CN104087561A

CN104087561A - White green leaf gene WGL1 of rice and application thereof

Info

Publication number: CN104087561A
Application number: CN201410326612.XA
Authority: CN
Inventors: 钱前; 朱丽; 曾大力; 康书静; 杨窑龙; 胡江; 张光恒; 徐杰; 郭龙彪; 董国军; 高振宇; 任德勇; 颜美仙
Original assignee: China National Rice Research Institute
Current assignee: China National Rice Research Institute
Priority date: 2014-07-10
Filing date: 2014-07-10
Publication date: 2014-10-08

Abstract

The invention relates to a white green leaf gene WGL1 of rice which is cloned by a map-based cloning technology and a method for identifying the function of the gene through a transgene complementary experiment and also relates to research on chlorophyll synthesis and chloroplast growth of rice by using the gene, which can be used for explaining the molecular mechanism of rice leaf color change to improve the yield of the rice. Particularly, the invention discloses a protein encoded by white green leaf gene WGL1 of rice and the protein is an amino acid sequence shown in SEQ ID No:3. The invention also discloses the white green leaf gene WGL1 of the rice for coding the protein, and the gene is a nucleotide sequence shown in SEQ ID No:1 and SEQ ID No:2. The white green leaf gene WGL1 of the rice is used for constructing transgenic rice, and the leaf color of the transgenic rice is improved.

Description

Paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 and uses thereof

Technical field

The invention belongs to plant genetic engineering field.Specifically, the present invention relates to a kind ofly utilize map-based cloning cloning rice leaf of Delavey Greenleaf Elaeagnus WGL1 (WHITE GREEN LEAF1) gene, and utilize transgene complementation test to identify the function of this gene; Also relate to simultaneously and utilize this gene studies rice chlorophyll to synthesize and Development of Chloroplasts, in order to the molecular mechanism of explaining that Rice Leaf look changes, improve the output of paddy rice.

Background technology

The growth that photosynthesis is paddy rice provides Material Source and energy derive, and chloroplast(id) is to carry out photosynthetic important place, is also the carrier of photosynthetic pigments simultaneously, is extensively distributed in leaf green histocyte.Chlorophyll is that plant carries out photosynthetic main pigment, participates in catching of luminous energy on antenna complex body, the separation of electric charge and electronics transmission.Chlorophyllously synthetic from L-glutamic acid (glutamate), start that (Chl a) and chlorophyll b (Chl b), needs 18 kinds of enzyme catalysiss to complete altogether to final formation chlorophyll a.In this process, the variation of any inside, external conditions all can cause leaf variegation and show as minus green symptom, as leaf color anomaly phenotypes such as albefaction, yellow, striped, zebras.A plurality of genes synthetic relevant to chlorophyll have been isolated at present, mainly contain OsCHLD, the OsCHLH and the OsCHLI that comprise coding chlorophyll a oxydase OsCAO1 and OsCAO2 and coding magnesium ion chelatase, and the OsDVR gene of coding divinyl reductase enzyme and the YGL1 gene of coding chlorophyll synthase have also been determined synthetic relevant with chlorophyll.

The growth of higher plant chloroplast(id) need, through the change procedure of series of complex, need the albumen of cell nucleus gene coding and the albumen of chloroplast(id) coding to coordinate to have participated in.In dark condition, in blade, non-photosynthetic proplastid develops into etioplast, contains the former lamella of lattice-like in etioplast, through the continuous differentiation and development of illumination etioplast, forms chloroplast(id).

Summary of the invention

The technical problem to be solved in the present invention is to provide a kind of protein and the gene thereof relevant to Rice Leaf chromatic variation, and thus obtained transgenic plant cells, and the method for utilizing described gene pairs rice leaf color to transform.

In order to solve the problems of the technologies described above, the invention provides a kind of protein of paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 coding, this protein is the aminoacid sequence shown in SEQ ID No:3.

Protein improvement as paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 of the present invention coding: described aminoacid sequence is also included in aminoacid sequence or the derivative that add, replace, insert or delete the homologous sequence of one or more amino acid or other species in the aminoacid sequence shown in SEQ ID No:3 and generate.

The present invention also provides the paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 of the above-mentioned protein of encoding simultaneously, and this gene has the nucleotide sequence shown in SEQ ID No:1, SEQ ID No:2.

Remarks explanation: SEQ ID NO:1 is cDNA total length, and " atg " of this sequence section start is initiator codon, " tga " at place, end is terminator codon.

SEQ ID NO:2 is gDNA total length.

Improvement as paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 of the present invention: described nucleotide sequence is also included in the nucleotide sequence shown in SEQ ID No:1 and 2 and adds, to replace, inserts or lacks one or more Nucleotide and the mutant, allelotrope or the derivative that generate.

The present invention also provides the plasmid that contains said gene simultaneously.

The present invention also provides the plant expression vector that contains said gene simultaneously.

The present invention also provides the host cell that contains said gene simultaneously.

Improvement as host cell of the present invention: this cell is Bacillus coli cells, agrobatcerium cell or vegetable cell.

