CN107258542A - Promote the method for Momordica grosvenori CYP749A36 gene expressions - Google Patents
Promote the method for Momordica grosvenori CYP749A36 gene expressions Download PDFInfo
- Publication number
- CN107258542A CN107258542A CN201710630089.3A CN201710630089A CN107258542A CN 107258542 A CN107258542 A CN 107258542A CN 201710630089 A CN201710630089 A CN 201710630089A CN 107258542 A CN107258542 A CN 107258542A
- Authority
- CN
- China
- Prior art keywords
- cyp749a36
- momordica grosvenori
- gene expressions
- methyl jasmonate
- promote
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/008—Methods for regeneration to complete plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G7/00—Botany in general
- A01G7/06—Treatment of growing trees or plants, e.g. for preventing decay of wood, for tingeing flowers or wood, for prolonging the life of plants
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H4/00—Plant reproduction by tissue culture techniques ; Tissue culture techniques therefor
- A01H4/001—Culture apparatus for tissue culture
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/0018—Culture media for cell or tissue culture
- C12N5/0025—Culture media for plant cell or plant tissue culture
Abstract
The invention discloses a kind of method of promotion Momordica grosvenori CYP749A36 gene expressions, Luohanguo With Plantlets of Tissue Culture is inoculated in Fiber differentiation at least 30 days in inducing culture, wherein, the concentration of methyl jasmonate is 50 400 μm of ol/L in inducing culture.The method of the present invention has the accumulation for promoting the expression of Momordica grosvenori CYP749A36 genes with momordica glycoside V content.
Description
Technical field
The present invention relates to plant biotechnology field.It is more particularly related to which a kind of promote Momordica grosvenori
The method of CYP749A36 gene expressions.
Background technology
Momordica glycoside V belongs to cucurbitane type tetracyclic triterpenes material, and this seminar early stage is according to Momordica grosvenori transcript profile number
According to having derived the possible biosynthesis pathways of sweet tea glycosides V.The precursor substance of momordica glycoside V biosynthesis is the phosphorus of iso-amylene two
Base pyrophosphoric acid (DMAPP) in sour (IPP) and 3,3- dimethyl alkene, the two is by mevalonic acid (MVA) and methylerythritol
Two approach of phosphorylation (MEP) are formed, and MVA approach occurs in kytoplasm, and MEP approach occurs in plastid.From above-mentioned two
The IPP or DMAPP of approach form Mang ox base pyrophosphoric acid (GPP), IPP and GPP through Mang ox base pyrophosphate synthase (GPS) catalysis
Under farnesyl pyrophosphate synthase (FPS) catalytic action so formed farnesyl pyrophosphate (FPP), then through squalene synthase
(SS), the catalysis of squalene epoxidase (SE) forms 2,3- oxidosqualenes, and cucurbit dienol synthase (CS) is further catalyzed
Cucurbit dienol is formed, finally in the presence of CYP450 enzymes and glucosyltransferase, momordica glycoside V is formed.
The generation of isoprenoid material is considered as on its biosynthesis way always by the strict regulation and control of speed limit enzymatic activity
Important regulating and controlling effect is played in footpath.As the rate-limiting enzyme in isoprene approach, the expression of CYP450 enzyme genes is to Momordica grosvenori
Sweet tea glycosides V biosynthesis plays decisive role.CYP450 enzyme genes are overexpressed, the accumulation of momordica glycoside V can be promoted;Phase
Instead, if suppressing the expression of CYP450 enzyme genes, the yield of momordica glycoside V will be significantly reduced.However, CYP450 enzyme genes are
The route of synthesis of individual supergene family, the early-stage Study discovery of this seminar, Momordica grosvenori CYP749A36 genes and momordica glycoside V
There is certain association.Promotion Momordica grosvenori CYP749A36 gene expressions are there are no in the prior art to improve sweet tea glycosides V content in Momordica grosvenori
Report.
The content of the invention
It is an object of the invention to solve at least the above, and provide the advantage that at least will be described later.
It is a still further object of the present invention to provide one kind by methyl jasmonate treatment Luohanguo With Plantlets of Tissue Culture or its fruit come
Promote the method for Momordica grosvenori CYP749A36 gene expressions, foundation stone is established to effectively facilitate sweet tea glycosides V content accumulation in Momordica grosvenori.
It is a still further object of the present invention to provide one kind by being handled with pollen into one the processing of Luohanguo With Plantlets of Tissue Culture root system
The method that step promotes Momordica grosvenori CYP749A36 gene expressions to improve momordica glycoside V content.
Momordica grosvenori CYP749A36 is promoted there is provided one kind according to object of the present invention and further advantage in order to realize
The method of gene expression, Fiber differentiation at least 30 days in inducing culture are inoculated in by Luohanguo With Plantlets of Tissue Culture, wherein, Fiber differentiation
The concentration of methyl jasmonate is 50-400 μm of ol/L in base.
