CN107200773A - Come from pathogenic gene MoSNT2 of Pyricularia oryzae and application thereof - Google Patents

Abstract

The invention discloses a kind of pathogenicity proteins MoSNT2 for coming from Pyricularia oryzae, the albumen is by SEQ ID No:Amino acid sequence composition shown in 1；The invention also discloses the gene M oSNT2 for encoding the pathogenicity proteins, the gene is by SEQ ID No:Nucleotide sequence composition shown in 2.The purposes in design or screening antifungal drug target is used as the invention also discloses said gene or albumen.The present invention provides an important target gene or target proteinses for the preventing and treating of rice blast.The medicine developed using the gene or albumen as target, can destroy gene expression or the protein function of rice warm disease bacterium, can efficiently control the pathogenic and popularity of Pyricularia oryzae.

Description

Come from pathogenic gene MoSNT2 of Pyricularia oryzae and application thereof

Technical field

The invention belongs to microbiological genetic engineering field, and in particular to one come from Pyricularia oryzae pathogenic gene MoSNT2；Further relate to the purposes of the gene.

Background technology

Rice blast (also known as rice blast) is one of important disease of paddy rice, can cause the significantly underproduction, the underproduction 40% when serious ~50%, or even No kernels or seeds are gathered, as in a year of scarcity.Rice blast has generation in each rice region in the world, wherein occuring as many, especially fringe with leaf portion, section portion Neck pest or section pest occur early and weighed, and can cause dead ears so that total crop failure.The pathogen for causing rice blast is Pyricularia oryzae, belongs to half work Body parasitic fungi (Magnaporthe oryzae), it has the features such as biological strain is more, breeding variation is fast, popularity is strong, Huge is threatened to Rice Production.In order to ensure Rice Production safety, the effective way of rice blast is prevented and treated in the urgent need to finding.

Pyricularia oryzae is broadly divided into following several stages to the infection processs of host rice：Conidium adhesion host, spore Son sprouts germ tube and breaks up generation and infect organ appresorium, appresorium and produce and infects nail and penetrate plant epidermis, infect mycelia and exist Breed in plant tissue and secrete effect protein and suppress host immunity power, mycelia killing plant tissue formation necrotic plaque, formed and divided Raw sporophore simultaneously discharges conidium (Wilson etc., Nature Reviews Microbiology, 2009,7 (3):185- 195).Many genes play critical function during rice blast infects host rice, and regulation and control Pyricularia oryzae infects allelotaxis And mycelia propagation is infected, so as to determine the pathogenicity and infectivity of rice blast.Illustrate the molecule work(of these pathogenic related genes Can, it will help develop and utilize new rice blast preventing and treating target spot.

(Dean etc., 2005,434 (7036) such as Dean：980-986) complete the genome of Pyricularia oryzae 70-15 bacterial strains Sequencing.South Korea Seoul university constructs Pyricularia oryzae mutant library, and report 202 pathogenic genes (Jeon etc., Nature Genetics, 2007 (39)：561-565).China's researcher has carried out base to Pyricularia oryzae epidemic strains Because of group sequencing and understand, identify many genes related to rice blast bacterium pathogenicity, the transcription factor of these coded by said gene, Secretory effect protein, born of the same parents secrete regulatory factor etc., and vital effect is played during Pyricularia oryzae infects host rice (Dong etc., 2015, PLoS Pathogens 11 (4):e1004801).Domestic and foreign scholars have identified many pathogenic related genes (Yan etc., Current Opinion in Microbiology, 2016,34:147–153).These pathogenic genes are participated in Metabolism mainly include with signal path：B16 cell, aliphatic acid beta oxidation, Trehalose Metabolism, glyoxalic acid circulation, cell are certainly Bite, cell secretion, cAMP/PKA, G-protein, MAPK signal pathways etc..But, for these metabolism and signal pathway, at present may be used It is also extremely limited that the fungi utilized specifically prevents and treats target spot.

At present, the method for preventing and treating plant pathogenic fungi is mainly chemical prevention.Identify and parse the cause of plant pathogenic fungi Characteristic of disease gene, the especially functional gene related to invasion host's process, can provide important for design, screening antifungal drug Target site.The target spot of traditional antifungal drug mainly includes steroid in the related important enzyme of Cell wall synthesis, cell membrane (Yu Xinxu, 2013, Fujian such as the synthesis machine of the synthetic enzymes of the key components such as alcohol and sphingomyelins, Fungal Protein and nucleic acid Agricultural university master thesis；Liu Xiaohuan, Pharmaceutical Analysis magazine, 2015,35 (2)：193-202).Tricyclazole is widely used in Prevent and treat Pyricularia oryzae, it can destroy infect organ appresorium penetrate function, its action target is cell membrane B16 cell phase The three hydroxyl naphthalene reductases closed.Pyricularia oryzae easily makes a variation, breeds fast and strong adaptability, and single antifungal drug is used for a long time, easily makes The pathogen accumulation resistance to the action of a drug, causes preventive effect to decline.Therefore, using Protocols in Molecular Biology, clone and identification it is new in rice blast The Disease-causing gene of critical function is played in bacterium infection processs, important medicine can be provided with the new antifungal medicine of screening for design Target spot, this integrated control to rice blast has highly important theory significance and application value.

The content of the invention

Endanger serious for the rice blast that presently, there are, the problem of lacking effective prevention and controls, present invention aims at carry For a kind of pathogenicity proteins for coming from Pyricularia oryzae.

Another object of the present invention is the gene for providing the above-mentioned pathogenicity proteins of coding.The mycelia of the gene pairs Pyricularia oryzae Nutrient growth, conidium are produced and sprouted, note fields and pathogenic etc. all played an important role.

3rd purpose of the invention is to provide the expression vector containing said gene.

4th purpose of the invention is the purposes for providing above-mentioned pathogenicity proteins.

5th purpose of the invention is the purposes for providing said gene.

6th purpose of the invention is the purposes for providing above-mentioned expression vector.

To achieve the above object, technical scheme is as follows：

The invention provides a kind of pathogenicity proteins for coming from Pyricularia oryzae, MoSnt2, the amino of the albumen are named as Acid sequence is as follows：

(1), with SEQ ID No:Amino acid sequence shown in 1；

(2), by SEQ ID No:Addition, replacement of the amino acid sequence by one or several amino acid residues shown in 1 Or lack amino acid sequence formed and sexual function of being caused a disease with rice blast.

Present invention also offers the gene for encoding above-mentioned pathogenicity proteins, MoSNT2 is named as, the gene has as follows (a), the nucleotide sequence of (b) or (c)：

(a) there is SEQ ID No:Nucleotide sequence shown in 2；

(b) under high stringency conditions with SEQ ID No:The nucleotide sequence of nucleotide sequence complementation shown in 2；

(c) by SEQ ID No:Addition, missing or replacement institute of the nucleotide sequence Jing Guo one or several bases shown in 2 Formed and nucleotide sequence of the coding with rice blast pathogenicity proteins function.

Present invention also offers the expression vector containing said gene.

The application for designing or/and screening antifungal drug target is used as present invention also offers above-mentioned pathogenicity proteins.

The application for designing or/and screening antifungal drug target is used as present invention also offers said gene.

Fungi described in above-mentioned application refers to Pyricularia oryzae (Magnaporthe oryzae) etc..

Present invention also offers application of the above-mentioned expression vector on screening antifungal drug.

Fungi described in above-mentioned application refers to Pyricularia oryzae (Magnaporthe oryzae) etc..

The present invention has the advantage that and beneficial effect：The present invention provides an important target base for preventing and treating Pyricularia oryzae Cause or target proteinses.Rice blast pathogenicity proteins of the present invention are to the mycelia nutrient growth of Pyricularia oryzae, conidium generation and sprout Each growth and development stage such as hair, note fields, and it is pathogenic have a major impact, ground using the gene or albumen as target The medicine of system, can destroy gene expression or the protein function of rice warm disease bacterium, can efficiently control the pathogenic of Pyricularia oryzae and It is popular.

Brief description of the drawings

Fig. 1 different developmental phases MoSNT2 gene expression dose column diagrams；Wherein 1 is the raw vegetative hyphae of liquid；2 be mitogenetic Sporophore；3 be conidium；4 be the attachment spore of development 4 hours；5 be 8 hours attachment spores of development；6 adhere to for 12 hours for development Spore；7 be 16 hours attachment spores of development；8 be 20 hours attachment spores of development；9 be 24 hours attachment spores of development；10 be to be grown on paddy rice Leaf sheath infects mycelia；11 infect mycelia for infect rice leaf.

The building process schematic diagram of Fig. 2 .MoSNT2 knock out mutants bodies.

The PCR detection electrophoresis patterns of MoSNT2 knockout mutations bodies of Fig. 3 using P1 and P2 as primer；Wherein 1 is DNA molecular Amount standard；2 be △ Mosnt2.1；3 be △ Mosnt2.2；4 be △ Mosnt2.3；5 be △ Mosnt2.4；6 be △ Mosnt2.5； 7 be wild type Guy11.

The PCR detection electrophoresis patterns of MoSNT2 knockout mutations bodies of Fig. 4 using P3 and P4 as primer；Wherein 1 is DNA molecular Amount standard；2 be △ Mosnt2.1；3 be △ Mosnt2.2；4 be △ Mosnt2.3；5 be △ Mosnt2.4；6 be △ Mosnt2.5； 7 be wild type Guy11.

The southern hybridization collection of illustrative plates of Fig. 5 checking MoSNT2 knockout mutations bodies；Wherein 1 is Guy11；2 be △ Mosnt2.1；3 be △ Mosnt2.2；4 be △ Mosnt2.3；5 be △ Mosnt2.4；6 be △ Mosnt2.5.

The bacterium colony and aerial hyphae form photo on CM plating mediums such as Fig. 6 .MoSNT2 knockout mutations bodies；Wherein 1 For Guy11；2 be △ Mosnt2.1；3 be △ Mosnt2.2；4 be Compl..

The aerial hyphaes such as Fig. 7 .MoSNT2 knockout mutations bodies grow and production spore microphoto；Wherein 1 is Guy11；2 be △ Mosnt2.1；3 be △ Mosnt2.2；4 be Compl..

The sporulation quantity column diagrams such as Fig. 8 .MoSNT2 knockout mutations bodies；Wherein 1 is Guy11；2 be △ Mosnt2.1；3 be △ Mosnt2.2；4 be Compl..

The spore shape microphotos such as Fig. 9 .MoSNT2 knockout mutations bodies；Wherein 1 is Guy11；2 be △ Mosnt2.1；3 are △Mosnt2.2；4 be Compl..