The present invention also provides the method for improvement rice leaf color simultaneously: comprise that using is the gene transformation rice cell of the nucleotide sequence shown in SEQ ID No:1, SEQ ID No:2, then the rice cell after transforming is cultivated into plant.

The present invention also provides the purposes of above-mentioned paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 simultaneously: for building transgenic paddy rice, the leaf look of described transgenic paddy rice is improved.

Further illustrate as follows:

The object of this invention is to provide a kind of new gene WGL1 cloning from paddy rice leaf of Delavey Greenleaf Elaeagnus mutant wgl1, there is the DNA sequence dna as shown in SEQ ID No:1 and SEQ ID No:2, also comprise the gene order that has 70% homology with the DNA sequence dna shown in SEQ ID No:1 and SEQ ID No:2 at least.Protein shown in SEQ ID No:3 in the present invention belongs to NADPH-protochlorophyllide oxide-reductase protein, wherein carries out one or several and replaces, and inserts or lack the functional analogue obtaining.In addition, be also included within the mutant, allelotrope or the derivative that in SEQ ID No:1 and SEQ ID No:2, add, replace, insert or delete one or more Nucleotide and generate, the sequence with identical function also can reach object of the present invention.

Another object of the present invention is to provide a kind of method of carrying out efficient Plant Transformation with WGL1 gene, specifically, the invention provides and there is the gene of sequence shown in SEQ ID No:1 and SEQ ID No:2 or the carrier of Gene Partial fragment, wherein, pCAMBIA1300-WGL1 as shown in Figure 4, this carrier can be expressed above-mentioned nucleotide sequence coded polypeptide or its homology analogue.

The present invention also provides a kind of plant expression vector transformed plant cells of utilizing to affect the method that Rice Leaf look changes.Utilize specifically plant expression vector transformed plant cells to affect the method for Rice Leaf look.

Realize concrete technological step of the present invention as follows:

One, the wgl1 separation of Rice Leaf look leaf of Delavey Greenleaf Elaeagnus mutant and genetic analysis:

The sudden change that Rice Leaf look leaf of Delavey Greenleaf Elaeagnus variant wgl1 of the present invention produces from the fine EMS of Japan (Ethyl Methyl Sulfonate) mutagenesis.Wgl1, by the orthogonal experiment with wild-type paddy rice, proves that this mutant is subject to recessive Dominant gene, as shown in Figure 1.

Two, map based cloning is controlled the WGL1 gene of paddy rice albefaction proterties:

1), the Primary Location of WGL1 gene:

For separated WGL1 gene, first the present invention sets up Liao Yige target group, by wgl1 and rice variety TN1 (Indica) hybridization, combines F ₂target group, then by the method for map based cloning, utilize STS, SSR equimolecular mark to carry out Primary Location to WGL1 site, on No. 10 karyomit(e) is long-armed, and between ks9-37 and ks9-39 two marks, sees Fig. 2 by its Primary Location.

2), the Fine Mapping of WGL1 gene and prediction:

By the BAC sequential analysis between ks9-37 and two marks of ks9-39, developing new SSR, STS mark is accurately positioned WGL1 on BAC AC068923 between ks9-38 and ks9-17 mark, within 54-kb scope (Fig. 3), by analyzing this section open reading frame (ORF), to infer candidate gene.

3), the evaluation of WGL1 gene and functional analysis:

Pass through transgenic technology, result shows that the present invention has obtained the transgenic paddy rice (Fig. 5) that makes mutant recover normal phenotype, proof the present invention has correctly cloned WGL1 gene, and amino acid sequence analysis shows WGL1 coding NADPH-protochlorophyllide oxide-reductase protein (POR).

The white green major cause of rice leaf is due to the green plain biosynthesis block of NADPH-protochlorophyllide redox enzyme mutant posterior lobe, Development of Chloroplasts defect, illustrating chlorophyll synthesizes and photosynthetic molecular mechanism, to solving Rice Leaf chromatic variation problem, improve photosynthetic efficiency, the initiative breeding of high photosynthetic efficiency is significant.The clone of WGL1 gene and application, can be used in and improve leaf color, Delaying Leaf-Senescence.Thereby the present invention, to further illustrating mechanism and the chlorophyll building-up process of Rice Leaf chromatic variation, finally improves rice yield and has certain theory significance.

In sum, the present invention utilizes paddy rice leaf of Delavey Greenleaf Elaeagnus mutant, by map-based cloning, in paddy rice, be cloned into first WGL1 gene, this genes encoding NADPH-protochlorophyllide oxide-reductase protein (POR), in paddy rice, participate in chlorophyllous synthesizing, the homologous gene of other species mainly causes leaf variegation by affecting chlorophyllous growth synthetic and chloroplast(id).By the function of WGL1 gene is understood, further illustrated the mechanism of the synthetic and Development of Chloroplasts of chlorophyll, the molecular mechanism for research leaf variegation lays the first stone simultaneously.

Accompanying drawing explanation

Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.