Preferably, also wrapped in the method for described promotion Momordica grosvenori CYP749A36 gene expressions, the inducing culture
Basal medium is included, its formula is:MS+1.5mg/L 6-BA+0.3mg/L IBA+3.5g/L agar+30g/l sucrose+1.0g/L
Activated carbon.
Preferably, the method for described promotion Momordica grosvenori CYP749A36 gene expressions, the condition of the Fiber differentiation
For:Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/d, 23 ± 2 DEG C of temperature.
Preferably, the method for described promotion Momordica grosvenori CYP749A36 gene expressions, the compound method of inducing culture
It is as follows:Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%, 10000 μm of ol/L jasmonic first is configured to
Ester mother liquor, and sterilized with 0.22 μm of miillpore filter, the methyl jasmonate mother liquor after sterilizing is added in basal medium, extremely
Methyl jasmonate concentration is 50-400 μm of ol/L, sterilizes and is cooled to 24-26 DEG C.
Preferably, jasmine in the method for described promotion Momordica grosvenori CYP749A36 gene expressions, the inducing culture
The concentration of sour methyl esters is 300-350 μm of ol/L.
Preferably, the method for described promotion Momordica grosvenori CYP749A36 gene expressions, by the Momordica grosvenori through Fiber differentiation
It is early, middle and late daily to be dripped in Momordica grosvenori surface sprinkling induction liquid to surface 20-30 days after pollinating after tissue culture transplantation of seedlings, even
Contain the methyl jasmonate that concentration is 50-400 μm of ol/L in continuous sprinkling 5 days, the induction liquid.
Preferably, concentration is contained in the method for described promotion Momordica grosvenori CYP749A36 gene expressions, the induction liquid
For 200-250 μm of ol/L methyl jasmonate.
Preferably, also wrapped in the method for described promotion Momordica grosvenori CYP749A36 gene expressions, the inducing culture
The golden lactone of the plain sterol of 0.35mg/L rapes and the only angles of 0.02mg/L is included.
Preferably, the method for described promotion Momordica grosvenori CYP749A36 gene expressions, the tissue-cultured seedling is through the induction
Handled before culture by root, the root processing is specifically included:
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy use sterile knife
2-3 wound is drawn respectively, and wound depth is less than 0.2mm, then the corn stigma handled with process pre-soaking coats the root system of tissue-cultured seedling,
Continuously intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment in 100-200 gauss magnetic fields
1h;
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in
5min is stored at 25 DEG C;
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion of 30-40 DEG C of water temperature
Handle 15min, the nano zine oxide containing 1mg/L in the pre-soaking solution, 3g/L citric acids, 4 μ g/L root of Chinese trichosanthes,
0.25g/L glucomannans, using magnetized water as solvent.
Preferably, the method for described promotion Momordica grosvenori CYP749A36 gene expressions, after Luohanguo With Plantlets of Tissue Culture is transplanted,
The flower on 2-3 grades of lateral bines of staminiferous plant is won in full-bloom stage 6-7 in morning points, pollen is taken, pollen is first placed in pollen soak and used
Frequency is stir process 2h in 3KHz ultrasonic oscillator, then after 400 mesh filtered through gauze, by gauze together with the upper thing of filter
Divide and be placed in water glass with cover, cover provided with passage, glassware with cover is placed in 40 DEG C of perseverances together with pollen
8h is dried in warm drying machine, sealed storage is drawn off being placed in the ring that relative humidity is 85-90% in standby at 4 DEG C before pollination
Moisture absorption 24h in border;
Wherein, the plain sterol of the honey containing 30g/L, 0.30mg/L rapes, 0.05mg/L regard Huang in the pollen soak
The golden lactone in the only angle of acid, 0.01mg/L, solvent is magnetized water.
The method of the promotion Momordica grosvenori CYP749A36 gene expressions of the present invention is simple to operate, and cost is low, environmentally friendly,
Suitable for large-scale production, with stronger practicality and promotional value, at least including following beneficial effect:
1) present invention before Luohanguo With Plantlets of Tissue Culture transplanting by being used the Fiber differentiation containing methyl jasmonate to it
Fiber differentiation in base, it is long-term interior to stimulate and induce the expression of CYP749A36 genes in Momordica grosvenori, so as to promote CYP450 enzyme bases
Because being overexpressed, promote the biosynthesis of momordica glycoside V, improve its yield;
2) present invention is by the way that after Luohanguo With Plantlets of Tissue Culture is transplanted, luring containing methyl jasmonate is used in 20-30d after pollination
Drain processing Momordica grosvenori surface, further stimulates and induces the expression of CYP749A36 genes in Momordica grosvenori, so as to promote in a short time
Enter to promote the biosynthesis of momordica glycoside V;
3) present invention is by the golden lactone of the plain sterol of rape of addition Sq and only angle in inducing culture, with jasmonic
Methyl esters plays coordinative role, and further induction stimulates Luohanguo With Plantlets of Tissue Culture to express CYP749A36 genes;
4) present invention is by the way that to carrying out root system processing before Luohanguo With Plantlets of Tissue Culture Fiber differentiation, to remove weak, scratching stimulates
Qiang Gen, and combination is handled with continuous intermittent warming and magnetic field, stimulate and coerce sweet tea glycosides V biosynthesis in Luohanguo With Plantlets of Tissue Culture fruit
Key gene CYP749A36 high expression in approach, so as to further improve the content of momordica glycoside V;
5) present invention is fully sent out by being handled using pollen soak combination sonic oscillation the staminiferous plant pollen for pollination
Wave the effect of main component in pollen soak, wherein the cavitation of honey, magnetized water combination ultrasonic wave is by pollen soak
In the plain sterol of rape, the golden lactone of retinoic acid and only angle fully wrap up staminiferous plant pollen, induced strong simultaneously regulates and controls Momordica grosvenori female plant and awarded
Enzyme gene CYP749A36 height expression after powder, promotes the accumulation of CYP749A36 gene expression amounts, so as to promote CYP450 enzyme genes high
Expression, improves momordica glycoside V content.