The colonial morphology photo under cell wall inhibitors CFW stress such as Figure 10 .MoSNT2 knockout mutations bodies；Wherein 1 is Guy11；2 be △ Mosnt2.1；3 be △ Mosnt2.2；4 be Compl..

Figure 11 .MoSNT2 knockout mutations bodies etc. are in H₂O₂Colonial morphology photo under oxidative stress；Wherein 1 is Guy11；2 are △Mosnt2.1；3 be △ Mosnt2.2；4 be Compl..

Figure 12 .MoSNT2 knockout mutations bodies etc. infect the microphoto of the development of organ attachment spore；Wherein 1 is Guy11；2 For △ Mosnt2.1；3 be △ Mosnt2.2；4 be Compl..

The pathogenicity photo to host rice blade such as Figure 13 .MoSNT2 knockout mutations bodies；Wherein 1 is Guy11；2 be △ Mosnt2.1；3 be △ Mosnt2.2；4 be Compl.；5 be the blank control of inoculation sterile letheen block.

The pathogenicity photo to host rice root such as Figure 14 .MoSNT2 knockout mutations bodies；Wherein 1 is Guy11；2 be △ Mosnt2.1；3 be △ Mosnt2.2；4 be Compl.；5 be the blank control of inoculation sterile letheen block.

Embodiment

The present invention is further explained and illustrated below by embodiment, but protection scope of the present invention is not constituted Any limitation.Method therefor is conventional method unless otherwise instructed in following embodiments.

Embodiment 1：The separation of MoSNT2 genes and clone

(1) SNT2 albumen plays a significant role (Baker etc., Molecular in the oxidative stress answering of yeast And Cellular Biology, 2013, (33) 19:, but Unknown Function of the albumen in Pyricularia oryzae 3735-3748).Ferment There is certain similitude between the female and protein sequence of Pyricularia oryzae, therefore first from the genome database (http of yeast:// Www.yeastgenome.org/) site search obtains yeast SNT2 protein sequences, then using blastP in Pyricularia oryzae base Because a group database (http://www.broadinstitute.org/annotation/genome/magnaporthe_ grisea/MultiHome.html) middle progress homologous sequence search, therefrom obtain a Pyricularia oryzae prediction albumen MGG_ 04421, MoSnt2 is named as, the amino acid sequence of the albumen is shown in SEQ ID NO：1.

(2) clone of MoSNT2 genes：To clone MoSNT2 cDNA sequence, first by RNeasy Plant Mini Kit kits (Qiagen companies), extract total serum IgE from Pyricularia oryzae wild-type strain Guy11, then use SuperScript III Reverse Transcriptase kits (Invitrogen companies), total serum IgE reverse transcription is generated First chain cDNA, then using SNT2-cDNA-For and SNT2-cDNA-Rev as primer, use Phusion high-fidelity enzymes (Thermo Fisher companies) MoSNT2 gene coded sequences are cloned from the first chain cDNA, common 5382bp is finally connected to clone and carried Sequencing analysis are carried out on body pEASY-Blunt (Quan Shi King Companies), the clone of MoSNT2 genes is obtained；MoSNT2 gene orders are shown in SEQ ID NO：2.

The reaction system (50 μ l) of the PCR：The μ l (50ng) of Guy11 bacterial strains cDNA 0.5, Phusion archaeal dna polymerases 0.5 μ l (2U/ μ l), 5 × Phusion HF buffer 10 μ l, dNTP (25mmol/L, each) 1 μ l, sense primer (50 μ Mol/L) 0.5 μ l, anti-sense primer (50 μm of ol/L) 0.5 μ l, ddH₂O 37μl.PCR response procedures are：98℃30s；98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 3.5min, 35 circulations；72 DEG C of 10min, 4 DEG C of insulations.Described primer SNT2-cDNA-For (draws upstream Thing) and SNT2-cDNA-Rev (anti-sense primer) be：

SNT2-cDNA-For：5’-ATGGCTCAAAAGGGTTCAGGTG-3’(SEQ ID NO：3)；

SNT2-cDNA-Rev：5’-AGACAGTAGATTTCGCAACGAAG-3’(SEQ ID NO：4).

Embodiment 2：MoSNT2 genes are detected in the quantitative RT-PCR of different developmental phases expression

(1) about the preparation of culture medium and solution：

(1) CM fluid nutrient mediums：Its constituent and its ratio are：D-Glucose 10g, Peptone2g, Yeast Extract 1g, Casamino Acids 1g, 20 × Nitrate Salts^*50ml, Vitamin Solution^#1ml, Trace Elements^&1ml, plus ddH₂O adjusts pH value to 6.5 to 1000ml, and with 1mol/L NaOH solution.

(2) CM agar plates：Its constituent and its ratio are：D-Glucose 10g, Peptone 2g, Yeast Extract 1g, Casamino Acids 1g, 20 × Nitrate Salts^*50ml, Vitamin Solution^#1ml, Trace Elements^&1ml, agar powder 15g, plus ddH₂O adjusts pH value to 6.5 to 1000ml, and with 1mol/L NaOH solution；121℃ Moist heat sterilization 20min.

(3)^*20 × Nitrate Salts (1000ml) constituents and its ratio are：NaNO₃120g, KCl 10.4g, MgSO₄·7H₂O 10.4g, KH₂PO₄30.4g, plus ddH₂O to 1000ml, 121 DEG C of moist heat sterilization 20min.

(4)^#Vitamin Solution (1000ml) constituents and its ratio are：Biotin 0.1g, Pyridoxin 0.1g, Thiamine 0.1g, Riboflavin 0.1g, PABA (p-aminobenzoic acid) 0.1g, Nicotinic Acid 0.1g, plus ddH₂O to 1000ml, filtration sterilization, 4 DEG C of dark storages.

(5)^&Trace Elements (100ml) constituents and its ratio are：ZnSO₄·7H₂O 2.2g, H₃BO₃ 1.1g, MnCl₂·4H₂O 0.5g, FeSO₄·7H₂O 0.5g, CoCl₂·6H₂O 0.17g, CuSO₄·5H₂O0.16g, Na₂MoO₄·2H₂O 0.15g, plus ddH₂O to 100ml, filtration sterilization, 4 DEG C of dark storages.

(2) test method：

Using Pyricularia oryzae wild-type strain Guy11 as material, vegetative hyphae, CM agar plates in CM fluid nutrient mediums are collected The conidiophore in upper production spore stage and conidium, the thalline of appresorium stage of development different time points and colonized paddy rice Leaf sheath or blade infect mycelia；Using RNeasy Plant Mini Kit kits (Qiagen companies) from the thalline of collection It is middle to extract total serum IgE respectively, then with PrimeScript RT Reagent Kit with gDNA Eraser (TAKARA companies) Reverse transcription produces cDNA, then using RP1 and RP2 as primer, quantitative RT- is carried out with SYBR Premix Ex Taq (TAKARA companies) PCR, and carry out homogenization correction using Pyricularia oryzae gene β-tublin expression.Described primer RP1 and RP2 be：

RP1：5’-CAGGATTATGGAGTTCTTG-3’(SEQ ID NO：5)；

RP2：5’-CTAGTATCGTTCACCTTAC-3’(SEQ ID NO：6).

As a result (see Fig. 1), MoSNT2 genes are producing spore stage conidiophore and the expression quantity highest in conidium；It is attached In born of the same parents' growth course, MoSNT2 gene expression amounts reach peak after 12 hours in spore inoculating, infect mycelia and dietetic bacterial Expression quantity in silk is relatively.The above results illustrate that MoSNT2 genes have table in each growth and development stage of Pyricularia oryzae Reach.

Embodiment 3：The structure of Pyricularia oryzae MoSNT2 knock out mutants bodies

Carry out as follows：

Using Split-Marker gene knockout method (bibliography：Kershaw etc., P Natl Acad Sci USA, 2009,106 (37):15967-15972) build gene M oSNT2 knockout mutations body (see Fig. 2).Gene M oSNT2 about 2.5kbp Coded sequence elect target practice site, gene knockout as during, it is mould that the target practice site sequence is replaced into tide by homologous recombination events Plain riddled basins HYG, so as to form knock out mutants body.Specific construction step is as follows：

(1) using Pyricularia oryzae wild type Guy11 genomic DNAs template, respectively with SNT2-LF-For and SNT2-LF- Rev or SNT2-RF-For/SNT2-RF-Rev is primer, and with archaeal dna polymerase KOD-Plus, (health is limited for century biotechnology Company) enter performing PCR amplification, amplification respectively obtains left wing LF (the SEQ ID NO of MoSNT2 genes：Or right flank RF fragments (SEQ 7) ID NO：8).Wherein PCR reaction systems (50 μ l) are：Guy11 genomic DNAs 0.5 μ l (100ng), the μ l of Taq polymerase 0.5 (5U/ μ l), 10 × buffer (+MgCl₂, 25mmol/L) and 5 μ l, dNTP (25mmol/L, each) 0.5 μ l, sense primer (50 μ Mol/L) 0.5 μ l, anti-sense primer (50 μm of ol/L) 0.5 μ l, ddH₂O 42.5μl.PCR response procedures are：94℃5min；94℃ 30s, 58 DEG C of 30s, 72 DEG C of 1min, 35 circulations；72 DEG C of 10min, 4 DEG C of insulations.Described primer SNT2-LF-For and SNT2- LF-Rev is：

SNT2-LF-For：5’-AATCCCTGCGGGCTACTT-3’(SEQ ID NO：9)；

SNT2-LF-Rev：5’-CCTTCAATATCATCTTCTGTCGACCTCACAAAGGCACCGCTG-3(SEQ ID NO：10).

Described primer SNT2-RF-For and SNT2-RF-Rev be：

SNT2-RF-For：5’-CCCAGCACTCGTCCGAGGGCAAAGGAATAGGCATCTCCAAGTTCGGCTCA-3’ (SEQ ID NO：11)；

SNT2-RF-Rev：5’-ACAACCGCAACCCTGGGA-3’(SEQ ID NO：12).

(2) respectively by primer of HYG-For and HY-split or YG-split and HYG-Rev from plasmid template pCB1004 The middle HYG of amplification hygromycin selectable marker gene respectively fragment HY is (see SEQ ID NO：Or fragment YG is (see SEQ ID NO 17)： 18).Described primer HYG-For and HY-split be：

HYG-For：5’-GTCGACAGAAGATGAT-3’(SEQ ID NO：13)；

HY-split：5’-TACTTCGAGCGGAGGCATCC-3’(SEQ ID NO：14).

Described primer YG-split and HYG-Rev be：

YG-split：5’-CGTTGCAAGACCTGCCTGAA-3’(SEQ ID NO：15)；

HYG-Rev：5’-CTATTCCTTTGCCCTCGGACG-3’(SEQ ID NO：16).