Fig. 1 is that the phenotype of paddy rice leaf of Delavey Greenleaf Elaeagnus mutant wgl1 and wild-type material (is from left to right followed successively by: the wgl1 of fine, the Japanese fine background of Japan);

Figure A is: the phenotype in mutant and wild-type seedling stage, and mutant Lao Ye blade tip bleaches;

Figure B is: the phenotype in mutant and wild-type tillering phase, and mutant Lao Ye blade tip bleaches, and white portion has a small amount of brown necrotic spot;

Figure C is: the phenotype of mutant same blade tip white in tillering phase (I) and blade bottom light green (II), and blade tip bleaches and follows brown scab, hypophyll pale green;

Figure D is: mutant and the phenotype in wild-type ripening stage, mutant blade recovers pale green.

Fig. 2 is the Primary Location figure of WGL1 gene on paddy rice the 10th karyomit(e).

Fig. 3 is the Fine Mapping figure of WGL1 gene;

Fig. 4 is pCAMBIA1300-WGL1 carrier collection of illustrative plates;

Fig. 5 is function complementation experiment T ₀for transgenic paddy rice, (be from left to right followed successively by: wgl1 plant phenotype is that blade tip is pale and with brown scab; The complementary carrier pCAMBIA1300-WGL1 of the fine conversion of Japan T ₀transgenosis strain, phenotype and common Japan are fine without considerable change; Wgl1 transforms complementary carrier pCAMBIA1300-WGL1, and it is normal that leaf color table type recovers);

Remarks explanation: in Fig. 5, ":: " is front is title material, after be institute's rotaring carrier title.

Fig. 6 is the Contents of Photosynthetic Pigments comparison diagram in mutant wgl1 and NIP seedling stage, tillering phase, ripening stage;

Figure A is: Chlorophyll-a Content; Figure B is: content of chlorophyll b; Figure C is: carotenoid content; Figure D is: chlorophyll a/b; Figure E is: tillering phase wild-type and mutant blade white portion and pale green part Contents of Photosynthetic Pigments; Figure F is: tillering phase wild-type and mutant blade white portion and pale green part chlorophyll a/b.

Fig. 7 is the transmission electron microscope results figure of mutant and wild-type;

Figure A is: wild-type mesophyll cell; Figure B is: the mesophyll cell of mutant wgl1 leaf green part; Figure C is: the mesophyll cell of the pale part of mutant wgl1 blade; Figure D is: the structure of wild-type chloroplast(id); Figure E is: the structure of the chloroplast(id) of mutant wgl1 leaf green part; Figure F is: the chloroplast structure of the pale part of mutant wgl1 blade;

CP-chloroplast(id); G-basal granule; SG-starch small grain.

Embodiment

Embodiment 1:

1, rice material:

Paddy rice (Oryza sativa L.) mutant wgl1 (white green leaf1), original wild material is japonica rice variety " Japan is fine ".

The sudden change (as shown in Figure 1) that paddy rice leaf of Delavey Greenleaf Elaeagnus mutant wgl1 produces from the fine EMS of Japan (Ethyl Methyl Sulfonate) mutagenesis, this mutant is to economize domestic acquisition at Zhejiang Province, China.

Wgl1 builds genetic group by the orthogonal experiment with wild-type kind (that is, rice variety TN1), carries out genetic analysis.The result of experiment is: in M2Dai colony, 51 individual plants of random selection carry out genetic analysis, and 34 strains are wild-type phenotype, and 17 strains are saltant type phenotype, card square examination result (χ ²=1.84< χ ²0.05=3.84), separated than meeting 3:1, illustrate that this mutant phenotype controlled by single recessive nuclear gene.Take mutant wgl1 as maternal, and TN1 is that the F1 generation plant that male parent is carried out quadrature gained all shows as normal phenotype, F2 for planting seed surrounding after, select at random 200 individual plants wherein 156 strains show as wild-type phenotype, 44 strains show as saltant type phenotype.Card square examination result (χ ²=0.95< χ ²0.05=3.84), normal plant phenotype and mutant plant phenotypic segregation ratio meet 3:1; Further this mutant phenotype of proof is controlled by recessive single recessive nuclear gene.

2, analysis and target group:

The wgl1 mutant isozygotying and wild-type kind rice variety TN1 are hybridized, F ₁for selfing, obtain F ₂colony.And therefrom select the obvious leaf of Delavey Greenleaf Elaeagnus wgl1 of 1000 strain phenotype mutated individual as target group.In the phase in tri-leaf period, the tender leaf of 1 gram of left and right is got in every strain, is used for extracting total DNA.

3, SSR and STS mark location WGL1 gene:

Adopt the rapid extracting method of paddy rice minim DNA from rice leaf, to extract the genomic dna for the assignment of genes gene mapping.Get about 0.2g rice leaf, through liquid nitrogen freezing, pulverize in the little mortar of diameter 5cm, transfers in 1.5ml centrifuge tube and extracts DNA, and the DNA of acquisition is precipitated and dissolved in 150 μ l ultrapure waters.Each PCR 2 μ l DNA samples for reaction.The Primary Location of WGL1 gene: at the F of wgl1 and TN1 combination ₂in colony, choose 21 recessive individualities, according to the molecular genetic linkage map of the japonica rice of announcing and long-grained nonglutinous rice establishment, choose the approximate SSR primer on each karyomit(e) that is uniformly distributed in, according to known reaction conditions, carry out pcr amplification, separated and Ethidum Eremide (EB) dyeing through 5% agarose gel electrophoresis, detect the polymorphism of PCR product, by WGL1 Primary Location on No. 10 karyomit(e) is long-armed, between ks9-37 and ks9-39 two STS marks (as shown in Figure 2).