Further advantage, target and the feature of the present invention embodies part by following explanation, and part will also be by this
The research and practice of invention and be understood by the person skilled in the art.
Embodiment
With reference to specific embodiment, the present invention is described in further detail, to make those skilled in the art's reference say
Bright book word can be implemented according to this.
It should be noted that experimental method described in following embodiments, is conventional method unless otherwise specified, institute
Reagent and material are stated, unless otherwise specified, is commercially obtained.
Obtained it should be noted that Luohanguo With Plantlets of Tissue Culture as described herein is conventional tissue culture method.6-BA is 6- benzyl amino
Adenine, IBA is indolebutyric acid.
Embodiment 1:
A kind of method of promotion Momordica grosvenori CYP749A36 gene expressions, inducing culture is inoculated in by Luohanguo With Plantlets of Tissue Culture
Middle Fiber differentiation at least 30 days, wherein, the concentration of methyl jasmonate is 50 μm of ol/L in inducing culture.
Wherein, basal medium is also included in the inducing culture, its formula is:MS+1.5mg/L 6-BA+0.3mg/
L IBA+3.5g/L agar+30g/l sucrose+1.0g/L activated carbons.
Wherein, the condition of the Fiber differentiation is:Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/
23 ± 2 DEG C of d, temperature.
The compound method of inducing culture is as follows:Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%,
10000 μm of ol/L methyl jasmonate mother liquor is configured to, and is sterilized with 0.22 μm of miillpore filter, by the jasmonic first after sterilizing
Ester mother liquor is added in basal medium, is 50 μm of ol/L to methyl jasmonate concentration, sterilizes and is cooled to 24-26 DEG C.
Embodiment 2:
A kind of method of promotion Momordica grosvenori CYP749A36 gene expressions, inducing culture is inoculated in by Luohanguo With Plantlets of Tissue Culture
Middle Fiber differentiation at least 30 days, wherein, the concentration of methyl jasmonate is 400 μm of ol/L in inducing culture.
Wherein, basal medium is also included in the inducing culture, its formula is:MS+1.5mg/L 6-BA+0.3mg/
L IBA+3.5g/L agar+30g/l sucrose+1.0g/L activated carbons.
Wherein, the condition of the Fiber differentiation is:Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/
23 ± 2 DEG C of d, temperature.
The compound method of inducing culture is as follows:Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%,
10000 μm of ol/L methyl jasmonate mother liquor is configured to, and is sterilized with 0.22 μm of miillpore filter, by the jasmonic first after sterilizing
Ester mother liquor is added in basal medium, is 400 μm of ol/L to methyl jasmonate concentration, sterilizes and is cooled to 24-26 DEG C.
Embodiment 3:
A kind of method of promotion Momordica grosvenori CYP749A36 gene expressions, inducing culture is inoculated in by Luohanguo With Plantlets of Tissue Culture
Middle Fiber differentiation 30 days, wherein, the concentration of methyl jasmonate is 350 μm of ol/L in inducing culture.
Wherein, basal medium is also included in the inducing culture, its formula is:MS+1.5mg/L 6-BA+0.3mg/
L IBA+3.5g/L agar+30g/l sucrose+1.0g/L activated carbons.
Wherein, the condition of the Fiber differentiation is:Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/
23 ± 2 DEG C of d, temperature.
The compound method of inducing culture is as follows:Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%,
10000 μm of ol/L methyl jasmonate mother liquor is configured to, and is sterilized with 0.22 μm of miillpore filter, by the jasmonic first after sterilizing
Ester mother liquor is added in basal medium, is 350 μm of ol/L to methyl jasmonate concentration, sterilizes and is cooled to 24-26 DEG C.
Embodiment 4:
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP749A36 gene expressions will be trained through induction
It is early, middle and late daily in Momordica grosvenori surface sprinkling induction liquid to table 20-30 days after pollinating after foster Luohanguo With Plantlets of Tissue Culture is transplanted
Face is dripped, continuous sprinkling 5 days, contains the methyl jasmonate that concentration is 50 μm of ol/L in the induction liquid.