Above-mentioned PCR reaction system (50 μ l) is：PCB1004 plasmid templates 0.5 μ l (10ng), the μ l of Taq polymerase 0.5 (5U/ μ l), 10 × buffer (+MgCl₂, 25mmol/L) and 5 μ l, dNTP (25mmol/L, each) 0.5 μ l, sense primer (50 μ Mol/L) 0.5 μ l, anti-sense primer (50 μm of ol/L) 0.5 μ l, ddH₂O 42.5μl.PCR response procedures are：94℃5min；94 DEG C 30s, 58 DEG C of 30s, 72 DEG C of 1min 30s, 35 circulations；72 DEG C of 10min, 4 DEG C of insulations.

(3) four fragments LF, RF, HY and YG for expanding obtain above are reclaimed using agarose gel electrophoresis；Pass through fusion PCR, connects fragment LF and HY using primer pair SNT2-LF-For and HY-split to form fusion fragment LF-HY (see SEQ ID NO：19)；Fragment YG and RF are connected using primer pair YG-split and SNT2-RF-Rev simultaneously to form fusion fragment YG-RF (see SEQ ID NO：20).

Above-mentioned acquisition fusion fragment LF-HY or YG-RF PCR reaction system (50 μ l) is：The μ l of fragment upstream 1 are (about 50ng), the μ l of segments downstream 1 (about 50ng), the μ l of Taq polymerase 0.5 (5U/ μ l), 10 × buffer (+MgCl₂, 25mmol/L) and 5 μ The μ l of l, dNTP (25mmol/L, each) 0.5, sense primer (50 μm of ol/L) 0.5 μ l, anti-sense primer (50 μm of ol/L) 0.5 μ l, ddH₂O 41μl.PCR response procedures are：94℃5min；94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 1min 30s, 35 circulations；72℃ 10min, 4 DEG C of insulations.

(4) acquisition of MoSNT2 knockout mutationss body：Agarose gel electrophoresis reclaims DNA fragmentation LF-HY and YG-RF, simultaneously With reference to (Tablot etc., the The Plant Cell, 1993,5 such as Tablot：1575-1590) methods described prepares Pyricularia oryzae open country Raw type bacterial strain Guy11 protoplast, by LF-HY and YG-RF fragment corotation into protoplast, using the CM fine jades containing hygromycin Fat plate screening fungi transformants.As a result the transformant (or being MoSNT2 knockout mutationss body) of MoSNT2 gene knockouts is obtained. In gene substitution process (as shown in Figure 2), most of exogenous DNA is inserted into the genome of Pyricularia oryzae, due to fusion piece There is homology in LF the and RF sequences of section and the site sequence of MoSNT2 on genome, therefore can occur homologous replacement, obtain MoSNT2 knockout mutations bodies.

The identification of the Pyricularia oryzae MoSNT2 knock out mutants bodies of embodiment 4

Carry out as follows：

(1) genomic DNA of gained transformant in embodiment 3 is extracted, is carried out respectively by primer of P1 and P2 or P3 and P4 PCR is expanded, and wherein the fragment of radom insertion can not produce amplified band, only there occurs homologous replacement in MoSNT2 gene locis Transformant could produce amplified band.The PCR reaction systems (25 μ l) of wherein transformation factor test are：Transformant genomic DNA 0.5 μ l (50ng), the μ l of Taq polymerase 0.3 (5U/ μ l), 10 × buffer (+MgCl₂, 25mmol/L) and 2.5 μ l, dNTP (25mmol/L, each) 0.2 μ l, the μ l of sense primer 0.2, anti-sense primer 0.2 μ l, ddH₂O 21.1μl.PCR response procedures are： 94℃5min；94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 2.5min, 35 circulations；72 DEG C of 10min, 4 DEG C of insulations.Wherein described primer P1 and P2 are：

P1：5’-GGTAGGAGAAAGGCTGATGG-3’(SEQ ID NO：21)；

P2：5’-GCTTCTGCGGGCGATTTGTGTA-3’(SEQ ID NO：22).

Described primer P3 and P4 be：

P3：5’-CAGCGAGAGCCTGACCTATTGC-3’(SEQ ID NO：23)；

P4：5’-CTTCCTGACGCTTCCGATAA-3’(SEQ ID NO：24).

As a result using P1 and P2 be amplified production size obtained by primer as 2.8kbp (see Fig. 3), the institute by primer of P3 and P4 The amplified production size obtained is 2.2kbp (see Fig. 4).5 transformants are the knockout mutations bodies produced through homologous replacement, respectively It is named as △ Mosnt2.1, △ Mosnt2.2, △ Mosnt2.3, △ Mosnt2.4 and △ Mosnt2.5.

(2) southern hybridization identification：The genomic DNA of wild-type strain Guy11 and 5 knockout mutations bodies is extracted, so Digestion is carried out using restriction enzyme SphI afterwards, digestion products carry out transferring film after agarose gel electrophoresis.Southern Cross experiment uses digoxin DNA marker and detection kit (Roche companies).Hybridization probe is LF fragments, is visited for synthesizing The PCR reaction systems of pin are identical with aforementioned operation method.

As a result (see Fig. 5), wild type Guy11 bacterial strains have a hybridization signal at 1.2kbp and 4.1kbp, and knockout mutations body Δ Mosnt2 is due to homologous replacement so that a SphI restriction enzyme site in encoder block disappears (as shown in Figure 2), so as to cause There is hybridization signal at 4.1kbp and 5.5kbp, the southern qualification results confirm △ Mosnt2.1, △ Mosnt2.2, △ Mosnt2.3, △ Mosnt2.4 and △ Mosnt2.5 are correct MoSNT2 knockout mutationss bodies.

The MoSNT2 gene complementations carrier of embodiment 5 and the structure for replying bacterial strain

In order to which the phenotype for verifying mutant is caused by the missing because of gene M oSNT2, according to Oldenburg etc. (Oldenburg etc., 1997, Nucleic Acids Research, 25:The side of restructuring in yeast cells described in 451-452) Method, builds the C-terminal mark green fluorescent protein of MoSnt2 albumen in complementing vector pNEB-MoSNT2-GFP-BAR, the carrier GFP, in favor of analyzing MoSnt2 protein subcellular positioning, the carrier construction method is as follows：

(1) using Guy11 genomic DNA as template, respectively with SNT2-For1 and SNT2-Rev1, SNT2-For2 and SNT2-Rev2, SNT2-For3 and SNT2-Rev3 or SNT2-For4 and SNT2-Rev4 are that primer enters performing PCR amplification, amplification production Four overlapping fragmentses of promoter of the thing comprising MoSNT2 full-length genes and encoder block；Simultaneously with GFP-SNT2-For and GFP- SNT2-Rev is that primer expands the encoder block and terminator for obtaining green fluorescent protein；Expand by primer of BAR-For and BAR-Rev Increase the resistance screening marker gene BAR of glufosinate-ammonium；Six DNA fragmentations that above-mentioned amplification is obtained, it is and double through SacI and HindIII Carrier pNEB-Nat (He etc., the Plos One, 2012,7 (3) of linearization for enzyme restriction processing:E33270) together, cotransformation yeast sense By state cell, in the presence of the recombinantal repair system in yeast cells, DNA fragmentation and carrier can connect to form restructuring load Body, is named as pNEB-MoSNT2-GFP-BAR.Wherein described primer SNT2-For1 and SNT2-Rev1 be：

SNT2-For1：

5’-AACTGTTGGGAAGGGCGATCGGTGCGGGCCACTAGTTCATTGTTACCGAAAGAAGCC-3’(SEQ ID NO：25)；

SNT2-Rev1：5’-AACCCTTTTGAGCCATGAATTCGACGACCAGGCAGGCAAATC-3’(SEQ ID NO： 26)。

Described primer SNT2-For2 and SNT2-Rev2 be：

SNT2-For2：5’-CCTGCCTGGTCGTCGAATTCATGGCTCAAAAGGGTTCAGGTG-3’(SEQ ID NO： 27)；

SNT2-Rev2：5’-AGTGGATTCCCAGGTAGCG-3’(SEQ ID NO：28).

Described primer SNT2-For3 and SNT2-Rev3 be：

SNT2-For3：5’-TGTACCATGCCAGCCTCTG-3’(SEQ ID NO：29)；

SNT2-Rev3：5’-TGACGCTTCCGATAATGTTCT-3’(SEQ ID NO：30).

Described primer SNT2-For4/SNT2-Rev4 is：

SNT2-For4：5’-ACCCAACCAGCATTCTTCCC-3’(SEQ ID NO：31)；

SNT2-Rev4：5’-AGACAGTAGATTTCGCAACG-3’(SEQ ID NO：32).

Described primer GFP-SNT2-For and GFP-SNT2-Rev be：

GFP-SNT2-For：5’-GCCAGCCCTTCGTTGCGAAATCTACTGTCTcccgggATGGTGAGCAAGGGCGA GGA-3’(SEQ ID NO：33)；

GFP-SNT2-Rev：

5’-AGTGCTCCTTCAATATCATCTTCTGTCGACGGCCGGCCGTGGAGATGTGGAGTGGGC-3’(SEQ ID NO：34).

Described primer BAR-For and BAR-Rev be：

BAR-For：5’-GTCGACAGAAGATGATATTG-3’(SEQ ID NO：35)；

BAR-Rev：

5’-TTCACACAGGAAACAGCTATGACCATGATTATTTAAATACGCGTGGCCGGCCGTCGACCTAAATCT CGGTGACGG-3’(SEQ ID NO：36).

(2) the recombinant vector pNEB-MoSNT2-GFP-BAR of gained in step (1) is converted to mutant △ Mosnt2.1 Protoplast, obtains revertant, revertant is named as：Compl. (Compl. is English word complement Abbreviated form, represents supplement, the meaning recovered).

Embodiment 6：MoSNT2 knockout mutationss body △ Mosnt2 and wild type and the comparative analysis for replying bacterial strain

(1) knockout mutations body △ Mosnt2 colony growths are tested

Wild type Guy11, knockout mutations body △ Mosnt2.1, △ Mosnt2.2 and reply bacterial strain Compl. are inoculated with respectively In on CM agar mediums, culture culture 10 days, then observe bacterium colony under the conditions of 25 DEG C.

As a result (see Fig. 6), knockout mutations body △ Mosnt2.1 and △ Mosnt2.2 bacterium colony is significantly less than wild-type strain Guy11 and the bacterium colony for replying bacterial strain Compl.；In addition, the raw bacterium of gas of knockout mutations body △ Mosnt2.1 and △ Mosnt2.2 bacterium colonies Silk is seldom, and wild type Guy11 and reply bacterial strain Compl. aerial hyphae are dense.Illustrate that the missing of MoSNT2 genes have impact on The colonial morphology and the speed of growth of Pyricularia oryzae.

