CN108864266A - One kind Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and application - Google Patents
One kind Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and application Download PDFInfo
- Publication number
- CN108864266A CN108864266A CN201810757562.9A CN201810757562A CN108864266A CN 108864266 A CN108864266 A CN 108864266A CN 201810757562 A CN201810757562 A CN 201810757562A CN 108864266 A CN108864266 A CN 108864266A
- Authority
- CN
- China
- Prior art keywords
- ssh1
- plant
- sequence
- gene
- seed
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and applications.Plant phenotype can be regulated and controled using the relevant Protein S SH1 of plant phenotype provided by the invention and its encoding gene:Silencing strain (RNAi-SSH1-1, RNAi-SSH1-2) and the phenotype of mutant ssh1 are almost the same, show as seed holding decline, and seed is elongated;T1It shows as seed holding for SSH1 gene complementation strain (GC-SSH1-1, GC-SSH1-2), overexpression plant (OE-SSH1-1, OE-SSH1-2) to increase, seed shortens.The result shows that plant fallen and/or the relevant Protein S SH1 of grain shape and its encoding gene energy regulating plant fallen and/or grain shape.The present invention is of great significance for rice breeding.
Description
Technical field
The present invention relates to plant genetic engineering fields, and in particular to a kind of albumen relevant to rice seed holding and grain shape
SSH1 and its encoding gene and application.
Background technique
It is also one of the cereal crops tamed earliest, the whole world about one that rice (Oryza sativa L.), which is most important,
The half above population is food with rice.As world population increases year by year, and available cultivated area declines year by year, grain
The unbalanced contradiction of relation between supply and demand becomes increasingly conspicuous.Therefore, more high yields, stable yields, good rice varieties gesture are cultivated must
Row.
Seed holding is one of the Main Agronomic Characters for influencing crop yield and building up, and is all crop genetics research all the time
Emphasis and hot spot, and it is one of critical event during Crop Domestication that seed holding, which reduces or loses,.Seed is after maturation
Natural shattering, this has important ecological significance for it raises up seed, however people are more in Crop Domestication process
The kind for tending to that seed holding is selected to reduce further cultivates to avoid crop loss while improving crop efficiency of crop.
Genetics research the result shows that, rice seed holding is the complicated quantitative character of a typical controlled by multiple genes.
Grain shape is also an important factor for influencing rice yield, and by grain length, grain is wide, grain is thick constitutes.In domesticated breeding, grain
Type is also one of character of artificial selection, provides excellent model for domestication research.
Rice seed holding and grain shape are the Main Agronomic Characters for influencing yield.Therefore, further separation control rice is fallen
The gene of graininess, grain shape is not only to illustrate the molecular regulation mechanism offer reference of seed holding and grain shape, and help to pass through
Molecular breeding means cultivate the moderate new rice variety of new high yield, seed holding.
Summary of the invention
The object of the present invention is to provide a kind of Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and
Using.
Protein provided by the invention is obtained from rice, is named as SSH1 albumen, is following (a1) or (a2):
(a1) protein that the amino acid sequence shown in sequence 1 in sequence table forms;
(a2) amino acid sequence of sequence 1 by the substitution of one or several amino acid residues and/or missing and/or is added
Add and the protein as derived from sequence 1 relevant to vegetable seeds seed holding and/or grain shape.
In order to make SSH1 albumen in (a1) convenient for purifying and detection, can in as sequence table amino acid shown in sequence 1
The amino terminal or carboxyl terminal of the protein of sequence composition connect upper label as shown in Table 1.
The sequence of 1 label of table
SSH1 albumen in above-mentioned (a2) can be artificial synthesized, can also first synthesize its encoding gene, then carries out biological expression and obtain
It arrives.The encoding gene of SSH1 albumen in above-mentioned (a2) can be by will lack one in DNA sequence shown in sequence 4 in sequence table
The codon of a or several amino acid residues, and/or the missense mutation of one or several base-pairs is carried out, and/or at its 5 ' end
And/or 3 ' end connect the coded sequence of label shown in table 1 and obtain.
The gene (SSH1 gene) for encoding the SSH1 albumen also belongs to protection scope of the present invention.