The Fine Mapping of WGL1 gene: the F that chooses wgl1 and TN1 combination ₂in colony, totally 630 strains are recessive individual, on the basis of just locating, further design SSR and STS mark, WGL1 is accurately positioned to be accurately positioned No. BAC within the upper 54-kb scope of AC068923 the most at last, and the molecule marker on both sides is that ks9-38 and ks9-17 primer sequence are:

ks9-38F：ACAGGTCCAACTAATTACATATA，

ks9-38R：AAAGTGAGTCACAAATAAAAG；

ks9-17F：TGCAGCGCAGTTTATACACTGTT，

ks9-17R：TGACACTGTTTCTGGTACTGTTTTACA。

As shown in Figure 3.

The primer sequence above relating to is in Table 1.

The telltale mark sequence of table 1, WGL1 gene

Remarks explanation: Ks9-35, Ks9-27, RM6737, Ks9-37, Ks9-39,10-7, RM3451 and RM4471 are used in " Primary Location of WGL1 gene ", and all the other are Fine Mapping primer.Wherein RM series of markings belongs to the primer of having published, and in common data base, all can find.

4, predictive genes and comparative analysis:

According to the result of Fine Mapping, within the scope of 54-kb, according to the prediction of Rice Automated Annotation System (http://RiceGAAS.dna.affrc.go.jp), find to have 9 candidate genes in this interval.According to the remaining restructuring number of individuals of two marks, we have designed the sequencing primer of each gene, adopt PCR method from wgl1 and wild-type kind genome, to amplify candidate gene respectively and carry out sequencing analysis.Find that the Substitution of 1 base occurs at the 4th the exon place of gene LOC_Os10g35370 wgl1, by G, sport A, make the glycine (Gly) of the 235th amino acid aliphatic category sport the arginine (Arg) of basic aminoacids class.By this result repeated authentication twice, find that mutant wgl1 gene and wild-type and forecasting sequence have the generation (sequencing primer sequence is in Table 2) of catastrophic event.According to the gene annotation information (NCBI) of BAC clone AC068923 sequence, predict this genes encoding OsPORB, this full length gene 3733bp (as shown in the NO2 of sequence table), comprise five introns and three exons, cDNA total length 1209bp (as shown in the NO1 of sequence table), the PORB gene height homology of the WGL1 gene in paddy rice and Chinese sorghum, barley, corn, wheat, short fringe two handle grass and Arabidopis thaliana.

The aminoacid sequence of the protein of this genes encoding is as shown in the SEQ ID No:3 of sequence table.

The sequencing primer sequence of table 2, WGL1 gene

Embodiment 2:

Plant Transformation:

Japonica rice variety " Japan the is fine " genome of take is template, according to goal gene design primer Ks-BamHI (5 '-cacggatccTCTAGCGAGCCCCGGGCTGGGC-3 ') and Ks-EcoRI (5 '-cacgaattcCACTGGTTTCTGCCGTCTGCTG-3 ')

Pcr amplification system (the PCR reaction systems of 50 μ L): template DNA 2 μ L; 2 * PCR buffer25 μ L; 2mmol dNTP (Roche) 10 μ L; KODFX (TOYOBO) enzyme 1 μ L; 10 μ M PrimerF3 μ L; 10 μ M PrimerR3 μ L; ddH ₂o6 μ L;

Pcr amplification condition is: 94 ℃ of denaturation 2min; 98 ℃ of sex change 10s, 60 ℃ of annealing 30s, 68 ℃ are extended 7min; Totally 35 circulations; 68 ℃ of downward-extension 10min, 15 ℃ of insulations.

After pcr amplification, carry out electrophoretic separation, recovery obtains the DNA fragmentation of 6548bp, with BamHI, be connected with after pCAMBIA1300 (p1300) with EcoRI double digestion object fragment, obtained complementary carrier pCAMBIA1300-WGL1, this clone has covered the genome area (having comprised the nucleotide sequence shown in SEQ ID No:2) of whole ORF, also comprises ATG upstream 2218-bp promoter sequence and TGA downstream 1153-bp terminator sequence (as shown in Figure 4).This plasmid proceeds in Agrobacterium (Agrobacterium tumefaciens) strain EHA105 for rice transformation callus by the method for electric shock.We utilize mutant wgl1 mature seed evoked callus, through inducing culture, cultivate (culture condition: 32 ℃ of intensity of illumination 13230Lx), select the vigorous callus of growth as the acceptor transforming after 3 weeks.With the EHA105 bacterial strain that contains the complementary carrier of pCAMBIA1300-WGL1, infect wgl1 callus, 25 ℃ of dark cultivations after 3 days, in the screening culture medium that contains 50mg/L hygromycin B and 400mg/L carboxylic benzyl, cultivate (culture condition: 32 ℃, intensity of illumination 13230Lx, time is about 2 weeks), without Agrobacterium, pollute, and the individuality that has fresh callus to grow is used to differentiation culture (culture condition: 32 ℃, intensity of illumination 13230Lx, time is as the criterion to differentiate seedling), the seedling differentiating goes to and on Rooting and hardening-off culture base, cultivates about 2 weeks (culture condition: 32 ℃, intensity of illumination 13230Lx, ), turn field planting.Plant is identified and continuous observation discovery, and with mutant comparison of the same period, wgl1::pCAMBIA1300-WGL1 transfer-gen plant leaf look reverts to normal green.By above-mentioned transgenic technology, result shows: the present invention has obtained the transgenic paddy rice (Fig. 5) that makes mutant recover normal phenotype.