(2) knockout mutations body △ Mosnt2 sporulation quantity detection

(a) by wild-type strain Guy11, knockout mutations body △ Mosnt2.1 and △ Mosnt2.2, reply bacterial strain Compl. It is seeded on CM agar mediums, 16 hours illumination/8 hour dark, is grown 10 days under the conditions of 25 DEG C, then micro- respectively Microscopic observation conidium production.

As a result a large amount of mitogenetic spores are differentiated to form on wild type Guy11 and reply bacterial strain Compl. aerial hyphae (see Fig. 7) Son, and then it is rarely formed conidium on knockout mutations body △ Mosnt2.1 and △ Mosnt2.2 aerial hyphae；Explanation The missing of MoSNT2 genes greatly reduces sporulation quantity.

(b) with the conidium on 5ml sterilized waters scraping bacterium colony surface, and spore suspension is filtered with lens wiping paper, then in micro- Spore quantity is counted under mirror.

As a result the spore quantity that knockout mutations body △ Mosnt2.1 and △ Mosnt2.2 are produced (see Fig. 8) is considerably less than wild Type bacterial strain Guy11 and reply bacterial strain Compl..Illustrate that MoSNT2 plays key effect during production spore.

(c) spore shape for knocking out mutant △ Mosnt2 is observed under the microscope.

As a result wild type Guy11 and reply bacterial strain Compl. spore (see Fig. 9) and be presented normal pyriform, and knockout mutations Body △ Mosnt2.1 and △ Mosnt2.2 conidial paramophia, it is elongated, circular or bar-shaped.Illustrate that MoSNT2 exists Spore shape plays a significant role during building up.

It these results suggest that MoSNT2 genes play important work during the production spore and spore shape of Pyricularia oryzae are built up With.

(3) sensitivity tests that knockout mutations body △ Mosnt2 are coerced cell membrane

Fluorescent whitening agent (Calcofluor white, CFW) energy binding to fungal cell wall components chitin, therefore can influence true The assembling of mycetocyte wall and structure, cause cell membrane to coerce fungi.By wild type Guy11, knockout mutations body △ Mosnt2.1, △ Mosnt2.2 bacterial strains and reply bacterial strain Compl. are inoculated on the CM agar plates comprising 200 μ g/ml fluorescent whitening agents and grow 5 My god, then observe colonial morphology.

As a result (see Figure 10)：With wild type Guy11 compared with replying bacterial strain Compl., knockout mutations body △ Mosnt2.1, △ Mosnt2.2 coerce the colony growth on flat board in CFW and are obviously reduced, more sensitive to CFW.This explanation MoSNT2 influence rice Seasonal febrile diseases bacterium cell wall integrity.

(4) sensitivity tests of the knockout mutations body △ Mosnt2 to oxidative stress

To CM agar mediums addition hydrogen peroxide (H₂O₂), it is respectively 2mM, 3mM or 5mM to make its final concentration, so as to be formed Oxidative stress growing environment, by wild type Guy11, knockout mutations body △ Mosnt2.1, △ Mosnt2.2 bacterial strains and reply bacterial strain Compl. it is inoculated in addition hydrogen peroxide (H₂O₂) CM agar mediums on, 25 DEG C grow 10 days, then observe bacterium colony shape State.

As a result (see Figure 11), hydrogen peroxide can substantially suppress the colony growth of each bacterial strain, but it is to knocking out mutant △ Mosnt2.1 and △ Mosnt2.2 inhibition level will be apparently higher than wild type Guy11 and reply bacterial strain Compl.；Work as peroxidating When hydrogen concentration is 5mM, Guy11 can grow with replying bacterial strain Compl., but knockout mutations body △ Mosnt2.1 and △ Mosnt2.2 can not then grow completely.Illustrate that knockout mutations body is extremely sensitive to oxidative stress, therefore MoSNT2 is regulation and control rice blast The important factor of germ oxidative stress response.

(5) knockout mutations body △ Mosnt2 infect organ attachment spore observation experiment

Conidium is collected from the bacterium colony for being grown on CM agar mediums, spore suspension is prepared as, then by spore suspension inoculation To hydrophobicity slide (Fisher Scientific products), 0 is placed at 25 DEG C, 10 and 24 hours, then carry out under the microscope Observation.

As a result (see Figure 12), wild type Guy11, can be in hydrophobicity glass with replying bacterial strain Compl. after inoculation 10 hours The appresorium of melanin is sprouted and is differentiated to form on piece, although knockout mutations body △ Mosnt2.1 and △ Mosnt2.2 can sprout Hair, but attachment spore can not be differentiated to form；After inoculation 24 hours, wild type Guy11 with reply bacterial strain Compl. attachment spore into It is ripe, and conidium caved in due to autophagy, but knockout mutations body △ Mosnt2.1 and △ Mosnt2.2 can not still form attached Spore, conidium keeps intact form and do not caved in.The above results illustrate that MoSNT2 plays pass during note fields Key is acted on.

Embodiment 7：The pathogenic contrast test of rice blast of MoSNT2 knock out mutants bodies

Carry out as follows：

(1) by Pyricularia oryzae wild-type strain Guy11, knockout mutations body △ Mosnt2.1, △ Mosnt2.2 and reply bacterium Strain Compl. is inoculated on CM agar mediums respectively, is grown at 25 DEG C 10 days, the agar block for then having mycelia to growth is punched. With the rice varieties CO39 of the conventional high sense rice blast in laboratory (rice material is stored in Inst. of Paddy Rice, Sichuan Agriculture Univ.) For host material.

(2) fungus block is seeded on the CO39 of nursery 21 days blade, bacterio-agar block is not connect and is inoculated with blade as control.Connect 5 days observation rice leaf incidences after kind.

As a result formed and known clearly typically on the rice leaf that wild type Guy11 and reply bacterial strain Compl. are inoculated with (see Figure 13) Rice blast scab, and be inoculated with knockout mutations body △ Mosnt2.1 and △ Mosnt2.2 rice leaf without the typical rice of generation Seasonal febrile diseases scab, is only formed as the acute brown spot caused by hypersensitivity.

(3) fungus block is seeded on the CO39 of nursery 21 days root, the root of bacterio-agar block inoculation is not connect as control, inoculation Incidence is observed after 7 days.

As a result (see Figure 14), wild type Guy11 and reply bacterial strain Compl. can make root necrosis and be changed into black, and knock out Mutant △ Mosnt2.1 and △ Mosnt2.2 can not make rice root produce black necrotic plaque, thus lose to rice root It is pathogenic.

These results suggest that MoSNT2 genes is the key gene of rice blast bacterium pathogenicity.

Listed above is only several specific embodiments of the present invention.But the present invention is not limited by above example, One of ordinary skill in the art directly can export or associate many deformations from present disclosure, and other are any not Change, modification, replacement, combination, the simplification made under the Spirit Essence and principle of the present invention, are regarded as equivalent displacement Mode, should all be included within protection scope of the present invention.

SEQUENCE LISTING

<110>Sichuan Agricultural University

<120>Come from pathogenic gene MoSNT2 of Pyricularia oryzae and application thereof