Embodiment 5:
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP749A36 gene expressions will be trained through induction
It is early, middle and late daily in Momordica grosvenori surface sprinkling induction liquid to table 20-30 days after pollinating after foster Luohanguo With Plantlets of Tissue Culture is transplanted
Face is dripped, continuous sprinkling 5 days, contains the methyl jasmonate that concentration is 400 μm of ol/L in the induction liquid.
Embodiment 6:
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP749A36 gene expressions will be trained through induction
It is early, middle and late daily in Momordica grosvenori surface sprinkling induction liquid to table 20-30 days after pollinating after foster Luohanguo With Plantlets of Tissue Culture is transplanted
Face is dripped, continuous sprinkling 5 days, contains the methyl jasmonate that concentration is 250 μm of ol/L in the induction liquid.
Embodiment 7:
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP749A36 gene expressions, the induction training
Support and also include the golden lactone of the plain sterol of 0.35mg/L rapes and the only angles of 0.02mg/L in base.
Embodiment 8:
On the basis of embodiment 6, the described method for promoting Momordica grosvenori CYP749A36 gene expressions, the induction training
Support and also include the golden lactone of the plain sterol of 0.35mg/L rapes and the only angles of 0.02mg/L in base.
Embodiment 9:
On the basis of embodiment 3, the described method for promoting Momordica grosvenori CYP749A36 gene expressions, the tissue-cultured seedling
Through being handled before the Fiber differentiation by root, the root processing is specifically included:
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy use sterile knife
2-3 wound is drawn respectively, and wound depth is less than 0.2mm, then the corn stigma handled with process pre-soaking coats the root system of tissue-cultured seedling,
Continuously intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment in 100-200 gauss magnetic fields
1h;
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in
5min is stored at 25 DEG C;
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion of 30-40 DEG C of water temperature
Handle 15min, the nano zine oxide containing 1mg/L in the pre-soaking solution, 3g/L citric acids, 4 μ g/L root of Chinese trichosanthes,
0.25g/L glucomannans, using magnetized water as solvent.
Embodiment 10:
On the basis of embodiment 6, the described method for promoting Momordica grosvenori CYP749A36 gene expressions, the tissue-cultured seedling
Through being handled before the Fiber differentiation by root, the root processing is specifically included:
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy use sterile knife
2-3 wound is drawn respectively, and wound depth is less than 0.2mm, then the corn stigma handled with process pre-soaking coats the root system of tissue-cultured seedling,
Continuously intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment in 100-200 gauss magnetic fields
1h;
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in
5min is stored at 25 DEG C;
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion of 30-40 DEG C of water temperature
Handle 15min, the nano zine oxide containing 1mg/L in the pre-soaking solution, 3g/L citric acids, 4 μ g/L root of Chinese trichosanthes,
0.35g/L glucomannans, using magnetized water as solvent.
Embodiment 11:
On the basis of embodiment 8, the described method for promoting Momordica grosvenori CYP749A36 gene expressions, the tissue-cultured seedling
Through being handled before the Fiber differentiation by root, the root processing is specifically included:
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy use sterile knife
2-3 wound is drawn respectively, and wound depth is less than 0.2mm, then the corn stigma handled with process pre-soaking coats the root system of tissue-cultured seedling,
Continuously intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment in 100-200 gauss magnetic fields
1h;
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in
5min is stored at 25 DEG C;
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion of 30-40 DEG C of water temperature
Handle 15min, the nano zine oxide containing 1mg/L in the pre-soaking solution, 3g/L citric acids, 4 μ g/L root of Chinese trichosanthes,
0.25g/L glucomannans, using magnetized water as solvent.
Embodiment 12:
On the basis of embodiment 6, the described method for promoting Momordica grosvenori CYP749A36 gene expressions, Momordica grosvenori tissue culture
After transplantation of seedlings, the flower on 2-3 grades of lateral bines of staminiferous plant is won in full-bloom stage 6-7 in morning points, pollen is taken, pollen is first placed in pollen leaching
Stir process 2h in the ultrasonic oscillator for being 3KHz with frequency in liquid is steeped, then after 400 mesh filtered through gauze, by gauze together with filter
Upper thing is divided together to be placed in water glass with cover, is covered provided with passage, and glassware with cover is put together with pollen
8h is dried in 40 DEG C of freeze-day with constant temperature machines, sealed storage is drawn off being placed in relative humidity for 85- in standby at 4 DEG C before pollination
Moisture absorption 24h in 90% environment;
Wherein, the plain sterol of the honey containing 30g/L, 0.30mg/L rapes, 0.05mg/L regard Huang in the pollen soak
The golden lactone in the only angle of acid, 0.01mg/L, solvent is magnetized water.