The gene is any DNA molecular in following (b1)-(b5):
(b1) code area DNA molecular as shown in sequence 4 in sequence table;
(b2) DNA molecular shown in 2310-5997 nucleotide of sequence 2 in sequence table;
(b3) DNA molecular shown in 2310-5997 nucleotide of sequence 3 in sequence table;
(b4) hybridize and encode and vegetable seeds with (b1) or (b2) or (b3) DNA sequence dna limited under strict conditions
The DNA molecular of seed holding and/or grain shape GAP-associated protein GAP;
(b5) with (b1) or (b2) or (b3) or (b4) limit DNA sequence dna have 90% or more homology and coding with
The DNA molecular of vegetable seeds seed holding and/or grain shape GAP-associated protein GAP.
Above-mentioned stringent condition can be with 0.1 × SSPE (or 0.1 × SSC), the solution of 0.1%SDS, in DNA or RNA
Hybridize at 65 DEG C in hybrid experiment and washes film.
Recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium containing the SSH1 gene belong to this hair
Bright protection scope.
The recombinant expression carrier of SSH1 gene can be contained with existing plant expression vector construction.The plant expression carries
Body includes double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.It is carried using the gene constructed recombinant expression of SSH1
It, can be before its transcription initiation nucleotide plus any enhanced, composing type, organizing specific type or induction type starting when body
Son, they can be used alone or are used in combination with other plant promoters;In addition, using the gene constructed recombinant expression of SSH1
When carrier, enhancer, including translational enhancer or transcriptional enhancer also can be used, these enhancer regions can be ATG starting
Codon or neighboring region initiation codon etc., but must be identical as the reading frame of coded sequence, to guarantee entire sequence just
Really translation.The source of the translation control signal and initiation codon be it is extensive, can be natural, be also possible to synthesize
's.Translation initiation region can come from transcription initiation region or structural gene.For the ease of to transgenic plant cells or plant
It is identified and is screened, plant expression vector used can be processed, the expression in plant, which is such as added, can produce color change
Enzyme or gene, resistant antibiotic marker or the anti-chemical reagent marker gene of luminophor etc..
The recombinant expression carrier is concretely by the piece between BmaHI the and SpeI restriction enzyme site of plasmid pCAMBIA1301
Section replaces with the recombinant expression carrier that DNA molecular shown in the sequence 4 of sequence table obtains.
The gene or SSH1 gene that the present invention also protects SSH1 albumen are in regulation vegetable seeds seed holding and/or grain shape
Application.
The present invention also protects a kind of method for cultivating genetically modified plants, is the expression for inhibiting SSH1 gene in purpose plant,
Obtain genetically modified plants;The genetically modified plants meet the phenotype of following (c1) and/or (c2):
(c1) seed shattering is lower than the purpose plant;
(c2) seed length is greater than the purpose plant.
The expression for inhibiting SSH1 gene in purpose plant can be realized by importing interference carrier into purpose plant.
The interference carrier is concretely by the piece between SpeI the and SacI restriction enzyme site of plasmid pTCK303/JL1460
Section replaces with the sequence 4 of the sequence table DNA molecular shown in the 1098th to the 1420th from 5 ' ends, and by plasmid
Segment between BamHI the and KpnI restriction enzyme site of pTCK303/JL1460 replaces with the sequence 4 of sequence table from 5 ' ends
The interference carrier that the reverse complementary sequence of DNA molecular shown in 1098 to the 1420th obtains.
The present invention also protects a kind of method for reducing plant fallen and/or increasing seed length, includes the following steps:Drop
The expression quantity and/or activity of SSH1 albumen in low purpose plant reduce plant fallen and/or increase seed length.
The present invention also protects a kind of method for cultivating genetically modified plants, is to be turned SSH1 channel genes purpose plant
Gene plant;The genetically modified plants meet the phenotype of following (d1) and/or (d2):
(d1) seed shattering is higher than the purpose plant;
(d2) seed length is less than the purpose plant.
It is described that SSH1 gene is imported into purpose plant to pass through any description above recombinant expression carrier.The recombination table
Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, mediated by agriculture bacillus can be passed through up to carrier
Equal conventional biology methods are transformed into plant cell or tissue.
The present invention also protects a kind of method for increasing plant fallen and/or reducing seed length, includes the following steps:Increase
Add the expression quantity and/or activity of SSH1 albumen in purpose plant, increase plant fallen and/or reduces seed length.
The present invention also protects SSH1 albumen, or, SSH1 gene, or, any description above method, in plant breeding
Using.
The purpose of the breeding is the plant that breeding plant fallen is low and/or seed length is big.
The purpose of the breeding is the plant that breeding plant fallen is high and/or seed length is small.