<160> 36

<170> PatentIn version 3.5

<210> 1

<211> 1794

<212> PRT

<213> Magnaporthe oryzae

<400> 1

Met Ala Gln Lys Gly Ser Gly Gly Ser Asp Ala Ala Thr Pro Asn Thr

1 5 10 15

Thr Thr Thr Ser Ala His Lys Gly Thr Ala Glu Ser Lys Gln Ser Ser

20 25 30

Asn Ala Pro Ser Ser Gly Pro Ser Thr Thr Ser Ser Ser Ser Ala Ser

35 40 45

Val Leu Pro Lys Met Ser Asp Pro Gly Pro Pro Gln Ala Leu Gly Ser

50 55 60

Pro Ala Ser Glu Ser Thr Thr Lys Ser Ser Ser Thr Ala Lys Asp Ala

65 70 75 80

Thr Ala Gly Thr Thr Ala Ser Pro Tyr Gly Thr Arg Ser Arg Asn Arg

85 90 95

Gly Gly Asn Ser Arg Pro Asn Tyr Ala Glu Asp Lys Asp Ile Asp Met

100 105 110

Asp Ile Phe Glu Gln Leu His Pro Gln Lys Arg Asp Asp Asp Ser Lys

115 120 125

Lys Thr Ser Arg Gln Asn Ala Ser Ser Ser Ala Thr Asn Thr Gly Asp

130 135 140

Thr His Asn Thr Pro Pro Pro Pro Pro Arg Thr Thr Asn Gly Leu Ser

145 150 155 160

Ser Arg Lys Pro Leu Pro Met Asp Asn Lys Gln Ser Gln Ala Ala Ala

165 170 175

Ala Lys Glu Ser Ser Ser Asn Ala Asn Gln Ala Thr Gly Ala Gly Ser

180 185 190

Thr Gly Ser Thr Gln Thr Thr Ser Lys Lys Arg Lys Ala Ala Ser Gln

195 200 205

Thr Ser Ser Asn Gln Pro Pro Ala Thr Glu Ser Thr His Val Pro Ala

210 215 220

Asn Ala Lys Lys Pro Ser Asn Asn Asn His Asn Ser Asn Ala Ala Ser

225 230 235 240

Ser His Gly Ala Asp Lys Gly Tyr Ala Ala Thr Asn Leu Leu Thr Phe

245 250 255

Glu Asn Cys Gly Ala Arg Pro Lys Asp Gly Lys Leu Ile Ala Asp Asp

260 265 270

Gly Thr Tyr Leu Glu Val Asn Asp His Val Tyr Leu Val Cys Glu Pro

275 280 285

Pro Gly Glu Pro Tyr Tyr Leu Ala Arg Ile Met Glu Phe Leu His Ala

290 295 300

Lys Asn Asp Pro Ser Gln Pro Val Asp Ala Leu Arg Val Asn Trp Tyr

305 310 315 320

Tyr Arg Pro Lys Asp Ile Ala Arg Lys Val Asn Asp Thr Arg Ala Val

325 330 335

Phe Ala Thr Met His Ser Asp Ile Ser Pro Leu Thr Ser Leu Arg Gly

340 345 350

Lys Cys Thr Ile Lys His Lys Ala Glu Ile Lys Gly Lys Leu Glu Glu

355 360 365

Tyr Arg Lys Asn Pro Asp Cys Phe Trp Phe Glu Lys Leu Tyr Asp Arg

370 375 380

Tyr Ile Gln Lys Asn Tyr Glu Val Ile Pro Thr Phe Gln Ile Ile Asn

385 390 395 400

Val Pro Glu Lys Val Lys Lys Val Leu Asp Glu Arg Trp Lys Tyr Ile

405 410 415

Leu Val Glu Gln Gly Arg Gly Lys Glu Leu Thr Ser Ala Val Lys Thr

420 425 430

Cys Arg Arg Cys Ser Gly Tyr Cys Ala Ser Asn Asp Ser Val Asp Cys

435 440 445

Ala Val Cys Glu His Thr Tyr His Met Asn Cys Val Arg Pro Pro Leu

450 455 460

Leu Lys Lys Pro Ser Arg Gly Phe Ala Trp Ser Cys Ala Ala Cys Ser

465 470 475 480

Arg Ala Gln Glu Arg Lys Leu Glu Ala Arg Asn Thr Pro Asn Val Ser

485 490 495

Leu Asp Pro Asn Ala Glu Ala Glu Glu Glu Glu Phe Phe Asp Glu Glu

500 505 510

Glu Glu Asp Ala Gly Leu Asp Thr Gly Arg Thr Ser Pro Ala Asp Gly

515 520 525

Ala Asn Asp Met His Ile Pro Ala Thr Glu Glu Gln Met Tyr His Ala

530 535 540

Ser Leu Trp Pro Tyr Arg Tyr Leu Gly Ile His Cys Lys Val Glu Asp

545 550 555 560

Ala Leu Asp Tyr Asp Asp Arg Ile Tyr Pro Arg Ala Ser Thr Arg Val

565 570 575

Gly Pro Arg His Gln Ala Thr Val Leu Asp Trp Pro Gly Arg Pro Val

580 585 590

Gln Tyr Val Lys Ala Pro Glu Ile Glu Ile Lys Lys Thr Gly Arg Lys

595 600 605

Asp Gly Lys Leu Asn Lys Glu Ala Gln Ala Ala Leu Glu Ala Glu Lys

610 615 620

Val Ala Lys Ala Lys Arg Pro Lys Trp Ile Gln Asp Glu Pro Pro Gly

625 630 635 640

Tyr Val Pro Arg Gly Glu Asp Tyr Pro Asn Asp Asp Pro Arg Asn Thr

645 650 655

Ala Gln Leu His Trp Arg Pro Pro Glu Leu Asp Leu Pro Glu Glu Ser

660 665 670

Gly Pro Glu Glu Ala His Ile Ser Glu Ser Glu Ile Asp Lys Tyr Met

675 680 685

Glu Gln Ala Lys Gly Met Ala Leu Asp Leu Asp Leu Pro Glu His Ser

690 695 700

Thr Asn Leu Leu Asp Gln Ala Leu Arg Leu Leu Tyr Glu His Gly Tyr

705 710 715 720

Asp Ala Glu Arg Ala Leu Glu Glu Leu Pro Lys Leu Ser Lys Glu Ala

725 730 735

Phe Asp Glu Pro Gln Leu Thr Ala Ala Glu Leu Lys Lys Phe Glu Glu

740 745 750

Gly Ile Ser Lys Phe Gly Ser Glu Leu Tyr Ser Val Lys Lys His Ile

755 760 765

Lys Thr Val Lys Pro Gly Thr Leu Val Arg Phe Tyr Tyr Thr Trp Lys

770 775 780

Lys Thr Glu Arg Gly Lys Gln Val Trp Gly Asn Tyr Ser Gly Arg Lys

785 790 795 800

Ser Lys Lys Glu Ala Lys Glu Ala Lys Lys Ala Glu Thr Ala Ser Gln

805 810 815

Asn Lys Met Gln Asp Asp Val Ala Asp Asp His Asp Asp Ser Ala Phe

820 825 830

Asp Ala Ala Lys Ala Ala Glu Lys Lys Arg Ser Phe Ile Cys Lys Phe

835 840 845

Cys Asn Thr Lys Ser Ser Arg Gln Trp Arg Arg Ala Pro Asn Ala Ser

850 855 860

Gly Ala Leu Val Thr Glu Ser Gly Gly Lys Gly Ala Asn Lys Asp Lys

865 870 875 880

Gly Val Gln Tyr Val Val Ala Leu Cys Arg Arg Cys Ala Glu Leu Trp

885 890 895

Arg Arg Tyr Ala Ile Gln Trp Glu Asp Val Asp Gln Leu Tyr Ser Lys

900 905 910

Val Ala Gln Ala Gly Gly Arg Ala Trp Lys Lys Lys Ile Asp Glu Glu

915 920 925

Leu Leu Lys Glu Ile Val Ala Ala Glu Gln Arg Ser Lys Asn Thr Pro

930 935 940

Ser Ser Ser Gly Ala Ala Thr Pro Pro Ser Asn Thr Thr Pro Ala Pro

945 950 955 960

Ala Ser Thr Gln Pro Ala Ala Ser Gly Gln Glu Pro Ala Arg Lys Lys

965 970 975

Gln Lys Thr Thr Gln Pro Pro Gln Asp Lys Asp Val Glu Met Thr Gly

980 985 990

Thr Glu Pro Val Gly Thr Thr Thr Thr Ala Pro Ala Ser Lys Lys Lys

995 1000 1005

Glu Lys Ala Ser Leu Glu Lys Glu Lys Glu Lys Glu Lys Glu Lys

1010 1015 1020

Glu Lys Glu Lys Glu Lys Glu Lys Glu Pro Val Lys Glu Lys Lys

1025 1030 1035

Glu Ala Pro Ala Pro Pro Pro Val Pro Glu Ile Pro Lys Pro Arg

1040 1045 1050

Thr Met Pro Cys Asp Ile Cys Arg Gln Leu Glu Pro Leu Gly Asp

1055 1060 1065

Gln His Ile Thr Cys Lys Glu Cys Arg Met Thr Val His Arg Asn

1070 1075 1080

Cys Tyr Gly Val Val Asp Asn Arg Asn Pro Gly Lys Trp Val Cys

1085 1090 1095

Asp Met Cys Ile Asn Asp Arg Ser Pro His Val Ser Ile His Tyr

1100 1105 1110

Lys Cys Val Leu Cys Pro Val Glu Tyr Thr Glu His Asp Phe Val

1115 1120 1125

Glu Pro Pro Lys Val Ser His Lys Lys Lys Thr Glu Lys Asp Arg

1130 1135 1140

Glu Arg Glu Arg Gln Glu Arg Glu Ala Ala Val Asn Ala Ala Glu

1145 1150 1155

His Tyr Arg Lys Arg Gln Glu Glu Leu Asn Arg Pro Val Asn Pro

1160 1165 1170

Arg Glu Pro Leu Lys Arg Thr Ala Asp Asn Asn Trp Val His Val

1175 1180 1185

Thr Cys Ser Val Trp Thr Pro Glu Val Lys Phe Gly Asn Ala Lys

1190 1195 1200

Ala Leu Glu Pro Ser Glu Gly Ile Pro Ser Ile Pro Arg Ser Arg

1205 1210 1215

Tyr Ser Glu Val Cys Glu Val Cys Lys Ser Thr Gly Gly Ala Cys

1220 1225 1230

Thr Asn Cys Pro Gln Cys Lys Ala Ser Val His Val Glu Cys Ala

1235 1240 1245

His Gln Ser Asp Asp Tyr Val Leu Gly Phe Glu Ile Thr Pro Val

1250 1255 1260

Lys Gly Ser Arg Arg Asp Gln His Asn Ile Val Thr Ile Gly Gly

1265 1270 1275

Glu Ser Gly Ser Met Ser Ala Ser Val Trp Cys Lys Leu His Ala

1280 1285 1290