Embodiment 13:
On the basis of embodiment 11, the described method for promoting Momordica grosvenori CYP749A36 gene expressions, Momordica grosvenori tissue culture
After transplantation of seedlings, the flower on 2-3 grades of lateral bines of staminiferous plant is won in full-bloom stage 6-7 in morning points, pollen is taken, pollen is first placed in pollen leaching
Stir process 2h in the ultrasonic oscillator for being 3KHz with frequency in liquid is steeped, then after 400 mesh filtered through gauze, by gauze together with filter
Upper thing is divided together to be placed in water glass with cover, is covered provided with passage, and glassware with cover is put together with pollen
8h is dried in 40 DEG C of freeze-day with constant temperature machines, sealed storage is drawn off being placed in relative humidity for 85- in standby at 4 DEG C before pollination
Moisture absorption 24h in 90% environment;
Wherein, the plain sterol of the honey containing 30g/L, 0.30mg/L rapes, 0.05mg/L regard Huang in the pollen soak
The golden lactone in the only angle of acid, 0.01mg/L, solvent is magnetized water.
In order to illustrate the technique effect of the present invention, applicant of the present invention is directed to the arhat that distinct methods or embodiment are obtained
Fruits, are measured, specific method and result are as follows for CYP749A36 gene expression amounts and sweet tea glycosides V content.
1st, CYP749A36 gene expressions quantity measuring method:Using ABI7500 real-time fluorescence quantitative PCR instrument, using qRT-
PCR detects the expression of CYP749A36 genes.
Step 1: sample pre-treatments:Lo Han Guo fruit is gathered, picking pulp is cut into 2-4mm fritters and uses masking foil respectively
Wrap, be immediately placed on it is quick-frozen in liquid nitrogen, be stored in -80 DEG C it is standby.
Step 2: first extracting Lo Han Guo fruit total serum IgE using improved Trizol method;
Step 3: the reaction system for being cDNA by RNA reverse transcriptions is μ L, the PrimeScript RT Enzyme of RNA 10.0
μ L, the RNase Free dH of 1.0 μ L, RT Primer Mix of Mix I, 1.0 μ L, 5 × PrimeScript Buffer 2 4.02O
4.0μL;Reaction condition is 37 DEG C of (15min) → 85 DEG C (5s) → 4 DEG C;
Step 4: using the software Design primers of Primer Premier 5.0, being had by raw work bioengineering (Shanghai) share
Limit company synthesizes, wherein, CYP749A36 primer sequences are:
FP:GATAAGAATGCGGCCGCATGGTTGGTATGAGAATCTACG,
RP:CGAGCTCTTATGGCTTGTGGTGAGACAATG;
Reference gene UBQ5, sequence is FP:ATAAAAGACCCAGCACCACATTC, RP:
CCCTTGCCGACTACAACATCC;
Step 5: qRT-PCR reaction systems (20 μ L) are SYBR Premix Ex Taq II (Tli RNaseH Plus)
(2 ×) 10.0 μ L, PCR Forward Primer (10 μM) 0.8 μ L, PCR Reverse Primer (10 μM) 0.8 μ L, ROX
Reference Dye of Dye II (50 ×) 0.4 μ L, Template 2.0 μ L, dH2O 6.0μL;Reaction condition is 95 DEG C
(30s), then carries out 40 cycles [95 DEG C (5s), 95 DEG C (34s)].
2nd, momordica glycoside V content:Using high performance liquid chromatography, specific method reference《Colleges Of Traditional Chinese Medicine Of Guangxi's journal》The
" HPLC determines the content of momordica glycoside V in Momordica grosvenori " one text delivered on 04 phase in 2007.
Comparative example 1:In the method for embodiment 1-3 promotion Momordica grosvenori CYP749A36 gene expressions, by inducing culture
The concentration of methyl jasmonate is set as successively:0th, 100,150,200,250,300,350,400 μm of ol/L, comparative study is in induction
Incubation time be 30 days when inducing culture in methyl jasmonate concentration to Momordica grosvenori CYP749A36 gene expression amounts and sweet tea glycosides
The influence of V content (mass percent), the results are shown in Table 1.
Methyl jasmonate concentration is to Momordica grosvenori CYP749A36 gene expression amounts and sweet tea glycosides V content in the inducing culture of table 1
Influence
The concentration μm ol/L of methyl jasmonate | 0 | 100 | 150 | 200 | 250 | 300 | 350 | 400 |
CYP749A36 gene expression amounts | 1 | 4.4 | 7.3 | 9.9 | 12.3 | 14.4 | 15.3 | 14.2 |
Sweet tea glycosides V content/(w/w%) | 0.75 | 1.26 | 1.52 | 1.77 | 1.98 | 2.20 | 2.31 | 2.16 |
Note:The Lo Han Guo fruit CYP749A36 gene expression amounts of different methyl jasmonate concentration processing in inducing culture
It 1 is reference to be with the Lo Han Guo fruit CYP749A36 gene expression amounts obtained without methyl jasmonate concentration processing method;It is above-mentioned
Experimental data is the Momordica grosvenori obtained on 20 Momordica grosvenori fruit trees that each above-mentioned embodiment is obtained in optionally wherein 5
Fruit carries out what parallel test was obtained.