Any description above plant is dicotyledon or monocotyledon.The monocotyledon can be planted for Poales
Object.The Poales plant can be gramineae plant.The gramineae plant can be oryza plant.The oryza plant is specific
It can be rice, such as long-grained nonglutinous rice strain YIL100.
Plant phenotype can be regulated and controled using the relevant Protein S SH1 of plant phenotype provided by the invention and its encoding gene:It is heavy
Silent strain (RNAi-SSH1-1, RNAi-SSH1-2) and the phenotype of mutant ssh1 are almost the same, show as seed holding decline,
Seed is elongated;T1For SSH1 gene complementation strain (GC-SSH1-1, GC-SSH1-2), it is overexpressed plant (OE-SSH1-1, OE-
SSH1-2 seed holding increase) is shown as, seed shortens.The result shows that plant fallen and/or the relevant albumen of grain shape
SSH1 and its encoding gene energy regulating plant fallen and/or grain shape.The present invention is of great significance for rice breeding.
Detailed description of the invention
Fig. 1 is long-grained nonglutinous rice strain YIL100 Graphical genotype.
Fig. 2 is the comparison of the phenotype of mutant ssh1 and long-grained nonglutinous rice strain YIL100.
Fig. 3 is the clone of SSH1 gene.
Fig. 4 is mRNA relative expression water of the SSH1 gene in mutant ssh1 and long-grained nonglutinous rice strain YIL100 different tissues
Flat comparison.
Fig. 5 is transgenic plant phenotypic evaluation.
Specific embodiment
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified
It is commercially available from routine biochemistry reagent shop.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result
It is averaged.
Long-grained nonglutinous rice strain YIL100 is originated from Yuanjiang County of Yunnan common wild-rice (O.rufipogon Griff.) as donor parents,
It take Elite Rice kind special green (Oryza sativa ssp.indica) as the introgression line of receptor parent building, the introgression line table
Type is nature shattering.The Yuanjiang County of Yunnan common wild-rice (O.rufipogon Griff.) and Elite Rice kind are special green
(Oryza sativa ssp.indica) is recorded in document:Tan,L.,Li,X.,Liu,F.,Sun,X.,Li,C.,Zhu,
Z., Fu,Y.,Cai,H.,Wang,X.,Xie,D.,and Sun,C.(2008).Control of a key transition
from prostrate to erect growth in rice domestication.Nat.Genet.40:1360–1364.
The public can obtain from China Agricultural University, to repeat this experiment.The construction method of long-grained nonglutinous rice strain YIL100 is recorded in as follows
In offering:Tan L., Liu F.,Xue W.,Wang G.,Ye S.,Zhu Z.,Fu Y.,Wang X.,and Sun C.
(2007).Development of Oryza rufipogon and Oryza sativa introgression lines
and assessment for yield-related quantitative trait loci.JIntegr Plant
Bio.49:871–884.;Long-grained nonglutinous rice strain YIL100 Graphical genotype is as shown in Fig. 1.
Plasmid pCAMBIA1300 is recorded in following document:Tan,L.,Li,X.,Liu,F.,Sun,X.,Li,C.,Zhu,
Z.,Fu,Y.,Cai,H.,Wang,X.,Xie,D.,and Sun,C.(2008).Control of a key transition
from prostrate to erect growth in rice domestication.Nat.Genet.40:1360–1364.
The public can obtain from China Agricultural University, to repeat this experiment.
Plasmid pCAMBIA1301 is recorded in following document:Yu B.,Lin Z.,Lin H.,Li X.,Li J.,Wang
Y., Zhang W., Zhu Z., Zhai W., Wang X., Xie D., Sun C. (2007) .TAC1, a major
Quantitative trait locus controlling tiller angle in rice.Plant J, 52:891-898.
The public can obtain from China Agricultural University, to repeat this experiment.
Plasmid pTCK303/JL1460 is recorded in following document:Wang Z.,Chen C.,Xu Y.,Jiang R.,Han
Y.,Xu Z.,and Chong K.(2004).A Practical Vector for Efficient Knockdown of
Gene Expression in Rice(Oryza sativa L.).Plant Mol.Bio.Rep.22:409-417. public can
To be obtained from China Agricultural University, to repeat this experiment.
Agrobacterium EHA105 is recorded in following document:WuY.,FuY.,ZhaoS.,GuP.,ZhuZ.,SunC.,and
Tan L. (2015).CLUSTERED PRIMARY BRANCH 1,a new allele ofDWARF11,controls
panicle architecture and seedsize inrice.Plant Bio.J.14:377-386. public can be therefrom
Agriculture university of state obtains, to repeat this experiment.