Illustrate: above the formula of related various substratum can be with reference to Toki S., Hara N., Ono K., Onodera H., Tagiri A., Oka S., Tanaka H. (2006) Early infection of scutellum tissue with Agrobacterium allows high speed transformation of rice.The Plant Journal47:969-976.

Embodiment 3,

Contents of Photosynthetic Pigments is measured:

The blade of getting respectively mutant and wild-type seedling stage, tillering phase and ripening stage and mutant same blade tip in tillering phase (pale part) and hypophyll (pale green part) removes master pulse, be cut into the fragment of 1cm left and right, take 0.2g and be soaked in 10ml80% (volume %) acetone, dark cultivation 48 hours under 26 ℃ of conditions.Get solution and under ultraviolet spectrophotometer (DU800, BECKMAN COULTER) 663nm, 645nm and tri-kinds of wavelength of 470nm, measure the optical density value of chlorophyll a, chlorophyll b, carotenoid.Repeat for 3 times, then according to the method for Amon (1949) calculate the chlorophyll a that respectively detects in blade (Chl a), the content of chlorophyll b (Chl b), according to the content of Wellburn (1994) compute classes carotene (Car), calculation formula is as follows:

chl a＝(12.7×OD ₆₆₃－2.69×OD ₆₄₅)×V/W

chl b＝(22.9×OD ₆₄₅－4.68×OD ₆₆₃)×V/W

car＝(1000×OD ₄₇₀×V/W－3.27×Chl a－104×Chl b)/198

Wherein: V is extracting liquid volume (10ml), and W is leaf quality 0.2g, OD ₆₆₃, OD ₆₄₅and OD ₄₇₀for the optical density value reading on spectrophotometer, unit: mg/g.

Result demonstration, compares with wild-type, and mutant obviously reduces at the content of seedling stage, tillering phase and ripening stage chlorophyll a, chlorophyll b; And carotenoid content only obviously reduces (Fig. 6 A, 6B, 6C) in tillering phase and ripening stage compared with wild-type.Photosynthetic pigments measurement result to the pale part of mutant blade in tillering phase and pale green part shows, the Chlorophylls and Carotenoids content of pale part obviously declines, and content and the wild-type of pale green part carotenoid are basically identical, chlorophyll content also obviously reduce (Fig. 6 E) the same as pale part.Except seedling stage, the ratio of Chl a/b all obviously increases (Fig. 6 D, 6F) at each position of the blade in each period and tillering phase.In a word, the phenotype of mutant changes because Chlorophylls and Carotenoids disappearance causes.

Embodiment 4,

The preparation of chloroplast(id) transmission electron microscope and observation:

(1) sample: get the blade of yellow-white part in mutant seedling leaf, light green part and contrast wild-type, be cut into the fritter of 0.5～1mm3 left and right;

(2) fixing: the sample blocks cutting to be put into 2ml centrifuge tube, add 2.5% glutaraldehyde solution (PH=7.2), in vacuumizing instrument, vacuumize until blade sinks completely.0.1M phosphoric acid rinsing three times, every 15min once, then adds 1% osmic acid to fix 2～3 hours, until sample blackening;

(3) dehydration: first dewater successively with 50%, 70% and 90% ethanolic soln, each concentration is processed 20 minutes, use again ethanol and acetone (1:1) solution-treated 20 minutes, all in 4 degree refrigerators, carry out above, finally by pure acetone room temperature treatment 20 minutes for sample;

(4) infiltration: sample is acted on to 4 hours in anhydrous propanone and embedding medium (3:1) mixed solution, then process 3 hours at anhydrous propanone and embedding medium (1:1) mixed solution, finally act on 12 hours in pure embedding medium;

(5) embedding: in the embedded box that the sample in above-mentioned steps is chosen, 37 ℃ are spent the night, processes last 60 ℃ of processing in 12 hours 24 hours, obtains embedding sample for 45 ℃;

(6) cut into slices, take pictures: embedding sample is cut into the ultrathin section of 60-70nm left and right with ultramicrotome, then will cut into slices and use lead citrate solution-dyed 10 minutes, there are again acetic acid uranium solution dyeing 30 minutes, distilled water dries after cleaning three times, with Hitachi H-7650 type transmission electron microscope observing and select clearly multiple to take pictures.

