes processed and raising momordica glycoside V content have positive effect.
Although embodiment of the present invention is disclosed as above, it is not restricted in specification and embodiment listed
With it can be applied to various suitable the field of the invention completely, can be easily for those skilled in the art
Other modification is realized, therefore under the universal limited without departing substantially from claim and equivalency range, the present invention is not limited
In specific details and shown here as the embodiment with description.
Claims (8)
1. a kind of method for suppressing Momordica grosvenori CAS gene expressions, it is characterised in that Luohanguo With Plantlets of Tissue Culture is seeded in jasmonic first
Ester concentration cultivates 28-30d in the inducing culture for 325-400 μm of ol/L.
2. suppress the method for Momordica grosvenori CAS gene expressions as claimed in claim 1, it is characterised in that body is used in above-mentioned steps
Fraction is configured to methyl jasmonate mother liquor for 2% ethanol water dissolving methyl jasmonate, and is sterilized with miillpore filter, goes out
24-26 DEG C is cooled to after bacterium, then the methyl jasmonate mother liquor after cooling is added in solid medium, to methyl jasmonate most
Final concentration of 325-400 μm of ol/L, obtains inducing culture.
3. suppress the method for Momordica grosvenori CAS gene expressions as claimed in claim 2, it is characterised in that the solid medium
Component is：MS+6-BA 1.5mg/L+ indolebutyric acid 0.3mg/L+ agar 3.5g/L+ sucrose 30g/l+ activated carbons 1.0g/L.
4. suppress the method for Momordica grosvenori CAS gene expressions as claimed in claim 1, it is characterised in that by Luohanguo With Plantlets of Tissue Culture
It is placed in culture under the conditions of humidity 60-66%, intensity of illumination 1400lux, light application time 8h/d, 23 ± 2 DEG C of temperature.
5. suppress the method for Momordica grosvenori CAS gene expressions as claimed in claim 1, it is characterised in that it is 2% to use volume fraction
Ethanol water dissolving methyl jasmonate, methyl jasmonate is made into 325-400 μm of ol/L methyl jasmonate solution, spray
In the Momordica grosvenori surface of 20-30d after pollination, it is sprayed to every time untill Momordica grosvenori surface drips, sprinkling three times daily, every 4-6h
Sprinkling once, continuously sprays 4-6d.
6. suppress the method for Momordica grosvenori CAS gene expressions as claimed in claim 1, it is characterised in that prepare abscisic acid and chlorine
Change the mixed solution of calcium, the wherein concentration of abscisic acid is 10-20mg/L, and the concentration of calcium chloride is 350-540mg/L, by abscisic acid
Magnetization treatment is carried out with the mixed solution of calcium chloride, magnetic field intensity is 150-200mT, and the magnetization treatment time is 8-12min, will be trained
The root for the tissue-cultured seedling supported is put in progress immersion culture in the mixed solution of the abscisic acid after magnetization treatment and calcium chloride, immersion
Time is 8-12h；The 20th day after Momordica grosvenori Seeding planting, then it is molten with the mixing of abscisic acid and calcium chloride after magnetization treatment
Drop imposes on Momordica grosvenori seedling root, and the drop amount of applying is 300-500ml/ plants every time, is applied once every 3 days drops, drop is applied 5 times altogether.
7. suppress the method for Momordica grosvenori CAS gene expressions as claimed in claim 1, it is characterised in that in the Pollination of Luohanguo phase,
The Ne-He laser for being daily 400-420nm with wavelength is irradiated to Momordica grosvenori pistil, and each irradiation time is 2-4min, often
It irradiates once, Continuous irradiation three days；Since pollination, first day be 0.02-0.04mM with concentration Boratex spray arhat
Fruit plant, sprays 50-100ml, second day be 0.02-0.05mM with concentration ammonium molybdate spray Momordica grosvenori plant, spray 50-
100ml, the 3rd day be 0.01-0.02% with mass concentration glycine betaine spray Momordica grosvenori plant, spray 50-100ml, every 5 days
Repetitive cycling sprays once three kinds of solution, and circulation altogether is sprayed 6 times.