Pro Lys Lys Thr Val Val His Gln Met Tyr Asp Val Val Asp Glu

1295 1300 1305

Ala Gly Thr Asn Ala Leu Gln Leu Tyr Val Gln Asn Phe Lys Lys

1310 1315 1320

Ala Asp Leu Thr Leu Thr Gly Cys Ala Arg Lys Ala Asn Leu Ile

1325 1330 1335

Ser Thr Ala Ala Arg Met Ser Asn Pro Ile Val Thr Thr Thr Thr

1340 1345 1350

Ala Val Asn Arg Arg Ala Ser Thr Thr Thr Val Ser Thr Thr Thr

1355 1360 1365

Pro Ser Ala Met His Ile His Ser Leu Leu Asn Gly Asp Ser Pro

1370 1375 1380

Gly Asp Pro His Asp Leu Ala Val Pro Gly Gly Lys Ile Cys Ile

1385 1390 1395

Thr Cys Gly Val Asp Val Ser Pro Arg Trp Tyr Pro Ile Ser Asp

1400 1405 1410

Ser His Glu Arg Glu Leu Ala Asn Gly His Tyr Gly Ala Leu Gly

1415 1420 1425

Thr Glu Ala Gln Lys Phe Ala Glu Gln Arg His Phe Gln Cys His

1430 1435 1440

Lys Cys Lys Lys Leu Asn Lys Gln Pro Lys Ser His Val Pro Pro

1445 1450 1455

Pro Pro Pro Pro Gln Asp Pro Pro Pro Val Ala Ala Asn Thr Ile

1460 1465 1470

Asn Pro Ser Gly Pro Glu Ala Thr Ala His Ser Ala Ala Val Met

1475 1480 1485

Thr Asn Gly Ile Asp His Gly Pro Asn Gly Val Asp Ala Ala Val

1490 1495 1500

Arg Arg Gly Thr Pro Pro Leu Thr Ser Pro Arg Gln Pro Glu His

1505 1510 1515

Asp His Ile Pro Gly Arg Pro Ser Pro Tyr Leu Trp Gln Ser Gly

1520 1525 1530

Leu Gln Ala Pro His Pro Thr Gly Leu Val His Pro Thr Val Pro

1535 1540 1545

Ile Gln Gly Pro Pro Pro Pro Met Gln Ala Pro Pro Leu Gln Pro

1550 1555 1560

Pro Pro Ile Ala Pro Pro Pro Met Ala Arg Ser Met Ser Gly Arg

1565 1570 1575

Gly Gln Thr Gly Val Gln Pro Pro Gly Pro Val Pro Pro Ser Gln

1580 1585 1590

Ala Tyr Gln Pro Leu Pro Pro Pro Pro Pro Thr His Ser Ala Pro

1595 1600 1605

Ser Gly Pro Tyr Gly Asp Trp His Arg Thr Thr His His Gly Pro

1610 1615 1620

Pro Met Asn Gly Arg Pro Pro Ser Arg Ala Ser Arg Ile Ser Pro

1625 1630 1635

Ile Ile Pro Pro Leu Ala Pro Pro Ala Leu Arg Pro Pro Ser Leu

1640 1645 1650

His His Ser Pro His Ala Pro His Ala His Leu Thr Asn Gly His

1655 1660 1665

Met Val Asn Gly Ala Gly Ala Pro Gly Arg Arg Leu Ser Gly Pro

1670 1675 1680

Pro Pro Pro Pro Ser Arg Asp Gly Gln Gly Pro Tyr Met Gly Ser

1685 1690 1695

Tyr His Ser Pro Ala Pro Tyr His Ser Pro Ala Pro His Gln Ser

1700 1705 1710

Asn Gly Thr Met Val Pro Pro Arg Ile Asp His Ala Phe Ala Ser

1715 1720 1725

Val Leu Asn Pro Pro Arg Ala Tyr Gly Asn Ser Gly Ser Val Gln

1730 1735 1740

Pro Pro Ala His Met Ser Pro Ala Val Ala Arg Asp Ala Pro Ile

1745 1750 1755

Ser Arg Asp Gly Pro Leu Leu Ser Gln Pro Pro Pro Pro Ala Arg

1760 1765 1770

Ala Pro Glu Ser Arg Pro Ala Thr Gly Ala Ser Ala Ser Pro Ser

1775 1780 1785

Leu Arg Asn Leu Leu Ser

1790

<210> 2

<211> 5382

<212> DNA

<213> Magnaporthe oryzae

<400> 2

atggctcaaa agggttcagg tggctcagat gccgcaacac ctaataccac gacgacgtcg 60

gctcacaaag gcaccgctga gagcaagcaa tcttccaatg cgccctcttc tgggccatcg 120

acgacatcgt cgtcatctgc atcggttctg cccaaaatgt cagatcccgg tccaccacag 180

gccctaggaa gtccagcgtc agaatcgaca accaagtcga gttcgactgc caaggacgcg 240

acggccggca ccacggcatc tccttatggc acgcgatctc gcaacagggg cggcaactct 300

cgtcccaatt atgcagagga caaggacatt gatatggaca tttttgagca gttgcatcct 360

cagaagcgag atgacgacag caagaagacg tcgcgccaaa acgcatcgtc gtcagccacc 420

aacactggcg atacacacaa cacacctccg ccaccacctc gcaccactaa cgggttgtcg 480

tccagaaagc cgctgcccat ggataacaag cagtcccagg ctgcagccgc caaagagtca 540

tcctcaaatg ctaaccaggc aaccggcgct ggctcaactg gatccacaca gaccacatcg 600

aaaaagcgaa aagctgcatc acaaactagc agtaatcagc caccagcgac ggaatcgacg 660

cacgtgccag ccaacgccaa gaagcccagt aataataatc acaacagcaa cgctgcatcg 720

agccacggcg ccgacaaggg atatgctgct actaatttgc tcactttcga aaactgtggc 780

gcgcggccca aagatggcaa attgattgct gacgatggca catatcttga agtcaatgac 840

catgtctacc tggtttgcga gcccccaggc gaaccctatt atctcgccag gattatggag 900

ttcttgcatg caaagaacga cccttcgcag ccggtcgatg ctttgcgtgt gaattggtac 960

taccgcccaa aagatattgc ccgtaaggtg aacgatacta gggcggtttt tgcaaccatg 1020

cactcggaca ttagcccttt gacatcgctc cgcggcaaat gcacgatcaa gcacaaggca 1080

gagatcaagg gcaagctcga agagtaccgc aaaaatcccg attgtttctg gttcgagaaa 1140

ctctacgaca ggtacatcca gaaaaattac gaggtgatcc cgacgtttca gatcatcaat 1200

gtacccgaga aggtcaaaaa ggtccttgac gagaggtgga aatacatcct ggtcgagcag 1260

ggccgcggca aggagctcac cagcgccgtc aagacgtgca ggaggtgctc tggctattgc 1320

gcaagtaacg attctgtcga ctgcgctgtg tgtgagcaca cgtaccacat gaactgtgtg 1380

cgaccacccc tgctcaagaa gccatcacgt ggctttgcct ggtcctgtgc cgcctgcagt 1440

agagcccagg agcgcaagct ggaggctcgc aacacgccaa atgtcagcct ggatccgaat 1500

gcagaggccg aggaggagga gtttttcgat gaggaggagg aggacgctgg tctcgacacc 1560

ggccgcacca gtcctgccga tggcgccaac gatatgcaca tccctgcaac cgaggagcag 1620

atgtaccatg ccagcctctg gccatatcgc tacctgggaa tccactgcaa ggtggaggac 1680

gccctcgatt acgacgaccg aatatatccc cgtgcatcga ctcgtgttgg cccaagacac 1740

caggcgacgg tgcttgactg gcctggtcga ccggtccaat acgtcaaggc tcccgaaatt 1800

gaaataaaaa agacgggtcg taaagacggg aagctgaaca aggaagcgca agctgccctc 1860

gaggccgaaa aggtcgccaa ggccaaacgt cccaagtgga tccaggatga accccctggc 1920

tatgtgcccc gtggtgagga ctaccccaat gacgatcccc ggaataccgc ccagcttcac 1980

tggagacctc ctgagcttga cctcccggag gaatcgggtc cggaggaggc gcatatttcc 2040

gaatcggaga tcgacaagta catggagcaa gcgaaaggaa tggcgctaga cctcgacctc 2100

ccggagcact ctacgaatct gctggaccag gcgctccgac ttctctacga acacggttac 2160

gacgcggagc gtgcactgga agagctcccc aagctgagta aggaagcttt tgacgaacca 2220

cagctcacag ctgccgagct caaaaagttc gaggaaggca tctccaagtt cggctcagag 2280

ctttacagcg tgaagaaaca tatcaagacc gtcaaaccag ggacgcttgt tcgtttctac 2340

tacacatgga agaagacaga gcgcggaaag caggtgtggg gcaactactc tggccgcaag 2400

agcaagaagg aggccaagga agccaagaaa gcggagacag cctcacagaa taagatgcag 2460

gacgacgtcg cagacgacca cgatgactcg gctttcgacg cagctaaagc ggcggaaaag 2520

aaacggtctt tcatttgcaa gttttgcaac accaagagct cgcgtcagtg gagacgcgcg 2580

ccaaatgcat caggcgctct ggtcacggag agcgggggca agggtgccaa caaggacaag 2640

ggcgttcagt atgtcgtggc attgtgtcga agatgtgctg agctctggcg ccgctatgcc 2700

attcagtggg aggatgtcga ccagctctac agcaaggtgg cacaggccgg tggccgtgcg 2760

tggaagaaga agatcgacga ggagctgctc aaggagatcg ttgctgctga gcaaagaagc 2820

aagaacacgc caagcagtag cggtgcggct actccgccat cgaacaccac gcctgcgccc 2880

gcttccactc aaccagcagc ttcgggtcaa gaaccggcgc ggaagaaaca gaagacaacg 2940

cagccgcctc aagacaagga tgtggaaatg accggcacgg agcctgttgg cacgacaaca 3000

acggcgcccg catccaagaa aaaggagaag gccagcttgg aaaaggagaa agagaaggaa 3060

aaggagaaag agaaggaaaa ggagaaggag aaagaaccag tcaaagaaaa gaaggaagcg 3120

ccggctcctc cccctgttcc ggagataccc aagccgcgaa caatgccttg cgatatctgt 3180

cggcagctgg aacctctggg cgaccagcat atcacgtgca aagaatgtcg catgacagtg 3240