Result shows that the mesophyll cell Chloroplast number of wild-type blade is more, and chloroplast structure is complete, and in chloroplast(id), basal granule is arranged closely (Fig. 7 A, 7C).Although it is little that the light green of mutant blade is partly compared the variation of wild-type number of chloroplast, the arrangement of grana lamella do not have wild-type so closely, neat (Fig. 7 B, 7D); Pale asphyxia part can obviously be observed in mesophyll cell only has minority chloroplast(id), basal granule reduced number, and the stacking number of plies of basal granule reduces (Fig. 7 C, 7E).Result shows that transgenation has caused mutant Chloroplast destructurized.

Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, can also have many distortion.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.

<110> China Paddy Rice Inst

<120> paddy rice leaf of Delavey Greenleaf Elaeagnus gene wGL1and uses thereof

<160> 3

<210> 1

<211> 1209

<212> cDNA

<213> paddy rice (Oryza sativa)

<400> 1

atggctctcc aggcggccac caccacctcc ttcctcccct ccgcgctctc cgcccgcaag 60

gagggagcgg tgaaggactc ggcgttcttg ggcgttcgtc tcggcgacgg gctcaagctg 120

gagaccagtg ctctcggcct tcgcaccaag agggtgagca cgtcgtcggt ggccatccgc 180

gcgcaggcgt cggcggcggt gtcgtccccg acggtgacgc cggcgtcgcc gtcgggcaag 240

cagacgctgc gcaagggcac ggcggtcatc accggcgcgt cgtccgggct tggcctcgcg 300

acggcgaagg cgctggcgga gacgggcagg tggcacgtcg tcatggggtg ccgcgacttc 360

ctcaaggcgt cgcgcgccgc caaggccgcc ggcatggaga agggcagcta caccatcgtc 420

cacctcgacc tggcgtcgct cgacagcgtc aggcagttcg tcgccaacgt ccggcggctg 480

gagatgcccg tcgacgtggt ggtgtgcaac gccgccgtgt accagcccac cgccaagcag 540

ccgagcttca ccgccgacgg cttcgagatg agcgtcggcg tcaaccacct cgggcacttc 600

ctcctcgccc gcgagctcct cgccgacctc acctcctccg actacccctc caagcgcctc 660

atcatcgtcg gctccatcac cgggaacacg aacacgctgg cggggaacgt gccgccgaag 720

gcgaacctgg gggacctccg ggggctcgcc tcgggcctcg acggcgtgtc gagctccgcc 780

atgatcgacg gcggcgagtt cgacggcgcc aaggcctaca aggacagcaa ggtgtgcaac 840

atgctgacga tgcaggagtt ccaccgccgg taccacggcg agaccggggt gacgttcgcg 900

tcgctctacc ccgggtgcat cgccaccacg ggcctcttcc gggagcacgt cccgctgttc 960

cgcctcctct tcccgccctt ccagaagtac atcaccaagg gctacgtctc cgaggaggag 1020

gccggcaagc ggctggccca ggtcgtcagt gaccccagcc tcaccaagtc cggggtgtac 1080

tggagctgga acaacaactc ggcctcgttc gagaaccagc tctccgagga ggcctccgat 1140

ccggagaagg ccaagaaggt ctgggagctc agcgagaagc tcgtcggctt ggccgatcac 1200

gatcagtga 1209

<210> 2

<211> 3733

<212> gDNA

<213> paddy rice (Oryza sativa)