As shown in Table 1, Lo Han Guo fruit CYP749A36 can be effectively facilitated by methyl jasmonate being added in inducing culture
The expression of gene, and using during 300-350 μm of ol/L as optimum concentration.
Comparative example 2:In the method for embodiment 4-6 promotion Momordica grosvenori CYP749A36 gene expressions, by jasmine in induction liquid
The concentration of sour methyl esters is set as successively:0th, 100 jasmine in, 150,200,250,300,350,400 μm of ol/L, comparative study induction liquid
Influence of the concentration of jasmine acid methyl esters to Momordica grosvenori CYP749A36 gene expression amounts and sweet tea glycosides V content, the results are shown in Table 2.
Influence of the methyl jasmonate concentration to Momordica grosvenori CYP749A36 gene expression amounts and sweet tea glycosides V content in the induction liquid of table 2
The concentration μm ol/L of methyl jasmonate | 0 | 100 | 150 | 200 | 250 | 300 | 350 | 400 |
CYP749A36 gene expression amounts | 15.3 | 16.1 | 16.7 | 17.1 | 17.3 | 16.9 | 16.7 | 16.4 |
Sweet tea glycosides V content/(w/w%) | 2.31 | 2.40 | 2.45 | 2.49 | 2.51 | 2.47 | 2.44 | 2.43 |
Note:The Lo Han Guo fruit CYP749A36 gene expression amounts of different methyl jasmonate concentration processing in inducing culture
It 1 is reference to be with the Lo Han Guo fruit CYP749A36 gene expression amounts obtained without methyl jasmonate concentration processing method;It is above-mentioned
Experimental data is the Momordica grosvenori obtained on 20 Momordica grosvenori fruit trees that each above-mentioned embodiment is obtained in optionally wherein 5
Fruit carries out what parallel test was obtained.
As shown in Table 2, methyl jasmonate is added in induction liquid, in Momordica grosvenori nursery stock 20-30 days after pollinating, daily
It is early, middle and late further to effectively facilitate the expression of Lo Han Guo fruit CYP749A36 genes in the sprinkling of Momordica grosvenori surface, and with
It is optimum concentration to induce when methyl jasmonate concentration is 200-250 μm of ol/L in liquid.
Comparative example 3:Comparative example 3, embodiment 6, embodiment 7, embodiment 8, embodiment 9, embodiment 10, embodiment
11st, embodiment 12, the method for the promotion Momordica grosvenori CYP749A36 gene expressions of embodiment 13, determine Momordica grosvenori CYP749A36 bases
Because of expression quantity and sweet tea glycosides V content, 3 are the results are shown in Table.Control group is set as:On the basis of embodiment 3, by jasmine in inducing culture
Jasmine acid methyl acetate concentrations are set to 0 μm of ol/L, other be the same as Examples 3.
Not influence of the be the same as Example method to Momordica grosvenori CYP749A36 gene expression amounts and sweet tea glycosides V content of table 3
Note:The Lo Han Guo fruit CYP749A36 gene expression amounts of different methyl jasmonate concentration processing in inducing culture
It 1 is reference to be with the Lo Han Guo fruit CYP749A36 gene expression amounts obtained without methyl jasmonate concentration processing method;It is above-mentioned
Experimental data is the Momordica grosvenori obtained on 20 Momordica grosvenori fruit trees that each above-mentioned embodiment is obtained in optionally wherein 5
Fruit carries out what parallel test was obtained.
Embodiment 7 is on the basis of embodiment 3 and embodiment 6, to be added in inducing culture respectively with embodiment 8
The golden lactone of the plain sterol of appropriate rape and only angle, as can be seen from Table 3, embodiment 7 and embodiment 8 respectively relative embodiment 3 and
CYP749A36 gene expression amounts are substantially increased with sweet tea glycosides V content in the Lo Han Guo fruit that embodiment 6 is obtained;
Embodiment 9, embodiment 10, embodiment 11 be respectively on the basis of embodiment 3, embodiment 6 and embodiment 8, in
Tissue-cultured seedling is handled by root before Fiber differentiation, as can be seen from Table 3, embodiment 9, embodiment 10, embodiment 11 are distinguished
CYP749A36 gene expression amounts and sweet tea glycosides V content in the Lo Han Guo fruit obtained with respect to embodiment 3, embodiment 6 with embodiment 8
Dramatically increase.
Embodiment 12 is on the basis of embodiment 6 and embodiment 11, in transplanting before pollination, to sieve respectively with embodiment 13
Chinese fruit male flower pollen is handled, as can be seen from Table 3, and embodiment 12 is with embodiment 13 respectively with respect to embodiment 6 and embodiment
CYP749A36 gene expression amounts are dramatically increased with sweet tea glycosides V content in 11 obtained Lo Han Guo fruits.