catcggaact gctatggcgt cgtcgacaac cgcaaccctg ggaagtgggt gtgtgacatg 3300

tgcatcaacg acagaagtcc gcatgtctcc attcattaca aatgtgtctt gtgtcctgtt 3360

gaatacaccg agcacgattt tgtggaaccg ccaaaggtat ctcataaaaa gaagacagaa 3420

aaggatcgcg agcgcgagcg ccaagaacgt gaggctgcgg tcaacgcagc agaacattat 3480

cggaagcgtc aggaagagct gaaccgcccg gtcaatcctc gtgagcctct caaacgaaca 3540

gccgacaaca attgggtaca tgtcacttgc tcggtgtgga ctcctgaggt caagtttggc 3600

aatgccaaag ctctcgagcc cagcgaaggg atcccttcta tcccgagatc gaggtactcg 3660

gaggtttgcg aggtctgcaa atctacgggc ggtgcctgca caaactgccc tcagtgcaag 3720

gcatcagtgc atgtcgagtg tgcccaccag tcagacgact acgtcctagg ttttgagatc 3780

actcccgtca agggatcacg ccgcgatcag cacaacatcg taactattgg tggtgagagc 3840

ggctccatga gcgcgtctgt ctggtgcaag cttcatgcac cgaagaagac tgtcgtgcat 3900

caaatgtacg atgttgtcga cgaagcggga acgaacgctt tacaactata cgtgcagaac 3960

ttcaagaagg cagatcttac tctcactggc tgcgcacgaa aggccaactt gataagcact 4020

gctgcgcgca tgtccaaccc gatagtgacg acgactacgg cggtgaatcg cagagcatcg 4080

accacgacgg tttcaacaac caccccttcg gcaatgcata ttcacagtct cctcaacggg 4140

gacagccctg gagaccctca cgacctagca gtcccaggtg gcaagatatg tataacatgc 4200

ggagtcgacg tcagccctcg atggtatccc atcagcgaca gtcacgagcg ggagcttgca 4260

aacggtcact atggtgctct cggcactgag gcgcagaagt ttgctgagca gcgacatttc 4320

cagtgtcaca aatgcaagaa gctcaacaag caacccaagt ctcacgtgcc accgccgccg 4380

ccgccgcaag atcctccgcc ggttgctgca aatacgataa atccctccgg gcctgaagca 4440

acagcgcatt cagcagctgt aatgacgaac ggcatagatc acggtcccaa tggcgtcgat 4500

gcagcggttc gtcgaggcac accacctcta acaagccctc gccaaccaga gcacgatcat 4560

ataccgggta ggcctagccc gtacctatgg caatccggac ttcaggctcc acatccgacc 4620

ggcttggtgc atcctacggt ccctatacag gggccgccac ccccgatgca ggcaccgcct 4680

ctccaaccac cgccgatagc tccgccgccg atggcacgta gtatgtcagg ccgcggtcaa 4740

accggtgtac agcctccggg gccagtaccg ccctcccaag catatcaacc cttgccgccg 4800

cctcctccca ctcattcggc accatctggc ccctacggcg attggcatcg gacgactcat 4860

cacggacccc caatgaatgg tcgtcctcct tcacgcgcat cacggatttc cccgatcata 4920

ccacctctgg caccaccagc acttcgtcca ccgtctctcc accactctcc tcatgctcct 4980

cacgcgcatc tgaccaacgg ccacatggtc aacggtgcgg gtgcaccagg aagacgatta 5040

agcgggccgc caccgccacc ttcgcgagat ggtcagggcc catacatggg aagctatcat 5100

tctcctgcac cataccatag cccagcgccg caccaaagca acgggacaat ggtgccacct 5160

cgcatagatc atgcttttgc gtcagtcctc aaccctccga gagcatatgg aaacagcggg 5220

agcgtgcagc cgcctgcgca catgagccca gctgtggcga gggacgctcc tatttctagg 5280

gatggaccac ttctttccca gccaccgcca ccggccaggg cacctgagtc gagacctgca 5340

acaggtgcca gcgccagccc ttcgttgcga aatctactgt ct 5382

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-cDNA-For

<400> 3

atggctcaaa agggttcagg tg 22

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-cDNA-Rev

<400> 4

agacagtaga tttcgcaacg aag 23

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> RP1

<400> 5

caggattatg gagttcttg 19

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> RP2

<400> 6

ctagtatcgt tcaccttac 19

<210> 7

<211> 1167

<212> DNA

<213> Artificial Sequence

<220>

<223> LF

<400> 7

aatccctgcg ggctactttg acgatactac gcaccgcaga gcctgcaaaa agctgtagct 60

ggcggtccca tacaccggac ccatatattc gaagctagct cactaaatcg attggacaag 120

ggtgtggggt cccacccagg gactgatgta ggaagtgcaa aaaaatggac gagccttgcg 180

ggcgccgcca gcccttgttg ctttctgcgt gccgggcaag ccagccagcc agtacgggac 240

gtccccagtt gggtttggtc ttccatgtct ctttcttgtc ttgggggcgt gtggtccgtc 300

catcatatcc gcctttctgg gacatgcatc cattgaccat ctttctctaa atcctttctt 360

cgcggcactc catctctttc ctcactttcc acttttccgc cttccaagag gtcagtcgtt 420

gtgcactccc acgcgccccc gacgaaggac atttttgctt ccctctcggc accaggcaag 480

caagccagcc agtccctctc tacatgatcg gattaccagc ccggtttggg ttcccagcgc 540

cacaacgctt gtaactcgcg cgaagggctg ctggccttca aactcgattc ctcataacat 600

ttgctcgtgc agatctaact caccgggcat ctcgggggac acgaacaccc gcccacttcc 660

ttaacttctt tgtcaatcgc ccatatatct ctccttttcc tattccattc ccccccacac 720

aattcaaacc ttgcaccttt ctcacccatt tcgacataaa ctgggtccga ctttctttcc 780

tttcctcctt gtcacccaac cttgggtttc gaaaccttcg atttccatct gtacccatca 840

atctcttctg gcatgcatta tccgccacac gctcacctga atctgggagt ctcatcactg 900

tttacgtcgc gcattgcggc ctgcccagag cagttgtatt ctgcttcttg cggctgcgcc 960

gcctaccttt ccttcccata gttgtttctt tgcagcggaa ggcgaaattt gatcgacccg 1020

gcctctgggt ctcacttggg accttataaa cagcgcccac gtccagcaga tttgcctgcc 1080

tggtcgtcat ggctcaaaag ggttcaggtg gctcagatgc cgcaacacct aataccacga 1140

cgacgtcggc tcacaaaggc accgctg 1167

<210> 8

<211> 1026

<212> DNA

<213> Artificial Sequence

<220>

<223> RF

<400> 8

gcatctccaa gttcggctca gagctttaca gcgtgaagaa acatatcaag accgtcaaac 60

cagggacgct tgttcgtttc tactacacat ggaagaagac agagcgcgga aagcaggtgt 120

ggggcaacta ctctggccgc aagagcaaga aggaggccaa ggaagccaag aaagcggaga 180

cagcctcaca gaataagatg caggacgacg tcgcagacga ccacgatgac tcggctttcg 240

acgcagctaa agcggcggaa aagaaacggt ctttcatttg caagttttgc aacaccaaga 300

gctcgcgtca gtggagacgc gcgccaaatg catcaggcgc tctggtcacg gagagcgggg 360

gcaagggtgc caacaaggac aagggcgttc agtatgtcgt ggcattgtgt cgaagatgtg 420

ctgagctctg gcgccgctat gccattcagt gggaggatgt cgaccagctc tacagcaagg 480

tggcacaggc cggtggccgt gcgtggaaga agaagatcga cgaggagctg ctcaaggaga 540

tcgttgctgc tgagcaaaga agcaagaaca cgccaagcag tagcggtgcg gctactccgc 600

catcgaacac cacgcctgcg cccgcttcca ctcaaccagc agcttcgggt caagaaccgg 660

cgcggaagaa acagaagaca acgcagccgc ctcaagacaa ggatgtggaa atgaccggca 720

cggagcctgt tggcacgaca acaacggcgc ccgcatccaa gaaaaaggag aaggccagct 780

tggaaaagga gaaagagaag gaaaaggaga aagagaagga aaaggagaag gagaaagaac 840

cagtcaaaga aaagaaggaa gcgccggctc ctccccctgt tccggagata cccaagccgc 900

gaacaatgcc ttgcgatatc tgtcggcagc tggaacctct gggcgaccag catatcacgt 960

gcaaagaatg tcgcatgaca gtgcatcgga actgctatgg cgtcgtcgac aaccgcaacc 1020

ctggga 1026

<210> 9

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-LF-For

<400> 9

aatccctgcg ggctactt 18

<210> 10

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-LF-Rev

<400> 10

ccttcaatat catcttctgt cgacctcaca aaggcaccgc tg 42

<210> 11

<211> 50

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-RF-For

<400> 11

cccagcactc gtccgagggc aaaggaatag gcatctccaa gttcggctca 50

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-RF-Rev

<400> 12

acaaccgcaa ccctggga 18

<210> 13

<211> 16

<212> DNA

<213> Artificial Sequence

<220>

<223> HYG-For

<400> 13

gtcgacagaa gatgat 16

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> HY-split

<400> 14

tacttcgagc ggaggcatcc 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> YG-split