<400> 2

tcttcttctt ctagcttaga accccaaccc cccaaagcct cactcacttc gctgcagagg 60

aaaaaaaaga gagaaaaatc tccgatggct ctccaggcgg ccaccaccac ctccttcctc 120

ccctccgcgc tctccgcccg caaggaggtg agagctctaa gctcggggat tcagccatgg 180

aggcatttca gagttcagac tagttcagag ttttgcttcg tgttcatggc ggcgattggt 240

taaatggttt tttttttgtt tttgggttgg tttttggggg tgtagggagc ggtgaaggac 300

tcggcgttct tgggcgttcg tctcggcgac gggctcaagc tggagaccag tgctctcggc 360

cttcgcacca aggtagtaac tgtaataatg ttgttacagc actctgcttg ctctgtgctg 420

atgctctgtt tgttagtgct aatattagta cttactacta actggcgagt agtacaagta 480

attggctagt tcgttcagtg aattgccagg ttttcgtttc tagacttcac gattattagt 540

ttcagacttt cagttatgtt ggaggagctt accactgtgg ctctgtggtt tgctctgtca 600

gattaggagc acccgtggcg ttgcaaatgg ttatgcctgt gtttggcatt aatcaactgg 660

ctaatgagat tatatcatga tgattctctc atcgttttag ctatgacaat gtcaggggct 720

tgttttgttt tcacaggtgt gcagctttgc taattgctag taacatcagt gtgtgccgcc 780

attgttagtg caaccaagta gcctttgtgt ctggttaatt tgcaacttca ggttgacatt 840

tggacttgct gagtgagtgt atctagcatt gcaaactgat gtgaattttg acgaactttt 900

agtgcaagat tgcaaggttt gcttgatgta cttagaaatg gtagttgctc acaactctga 960

cagcgccaca aaaattgtat tatacttgat tagcctggca ttttgacttc ctattgatct 1020

ggattttatg tcagtgttag tttgagtata tatagcattg caaagtgatg cgaatttggg 1080

taacttttag tgcaagattg caaggtttac ttgctgtact tagaaatagt tgctcaaaac 1140

tctgacatcg ccacaccccc aaaaaattgt actactactt aattagcttt ggcatttcaa 1200

gttcatattg atgtggatcg atttcataaa cttgatttta ctgcaagact gtcaagtttg 1260

ctccctgtaa tttcataaac ttggttccgc atgtaaacta gacgaattta ttaagcctaa 1320

ttaatccatc attagtaaat atttattgta gcatcacatt attaaatcat agcataatta 1380

gattcaaaag atttgtctca caatttacat ataaactgtg caattatttt tttccccaca 1440

tttaatattc ttgcatgttc aaacatttga tgtgatgttt ttggccaaaa aattttttat 1500

ataaaaacaa aggcctagtt tgttcatata tcttgacatt gttgccacga aaactgaaac 1560

tctcctgcag agggtgagca cgtcgtcggt ggccatccgc gcgcaggcgt cggcggcggt 1620

gtcgtccccg acggtgacgc cggcgtcgcc gtcgggcaag cagacgctgc gcaagggcac 1680

ggcggtcatc accggcgcgt cgtccgggct tggcctcgcg acggcgaagg cgctggcgga 1740

gacgggcagg tggcacgtcg tcatggggtg ccgcgacttc ctcaaggcgt cgcgcgccgc 1800

caaggccgcc ggcatggaga agggcagcta caccatcgtc cacctcgacc tggcgtcgct 1860

cgacagcgtc aggcagttcg tcgccaacgt ccggcggctg gagatgcccg tcgacgtggt 1920

ggtgtgcaac gccgccgtgt accagcccac cgccaagcag ccgagcttca ccgccgacgg 1980

cttcgagatg agcgtcggcg tcaaccacct cgggcacttc ctcctcgccc gcgagctcct 2040

cgccgacctc acctcctccg actacccctc caagcgcctc atcatcgtcg gctccatcac 2100

cggtaatgac aacctttctt cctcaccaga attaggctgt tgtgttctaa tgtcaaagct 2160

tccaacttct actattttgt agttctccac gtacacaatt actacaatta ctgaactgct 2220

aaaaattgca tgttttataa aaaaaattat aggaagttgt tgtgattaat ccaattttta 2280

agtttttctt tttcatcggg aagattgaaa gagaccttct gaatgtatta agaatgagaa 2340

aaagttacaa gaaaaacata ataggaagtt gtcgaggatg atgcgcacca gcgtgtgcgt 2400

tcaagaacca cgagctaacc acacaagcac aaacctctaa aagtgaaaac ttcttcttag 2460

ataatactta attaatggat tatttttctg tgcatggagg gcacaacctt atactgcttt 2520

ctaaaatggg tatgataatt atttgatagt ataaacgaat gaatcaagta ttacaaagtc 2580

gataagctga ttttttttta aaaaaaaact ttataagtgc agttgtaact tttttttaaa 2640

aaaaatatca tatcatttga aagcatatcg gcaacattct attgtaacat gttactataa 2700

gaacatcgtt ctaatttcga tacgatgaat gcagggaaca cgaacacgct ggcggggaac 2760

gtgccgccga aggcgaacct gggggacctc cgggggctcg cctcgggcct cgacggcgtg 2820

tcgagctccg ccatgatcga cggcggcgag ttcgacggcg ccaaggccta caaggacagc 2880

aaggtgtgca acatgctgac gatgcaggag ttccaccgcc ggtaccacgg cgagaccggg 2940

gtgacgttcg cgtcgctcta ccccgggtgc atcgccacca cgggcctctt ccgggagcac 3000

gtcccgctgt tccgcctcct cttcccgccc ttccagaagt acatcaccaa gggctacgtc 3060

tccgaggagg aggccggcaa gcggctggcc caggtcgtca gtgaccccag cctcaccaag 3120

tccggggtgt actggagctg gaacaacaac tcggcctcgt tcgagaacca gctctccgag 3180

gaggcctccg atccggagaa ggccaagaag gtctgggagc tcagcgagaa gctcgtcggc 3240

ttggccgatc acgatcagtg agtgagagtg atgtgctatt gattttcgtc taggattttg 3300

ctgtgctctt cttcttcttc tcctctctac caagaaagat cgatggagga gaatttgtag 3360

gacgcgtttc tcacgaatta cttagctgtt aatgatcagc ttgatgtgta cgatatgatg 3420

gtgcagagtg aaagttgtgt tgttcactgg tggatcatgg gatgggaata tgggattgtt 3480

gtaagatgta actcaagtgt tttctttttt gggattactt ttggtaataa gagcttgggt 3540

gatcgaaaac tacagatggt ttttctttta agttgtatga tctctgtaga gtttttgagt 3600

aatttgtagt tttgtaccct atcaaagatc atctctagct gcctctgagc tctccaactc 3660

tatatgtcca tctctagtat atatgtccca tatttctgac tgaaaatttt caagtcggtt 3720

ggttccctcc gcc 3733

<210> 3

<211> 403

<212> PRT

<213> paddy rice (Oryza sativa)