Although embodiment of the present invention is disclosed as above, it is not restricted in specification and embodiment listed
With it can be applied to various suitable the field of the invention completely, can be easily for those skilled in the art
Other modification is realized, therefore under the universal limited without departing substantially from claim and equivalency range, the present invention is not limited
In specific details and shown here as the embodiment with description.
Claims (10)
1. a kind of method of promotion Momordica grosvenori CYP749A36 gene expressions, it is characterised in that Luohanguo With Plantlets of Tissue Culture is inoculated in and lured
Fiber differentiation at least 30 days in culture medium are led, wherein, the concentration of methyl jasmonate is 50-400 μm of ol/L in inducing culture.
2. promote the method for Momordica grosvenori CYP749A36 gene expressions as claimed in claim 1, it is characterised in that the induction
Also include basal medium in culture medium, its formula is:MS+1.5mg/L 6-BA+0.3mg/L IBA+3.5g/L agar+30g/
L sucrose+1.0g/L activated carbons.
3. promote the method for Momordica grosvenori CYP749A36 gene expressions as claimed in claim 2, it is characterised in that the induction
The condition of culture is:Relative humidity 60-66%, intensity of illumination 1400lux, light application time 8h/d, 23 ± 2 DEG C of temperature.
4. promote the method for Momordica grosvenori CYP749A36 gene expressions as claimed in claim 2, it is characterised in that Fiber differentiation
The compound method of base is as follows:Methyl jasmonate is dissolved in the ethanol water that volume fraction is 2%, 10000 μm of ol/ are configured to
L methyl jasmonate mother liquor, and sterilized with 0.22 μm of miillpore filter, the methyl jasmonate mother liquor after sterilizing is added to basis
It is 50-400 μm of ol/L to methyl jasmonate concentration in culture medium, sterilizes and be cooled to 24-26 DEG C.
5. promote the method for Momordica grosvenori CYP749A36 gene expressions as claimed in claim 1, it is characterised in that the induction
The concentration of methyl jasmonate is 300-350 μm of ol/L in culture medium.
6. promote the method for Momordica grosvenori CYP749A36 gene expressions as claimed in claim 1, it is characterised in that will be through induction
After the Luohanguo With Plantlets of Tissue Culture of culture is transplanted, 20-30 days after pollinating, the sprinkling in Momordica grosvenori surface early, middle and late daily induces liquid extremely
Surface is dripped, continuous sprinkling 5 days, contains the methyl jasmonate that concentration is 50-400 μm of ol/L in the induction liquid.
7. promote the method for Momordica grosvenori CYP749A36 gene expressions as claimed in claim 6, it is characterised in that the induction
Contain the methyl jasmonate that concentration is 200-250 μm of ol/L in liquid.
8. the method for the promotion Momordica grosvenori CYP749A36 gene expressions as described in claim 5 or 6, it is characterised in that described to lure
Lead and also include the golden lactone of the plain sterol of 0.35mg/L rapes and the only angles of 0.02mg/L in culture medium.
9. promote the method for Momordica grosvenori CYP749A36 gene expressions as claimed in claim 1, it is characterised in that the tissue culture
Handled before Fiber differentiation described in Miao Jing by root, the root processing is specifically included:
Root length in tissue-cultured seedling root system is less than into short of most long root length 1/4 to wipe out, then by 2-3 bars sturdy distinguished with sterile knife
2-3 wound is drawn, wound depth is less than 0.2mm, then the root system of tissue-cultured seedling is coated with the corn stigma handled by pre-soaking, continuously
Intermittent warming 10-12 times, then the corn stigma on tissue-cultured seedling is removed, be placed in magnetization treatment 1h in 100-200 gauss magnetic fields;
Each intermittent warming is root system is coated with into the tissue-cultured seedling of corn stigma to be first placed at 2 DEG C to store 1min, then is placed in 25 DEG C
Lower storage 5min;
The pre-soaking processing refers to by corn stigma after clean dry, in the pre-soaking solution immersion treatment of 30-40 DEG C of water temperature
Nano zine oxide containing 1mg/L, 3g/L citric acids, 4 μ g/L root of Chinese trichosanthes, 0.25g/L in 15min, the pre-soaking solution
Glucomannans, using magnetized water as solvent.