<400> 15

cgttgcaaga cctgcctgaa 20

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> HYG-Rev

<400> 16

ctattccttt gccctcggac g 21

<210> 17

<211> 1148

<212> DNA

<213> Artificial Sequence

<220>

<223> HY

<400> 17

gtcgacagaa gatgatattg aaggagcact ttttgggctt ggctggagct agtggaggtc 60

aacaatgaat gcctattttg gtttagtcgt ccaggcggtg agcacaaaat ttgtgtcgtt 120

tgacaagatg gttcatttag gcaactggtc agatcagccc cacttgtagc agtagcggcg 180

gcgctcgaag tgtgactctt attagcagac aggaacgagg acattattat catctgctgc 240

ttggtgcacg ataacttggt gcgtttgtca agcaaggtaa gtgaacgacc cggtcatacc 300

ttcttaagtt cgcccttcct ccctttattt cagattcaat ctgacttacc tattctaccc 360

aagcaacgct tcgattagga agtaaccatg aaaaagcctg aactcaccgc gacgtctgtc 420

gagaagtttc tgatcgaaaa gttcgacagc gtctccgacc tgatgcagct ctcggagggc 480

gaagaatctc gtgctttcag cttcgatgta ggagggcgtg gatatgtcct gcgggtaaat 540

agctgcgccg atggtttcta caaagatcgt tatgtttatc ggcactttgc atcggccgcg 600

ctcccgattc cggaagtgct tgacattggg gaattcagcg agagcctgac ctattgcatc 660

tcccgccgtg cacagggtgt cacgttgcaa gacctgcctg aaaccgaact gcccgctgtt 720

ctgcagccgg tcgcggaggc catggatgcg atcgctgcgg ccgatcttag ccagacgagc 780

gggttcggcc cattcggacc gcaaggaatc ggtcaataca ctacatggcg tgatttcata 840

tgcgcgattg ctgatcccca tgtgtatcac tggcaaactg tgatggacga caccgtcagt 900

gcgtccgtcg cgcaggctct cgatgagctg atgctttggg ccgaggactg ccccgaagtc 960

cggcacctcg tgcacgcgga tttcggctcc aacaatgtcc tgacggacaa tggccgcata 1020

acagcggtca ttgactggag cgaggcgatg ttcggggatt cccaatacga ggtcgccaac 1080

atcttcttct ggaggccgtg gttggcttgt atggagcagc agacgcgcta cttcgagcgg 1140

aggcatcc 1148

<210> 18

<211> 731

<212> DNA

<213> Artificial Sequence

<220>

<223> YG

<400> 18

cgttgcaaga cctgcctgaa accgaactgc ccgctgttct gcagccggtc gcggaggcca 60

tggatgcgat cgctgcggcc gatcttagcc agacgagcgg gttcggccca ttcggaccgc 120

aaggaatcgg tcaatacact acatggcgtg atttcatatg cgcgattgct gatccccatg 180

tgtatcactg gcaaactgtg atggacgaca ccgtcagtgc gtccgtcgcg caggctctcg 240

atgagctgat gctttgggcc gaggactgcc ccgaagtccg gcacctcgtg cacgcggatt 300

tcggctccaa caatgtcctg acggacaatg gccgcataac agcggtcatt gactggagcg 360

aggcgatgtt cggggattcc caatacgagg tcgccaacat cttcttctgg aggccgtggt 420

tggcttgtat ggagcagcag acgcgctact tcgagcggag gcatccggag cttgcaggat 480

cgccgcggct ccgggcgtat atgctccgca ttggtcttga ccaactctat cagagcttgg 540

ttgacggcaa tttcgatgat gcagcttggg cgcagggtcg atgcgacgca atcgtccgat 600

ccggagccgg gactgtcggg cgtacacaaa tcgcccgcag aagcgcggcc gtctggaccg 660

atggctgtgt agaagtactc gccgatagtg gaaaccgacg ccccagcact cgtccgaggg 720

caaaggaata g 731

<210> 19

<211> 2315

<212> DNA

<213> Artificial Sequence

<220>

<223> LF-HY

<400> 19

aatccctgcg ggctactttg acgatactac gcaccgcaga gcctgcaaaa agctgtagct 60

ggcggtccca tacaccggac ccatatattc gaagctagct cactaaatcg attggacaag 120

ggtgtggggt cccacccagg gactgatgta ggaagtgcaa aaaaatggac gagccttgcg 180

ggcgccgcca gcccttgttg ctttctgcgt gccgggcaag ccagccagcc agtacgggac 240

gtccccagtt gggtttggtc ttccatgtct ctttcttgtc ttgggggcgt gtggtccgtc 300

catcatatcc gcctttctgg gacatgcatc cattgaccat ctttctctaa atcctttctt 360

cgcggcactc catctctttc ctcactttcc acttttccgc cttccaagag gtcagtcgtt 420

gtgcactccc acgcgccccc gacgaaggac atttttgctt ccctctcggc accaggcaag 480

caagccagcc agtccctctc tacatgatcg gattaccagc ccggtttggg ttcccagcgc 540

cacaacgctt gtaactcgcg cgaagggctg ctggccttca aactcgattc ctcataacat 600

ttgctcgtgc agatctaact caccgggcat ctcgggggac acgaacaccc gcccacttcc 660

ttaacttctt tgtcaatcgc ccatatatct ctccttttcc tattccattc ccccccacac 720

aattcaaacc ttgcaccttt ctcacccatt tcgacataaa ctgggtccga ctttctttcc 780

tttcctcctt gtcacccaac cttgggtttc gaaaccttcg atttccatct gtacccatca 840

atctcttctg gcatgcatta tccgccacac gctcacctga atctgggagt ctcatcactg 900

tttacgtcgc gcattgcggc ctgcccagag cagttgtatt ctgcttcttg cggctgcgcc 960

gcctaccttt ccttcccata gttgtttctt tgcagcggaa ggcgaaattt gatcgacccg 1020

gcctctgggt ctcacttggg accttataaa cagcgcccac gtccagcaga tttgcctgcc 1080

tggtcgtcat ggctcaaaag ggttcaggtg gctcagatgc cgcaacacct aataccacga 1140

cgacgtcggc tcacaaaggc accgctggtc gacagaagat gatattgaag gagcactttt 1200

tgggcttggc tggagctagt ggaggtcaac aatgaatgcc tattttggtt tagtcgtcca 1260

ggcggtgagc acaaaatttg tgtcgtttga caagatggtt catttaggca actggtcaga 1320

tcagccccac ttgtagcagt agcggcggcg ctcgaagtgt gactcttatt agcagacagg 1380

aacgaggaca ttattatcat ctgctgcttg gtgcacgata acttggtgcg tttgtcaagc 1440

aaggtaagtg aacgacccgg tcataccttc ttaagttcgc ccttcctccc tttatttcag 1500

attcaatctg acttacctat tctacccaag caacgcttcg attaggaagt aaccatgaaa 1560

aagcctgaac tcaccgcgac gtctgtcgag aagtttctga tcgaaaagtt cgacagcgtc 1620

tccgacctga tgcagctctc ggagggcgaa gaatctcgtg ctttcagctt cgatgtagga 1680

gggcgtggat atgtcctgcg ggtaaatagc tgcgccgatg gtttctacaa agatcgttat 1740

gtttatcggc actttgcatc ggccgcgctc ccgattccgg aagtgcttga cattggggaa 1800

ttcagcgaga gcctgaccta ttgcatctcc cgccgtgcac agggtgtcac gttgcaagac 1860

ctgcctgaaa ccgaactgcc cgctgttctg cagccggtcg cggaggccat ggatgcgatc 1920

gctgcggccg atcttagcca gacgagcggg ttcggcccat tcggaccgca aggaatcggt 1980

caatacacta catggcgtga tttcatatgc gcgattgctg atccccatgt gtatcactgg 2040

caaactgtga tggacgacac cgtcagtgcg tccgtcgcgc aggctctcga tgagctgatg 2100

ctttgggccg aggactgccc cgaagtccgg cacctcgtgc acgcggattt cggctccaac 2160

aatgtcctga cggacaatgg ccgcataaca gcggtcattg actggagcga ggcgatgttc 2220

ggggattccc aatacgaggt cgccaacatc ttcttctgga ggccgtggtt ggcttgtatg 2280

gagcagcaga cgcgctactt cgagcggagg catcc 2315

<210> 20

<211> 1757

<212> DNA

<213> Artificial Sequence

<220>

<223> YG-RF

<400> 20

cgttgcaaga cctgcctgaa accgaactgc ccgctgttct gcagccggtc gcggaggcca 60

tggatgcgat cgctgcggcc gatcttagcc agacgagcgg gttcggccca ttcggaccgc 120

aaggaatcgg tcaatacact acatggcgtg atttcatatg cgcgattgct gatccccatg 180

tgtatcactg gcaaactgtg atggacgaca ccgtcagtgc gtccgtcgcg caggctctcg 240

atgagctgat gctttgggcc gaggactgcc ccgaagtccg gcacctcgtg cacgcggatt 300

tcggctccaa caatgtcctg acggacaatg gccgcataac agcggtcatt gactggagcg 360

aggcgatgtt cggggattcc caatacgagg tcgccaacat cttcttctgg aggccgtggt 420

tggcttgtat ggagcagcag acgcgctact tcgagcggag gcatccggag cttgcaggat 480

cgccgcggct ccgggcgtat atgctccgca ttggtcttga ccaactctat cagagcttgg 540

ttgacggcaa tttcgatgat gcagcttggg cgcagggtcg atgcgacgca atcgtccgat 600

ccggagccgg gactgtcggg cgtacacaaa tcgcccgcag aagcgcggcc gtctggaccg 660

atggctgtgt agaagtactc gccgatagtg gaaaccgacg ccccagcact cgtccgaggg 720

caaaggaata ggcatctcca agttcggctc agagctttac agcgtgaaga aacatatcaa 780

gaccgtcaaa ccagggacgc ttgttcgttt ctactacaca tggaagaaga cagagcgcgg 840

aaagcaggtg tggggcaact actctggccg caagagcaag aaggaggcca aggaagccaa 900

gaaagcggag acagcctcac agaataagat gcaggacgac gtcgcagacg accacgatga 960

ctcggctttc gacgcagcta aagcggcgga aaagaaacgg tctttcattt gcaagttttg 1020

caacaccaag agctcgcgtc agtggagacg cgcgccaaat gcatcaggcg ctctggtcac 1080

ggagagcggg ggcaagggtg ccaacaagga caagggcgtt cagtatgtcg tggcattgtg 1140

tcgaagatgt gctgagctct ggcgccgcta tgccattcag tgggaggatg tcgaccagct 1200

ctacagcaag gtggcacagg ccggtggccg tgcgtggaag aagaagatcg acgaggagct 1260

gctcaaggag atcgttgctg ctgagcaaag aagcaagaac acgccaagca gtagcggtgc 1320

ggctactccg ccatcgaaca ccacgcctgc gcccgcttcc actcaaccag cagcttcggg 1380

tcaagaaccg gcgcggaaga aacagaagac aacgcagccg cctcaagaca aggatgtgga 1440

aatgaccggc acggagcctg ttggcacgac aacaacggcg cccgcatcca agaaaaagga 1500

gaaggccagc ttggaaaagg agaaagagaa ggaaaaggag aaagagaagg aaaaggagaa 1560

ggagaaagaa ccagtcaaag aaaagaagga agcgccggct cctccccctg ttccggagat 1620

acccaagccg cgaacaatgc cttgcgatat ctgtcggcag ctggaacctc tgggcgacca 1680

gcatatcacg tgcaaagaat gtcgcatgac agtgcatcgg aactgctatg gcgtcgtcga 1740

caaccgcaac cctggga 1757

<210> 21

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> P1

<400> 21

ggtaggagaa aggctgatgg 20

<210> 22

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> P2

<400> 22

gcttctgcgg gcgatttgtg ta 22

<210> 23

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> P3

<400> 23

cagcgagagc ctgacctatt gc 22

<210> 24

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> P4

<400> 24

cttcctgacg cttccgataa 20

<210> 25

<211> 57

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-For1

<400> 25

aactgttggg aagggcgatc ggtgcgggcc actagttcat tgttaccgaa agaagcc 57

<210> 26

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-Rev1

<400> 26

aacccttttg agccatgaat tcgacgacca ggcaggcaaa tc 42

<210> 27

<211> 42

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-For2

<400> 27

cctgcctggt cgtcgaattc atggctcaaa agggttcagg tg 42

<210> 28

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-Rev2

<400> 28

agtggattcc caggtagcg 19

<210> 29

<211> 19

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-For3

<400> 29

tgtaccatgc cagcctctg 19

<210> 30

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-Rev3

<400> 30

tgacgcttcc gataatgttc t 21

<210> 31

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-For4

<400> 31

acccaaccag cattcttccc 20

<210> 32

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> SNT2-Rev4

<400> 32

agacagtaga tttcgcaacg 20

<210> 33

<211> 56

<212> DNA

<213> Artificial Sequence

<220>

<223> GFP-SNT2-For

<400> 33

gccagccctt cgttgcgaaa tctactgtct cccgggatgg tgagcaaggg cgagga 56

<210> 34

<211> 57

<212> DNA

<213> Artificial Sequence

<220>

<223> GFP-SNT2-Rev

<400> 34

agtgctcctt caatatcatc ttctgtcgac ggccggccgt ggagatgtgg agtgggc 57

<210> 35

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> BAR-For

<400> 35

gtcgacagaa gatgatattg 20

<210> 36

<211> 75

<212> DNA

<213> Artificial Sequence

<220>

<223> BAR-Rev

<400> 36

ttcacacagg aaacagctat gaccatgatt atttaaatac gcgtggccgg ccgtcgacct 60

aaatctcggt gacgg 75

Claims (8)

1. a kind of pathogenicity proteins for coming from Pyricularia oryzae, it is characterised in that the amino acid sequence of the albumen is as follows：

(1), with SEQ ID No:Amino acid sequence shown in 1；

(2), by SEQ ID No:Amino acid sequence shown in 1 is by the addition of one or several amino acid residues, replacement or scarce Become homeless it is being formed and with rice blast cause a disease sexual function amino acid sequence.

2. encode the gene of the pathogenicity proteins described in claim 1, it is characterised in that the gene have following (a), (b) or (c) nucleotide sequence：

(a) there is SEQ ID No:Nucleotide sequence shown in 2；

(b) under high stringency conditions with SEQ ID No:The nucleotide sequence of nucleotide sequence complementation shown in 2；

(c) by SEQ ID No:Addition, missing or replacement of the nucleotide sequence Jing Guo one or several bases shown in 2 is formed And coding with rice blast pathogenicity proteins function nucleotide sequence.

3. the expression vector containing gene described in claim 2.

4. the pathogenicity proteins described in claim 1 are used as the application for designing or/and screening antifungal drug target.

5. the gene described in claim 2 is used as the application for designing or/and screening antifungal drug target.

6. the application according to claim 4 or 5, it is characterised in that described fungi refers to Pyricularia oryzae (Magnaporthe oryzae)。

7. application of the expression vector on screening antifungal drug described in claim 3.

8. application according to claim 7, it is characterised in that described fungi refers to Pyricularia oryzae (Magnaporthe oryzae)。