<400> 3

MET Ala Leu Gln Ala Ala Thr Thr Thr Ser Phe Leu Pro Ser Ala Leu Ser Ala Arg Lys

1 5 10 15 20

Glu Gly Ala Val Lys Asp Ser Ala Phe Leu Gly Val Arg Leu Gly Asp Gly Leu Lys Leu

21 25 30 35 40

Glu Thr Ser Ala Leu Gly Leu Arg Thr Lys Arg Val Ser Thr Ser Ser Val Ala Ile Arg

41 45 50 55 60

Ala Gln Ala Ser Ala Ala Val Ser Ser Pro Thr Val Thr Pro Ala Ser Pro Ser Gly Lys

61 65 70 75 80

Gln Thr Leu Arg Lys Gly Thr Ala Val Ile Thr Gly Ala Ser Ser Gly Leu Gly Leu Ala

81 85 90 95 100

Thr Ala Lys Ala Leu Ala Glu Thr Gly Arg Trp His Val Val MET Gly Cys Arg Asp Phe

101 105 110 115 120

Leu Lys Ala Ser Arg Ala Ala Lys Ala Ala Gly MET Glu Lys Gly Ser Tyr Thr Ile Val

121 125 130 135 140

His Leu Asp Leu Ala Ser Leu Asp Ser Val Arg Gln Phe Val Ala Asn Val Arg Arg Leu

141 145 150 155 160

Glu MET Pro Val Asp Val Val Val Cys Asn Ala Ala Val Tyr Gln Pro Thr Ala Lys Gln

161 165 170 175 180

Pro Ser Phe Thr Ala Asp Gly Phe Glu MET Ser Val Gly Val Asn His Leu Gly His Phe

181 185 190 195 200

Leu Leu Ala Arg Glu Leu Leu Ala Asp Leu Thr Ser Ser Asp Tyr Pro Ser Lys Arg Leu

201 205 210 215 220

Ile Ile Val Gly Ser Ile Thr Gly Asn Thr Asn Thr Leu Ala Gly Asn Val Pro Pro Lys

221 225 230 235 240

Ala Asn Leu Gly Asp Leu Arg Gly Leu Ala Ser Gly Leu Asp Gly Val Ser Ser Ser Ala

241 245 250 255 260

MET Ile Asp Gly Gly Glu Phe Asp Gly Ala Lys Ala Tyr Lys Asp Ser Lys Val Cys Asn

261 265 270 275 280

MET Leu Thr MET Gln Glu Phe His Arg Arg Tyr His Gly Glu Thr Gly Val Thr Phe Ala

281 285 290 295 300

Ser Leu Tyr Pro Gly Cys Ile Ala Thr Thr Gly Leu Phe Arg Glu His Val Pro Leu Phe

301 305 310 315 320

Arg Leu Leu Phe Pro Pro Phe Gln Lys Tyr Ile Thr Lys Gly Tyr Val Ser Glu Glu Glu

321 325 330 335 340

Ala Gly Lys Arg Leu Ala Gln Val Val Ser Asp Pro Ser Leu Thr Lys Ser Gly Val Tyr

341 345 350 355 360

Trp Ser Trp Asn Asn Asn Ser Ala Ser Phe Glu Asn Gln Leu Ser Glu Glu Ala Ser Asp

361 365 370 375 380

Pro Glu Lys Ala Lys Lys Val Trp Glu Leu Ser Glu Lys Leu Val Gly Leu Ala Asp His

381 385 390 395 400

Asp Gln ***

401 402 403

Claims

1. the protein of paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 coding, is characterized in that: this protein is the aminoacid sequence shown in SEQ ID No:3.

2. the protein of paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 according to claim 1 coding, is characterized in that: described aminoacid sequence is also included in aminoacid sequence or the derivative that add, replace, insert or delete the homologous sequence of one or more amino acid or other species in the aminoacid sequence shown in SEQ ID No:3 and generate.

3. the paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 of protein described in coding claim 1 or 2, is characterized in that: this gene is the nucleotide sequence shown in SEQ ID No:1, SEQ ID No:2.

4. paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 according to claim 3, it is characterized in that: described nucleotide sequence is also included in the nucleotide sequence shown in SEQ ID No:1 and 2 and adds, to replace, insert or lack one or more Nucleotide and the mutant, allelotrope or the derivative that generate.

5. a plasmid that contains gene described in claim 3 or 4.

6. a plant expression vector that contains gene described in claim 3 or 4.

7. host cell, is characterized in that: this host cell contains the gene described in claim 3 or 4.

8. host cell according to claim 7, is characterized in that: this cell is Bacillus coli cells, agrobatcerium cell or vegetable cell.

9. a method that improves rice leaf color, is characterized in that: comprise that using is the gene transformation rice cell of the nucleotide sequence shown in SEQ ID No:1, SEQ ID No:2, then the rice cell after transforming is cultivated into plant.

10. the purposes of the paddy rice leaf of Delavey Greenleaf Elaeagnus gene WGL1 as described in claim 3 or 4, is characterized in that: for building transgenic paddy rice, the leaf look of described transgenic paddy rice is improved.