8. suppress the method for Momordica grosvenori CAS gene expressions as claimed in claim 7, it is characterised in that in Lo Han Guo fruit
Middle and later periods is wrapped Lo Han Guo fruit with kraft paper bag, and is passed through the carbon dioxide that concentration is 2-3% into bag, remaining
For nitrogen, each bagging 3-5h is total to bagging 5-6 times.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710629254.3A CN107278657A (en) | 2017-07-28 | 2017-07-28 | Suppress the method for Momordica grosvenori CAS gene expressions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710629254.3A CN107278657A (en) | 2017-07-28 | 2017-07-28 | Suppress the method for Momordica grosvenori CAS gene expressions |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107278657A true CN107278657A (en) | 2017-10-24 |
Family
ID=60102507
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710629254.3A Withdrawn CN107278657A (en) | 2017-07-28 | 2017-07-28 | Suppress the method for Momordica grosvenori CAS gene expressions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107278657A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110684708A (en) * | 2018-07-06 | 2020-01-14 | 华东理工大学 | Method for amplifying and culturing fructus momordicae suspension cells |
| CN111279915A (en) * | 2018-12-07 | 2020-06-16 | 广西作物遗传改良生物技术重点开放实验室 | Method for inducing amphoteric flowers of momordica grosvenori |
-
2017
- 2017-07-28 CN CN201710629254.3A patent/CN107278657A/en not_active Withdrawn
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110684708A (en) * | 2018-07-06 | 2020-01-14 | 华东理工大学 | Method for amplifying and culturing fructus momordicae suspension cells |
| CN110684708B (en) * | 2018-07-06 | 2023-05-16 | 华东理工大学 | Method for amplifying and culturing momordica grosvenori suspension cells |
| CN111279915A (en) * | 2018-12-07 | 2020-06-16 | 广西作物遗传改良生物技术重点开放实验室 | Method for inducing amphoteric flowers of momordica grosvenori |
| CN111279915B (en) * | 2018-12-07 | 2021-09-28 | 广西作物遗传改良生物技术重点开放实验室 | Method for inducing amphoteric flowers of momordica grosvenori |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106718920B (en) | The method for improving momordica glycoside V content | |
| CN106577298B (en) | The method for improving mogroside IV content | |
| CN103011969B (en) | Medium specialized for plant tissue culture, and preparation method thereof | |
| Hashempoor et al. | Effects of different concentrations of mannitol on gene expression in Stevia rebaudiana Bertoni | |
| CN105940811A (en) | Pawpaw seed germination accelerating method | |
| KR20140122533A (en) | Mass propagation method for adventitious root of Astragali Radix containing the increased amount of Astragaloside IV | |
| CN107278657A (en) | Suppress the method for Momordica grosvenori CAS gene expressions | |
| CN108040792A (en) | A kind of implantation methods of good quality and high output peanut | |
| CN108752107B (en) | Medicament for improving moso bamboo yield and preparation method and use method thereof | |
| CN106688779A (en) | Sowing and seedling method of sweet osmanthus | |
| CN107258541A (en) | Promote the method for Momordica grosvenori UGT7 gene expressions | |
| CN113174360A (en) | Isolated culture method of ginseng stem cells | |
| Vardhini et al. | Influence of brassinosteroids on metabolites of Raphanus Sativus L. | |
| CN107318654A (en) | Promote the method for Momordica grosvenori CS gene expressions | |
| CN108017421A (en) | A kind of seedbed of stem of noble dendrobium polyploid and preparation method thereof | |
| CN107018850A (en) | A kind of implantation methods of pine tree | |
| KR20070066461A (en) | Method of producing a plant growth activator for the cultivation of sprout seed plants as a property of chlorella culture by diluting and diluting nutrients expressed in seeds | |
| CN106804322A (en) | A kind of cutting processing method of lavender cuttage and seedling culture | |
| CN107232064A (en) | Promote the method for Momordica grosvenori CYP23 gene expressions | |
| CN106386172A (en) | Method for cultivating high-yield high-quality Lentinus edodes having sweet-scented osmanthus fragrance | |
| CN107360971A (en) | Promote the method for Momordica grosvenori SS gene expressions | |
| CN107278899A (en) | Promote the method for Momordica grosvenori UGT6 gene expressions | |
| CN107227290A (en) | Promote the method for Momordica grosvenori CYP81Q67 gene expressions | |
| CN107295971A (en) | Promote the method for Momordica grosvenori CYP4 gene expressions | |
| CN107360877A (en) | Promote the method for Momordica grosvenori CYP26 gene expressions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WW01 | Invention patent application withdrawn after publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20171024 |