10. promote the method for Momordica grosvenori CYP749A36 gene expressions as claimed in claim 6, it is characterised in that Momordica grosvenori group
Train after transplantation of seedlings, win the flower on 2-3 grades of lateral bines of staminiferous plant in full-bloom stage 6-7 in morning points, take pollen, pollen is first placed in pollen
Stir process 2h in the ultrasonic oscillator for being 3KHz with frequency in soak, then after 400 mesh filtered through gauze, by gauze together with
Thing is divided be placed in water glass with cover together in filter, covers provided with passage, by glassware with cover together with pollen
Be placed in 40 DEG C of freeze-day with constant temperature machines and dry 8h, sealed storage in standby at 4 DEG C, be drawn off being placed in relative humidity before pollination be
Moisture absorption 24h in 85-90% environment;
Wherein, the plain sterol of the honey containing 30g/L in the pollen soak, 0.30mg/L rapes, 0.05mg/L retinoic acids,
The golden lactone in the only angles of 0.01mg/L, solvent is magnetized water.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710630089.3A CN107258542A (en) | 2017-07-28 | 2017-07-28 | Promote the method for Momordica grosvenori CYP749A36 gene expressions |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710630089.3A CN107258542A (en) | 2017-07-28 | 2017-07-28 | Promote the method for Momordica grosvenori CYP749A36 gene expressions |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107258542A true CN107258542A (en) | 2017-10-20 |
Family
ID=60075093
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710630089.3A Pending CN107258542A (en) | 2017-07-28 | 2017-07-28 | Promote the method for Momordica grosvenori CYP749A36 gene expressions |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107258542A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102212552A (en) * | 2011-05-06 | 2011-10-12 | 西南大学 | Method for transforming genes by using efficient living body of chemical male sterilant |
CN106386511A (en) * | 2016-12-07 | 2017-02-15 | 广西壮族自治区药用植物园 | Rapid propagation method for suspension cell culture of Millettia speciosa Champ |
CN106577278A (en) * | 2016-12-07 | 2017-04-26 | 广西壮族自治区药用植物园 | Method for promoting polysaccharide accumulation of hairy roots of beautiful millettia roots |
CN106718920A (en) * | 2016-12-29 | 2017-05-31 | 广西壮族自治区药用植物园 | The method for improving momordica glycoside V content |
-
2017
- 2017-07-28 CN CN201710630089.3A patent/CN107258542A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN102212552A (en) * | 2011-05-06 | 2011-10-12 | 西南大学 | Method for transforming genes by using efficient living body of chemical male sterilant |
CN106386511A (en) * | 2016-12-07 | 2017-02-15 | 广西壮族自治区药用植物园 | Rapid propagation method for suspension cell culture of Millettia speciosa Champ |
CN106577278A (en) * | 2016-12-07 | 2017-04-26 | 广西壮族自治区药用植物园 | Method for promoting polysaccharide accumulation of hairy roots of beautiful millettia roots |
CN106718920A (en) * | 2016-12-29 | 2017-05-31 | 广西壮族自治区药用植物园 | The method for improving momordica glycoside V content |
Non-Patent Citations (2)
Title |
---|
李向辉等: "《植物遗传操作》", 31 August 1994, 高等教育出版社 * |
许智宏等: "《植物激素作用的分子机理》", 31 October 2012, 上海科学技术出版社 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103651121B (en) | A kind of bletilla differentiation, strong seedling culture base | |
CN104920227A (en) | Stem cell tissue culture seedling raising technique | |
CN104429950B (en) | Phalaenopsis Blume culture medium and cultural method | |
CN106613986B (en) | The method for improving mogroside Ⅲ content | |
CN104206417A (en) | Method for promoting paeonia suffruticosa seedling growth and application thereof | |
CN106797974A (en) | The method for improving Simon glycosides I contents in Momordica grosvenori | |
CN107227290A (en) | Promote the method for Momordica grosvenori CYP81Q67 gene expressions | |
CN106613987B (en) | The method for improving mogroside ⅡE content | |
CN107258541A (en) | Promote the method for Momordica grosvenori UGT7 gene expressions | |
CN102994544A (en) | Method for cultivating transgenetic gloxinia plant through agrobacterium-mediated transformation | |
CN107258542A (en) | Promote the method for Momordica grosvenori CYP749A36 gene expressions | |
CN103766039A (en) | Method for breaking dormancy of nervilis fordii schlecht bulb | |
CN107223568A (en) | Promote the method for Momordica grosvenori CYP89A143 gene expressions | |
CN106688769A (en) | Cutting treatment method for cutting seedling of maidenhair trees | |
CN107278900A (en) | Promote the method for Momordica grosvenori CYP87D18 gene expressions | |
CN107306792A (en) | Promote the method for Momordica grosvenori CYP87D17 gene expressions | |
WO2023155855A1 (en) | Application of 2-amino-3-indole butyric acid in promoting plant growth | |
CN107360877A (en) | Promote the method for Momordica grosvenori CYP26 gene expressions | |
CN107295971A (en) | Promote the method for Momordica grosvenori CYP4 gene expressions | |
CN107278658A (en) | Promote the method for Momordica grosvenori UGT1 gene expressions | |
CN107278657A (en) | Suppress the method for Momordica grosvenori CAS gene expressions | |
CN107318654A (en) | Promote the method for Momordica grosvenori CS gene expressions | |
CN107232063A (en) | Promote the method for Momordica grosvenori CYP24 gene expressions | |
CN107232064A (en) | Promote the method for Momordica grosvenori CYP23 gene expressions | |
CN107318652A (en) | Promote the method for Momordica grosvenori HMGR gene expressions |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171020 |
|
RJ01 | Rejection of invention patent application after publication |