The acquisition of embodiment 1, control rice rice seed holding and grain shape gene SSH1
Long-grained nonglutinous rice strain YIL100 was handled through methane sulfonamide (Ethyl Methyl Sulfone, EMS) and through excessive generation
After selfing and character observation, the mutation system of genotype homozygosis is formed.Screening by being mutated system has found a shattering
Property reduce mutant, which is named as ssh1.
The seed holding comparative experiments result of ssh1 and YIL100 is shown in A, B and C in Fig. 2.The seed shape of ssh1 and YIL100
State compares D, E, F and the G seen in Fig. 2.Compared with YIL100, ssh1 mutant seed holding reduces that (YIL100 shattering rate is
78.97 ± 8.93%, ssh1 shattering rate are 10.99 ± 3.61%).The seed holding comparative experiments result of ssh1 and YIL100 is shown in
A, B and C in Fig. 2.The Grain Morphology of ssh1 and YIL100 compares D, E, F and the G seen in Fig. 2.Compared with YIL100, ssh1
Seed it is elongated (D and E in Fig. 2).
Mutant ssh1 and long-grained nonglutinous rice strain YIL100 is returned, F1In generation, shows as shattering, therefore deduces and control the mutation
The gene of character is recessive.Hybridize F1F is generated after selfing2In offspring, the plant ratio of shattering with not shattering is shown as
Close to 3:1 (205 plants of shatterings, 72 plants do not fall, χ2=0.10<χ2 0.05,1=3.84).So the reduction of ssh1 seed holding is hidden by one
Property Dominant gene, is named as suppression of shattering 1 (ssh1) for the mutated gene.
From F220 plants of dominant shattering single plants of middle selection and 20 plants of recessiveness do not fall single plant and extract DNA respectively, by two groups of DNA points
Other mixed in equal amounts constructs dominant pond and recessive pond and utilizes Illumina HiSeq2500 microarray dataset (the auspicious conjunction Kang Sheng of Beijing shellfish
Object Technology Co., Ltd., item number BFC2013036) it carries out resurveying sequence, it is detected using MutMap strategy in the 7th chromosome
One SNP cluster (A in Fig. 3) chain with not shattering phenotype.Further target gene SSH1 is determined using 72 recessive single plants
Between SNP marker SNV4 and SNV8, physical distance between the two about 3104Kb (B in Fig. 3) is tied on this basis for position
Conjunction full-length genome resurveys sequence and SNP verifying identifies 3 SNP.Genome (http is referred to according to rice://
Rice.plantbiology.msu.edu) annotation and real-time fluorescence quantitative PCR, know that only SNP marker SNV6 is located at gene
It is interior that (there are the single nucleotide variations by base C to A for the 9th introne 3 ' end of LOC Os07g13170, specially
In sequence table shown in sequence 2 and/or sequence 3 the 5782nd, C and D in Fig. 3) and in the absciss layer portion of control seed shattering
Position expression, therefore using LOC_Os07g13170 as candidate gene, and be SSH1 by the unnamed gene.
Wherein, using rice ubiquitin gene, (LOC_Os03g13170.1 is reference gene to real-time fluorescence quantitative PCR.
Identify primer following P1, P2 and P3 used in SSH1 gene expression amount:
P1_F:5 '-TGACTATGAGGACGACTTGA-3 ' (sequence 4 735-754 in sequence table)
P1_R:5 '-AGATGTACTTCTTGCCGAGC-3 ' (the reverse complemental sequence of sequence 4 894-913 in sequence table
Column)
P2_F:5 '-ATGTCCCAGCATCCACATTT-3 ' (sequence 4 1234-1253 in sequence table)
P2_R:5 '-the GGAGTAATGGCAAAGGGGAG3 ' (reverse complemental of sequence 4 1368-1387 in sequence table
Sequence)
P3_F:5 '-GCCACCACCAGTTCTACTTC-3 ' (sequence 4 1472-1491 in sequence table)
P3_R:5 '-the CTCTCTGGACAAACGACGAA3 ' (reverse complemental of sequence 4 1569-1588 in sequence table
Sequence)
Detection ubiquitin gene primer be:
Ubi_F:5'-CTGTCAACTGCCGCAAGAAG-3';
Ubi_R:5’-GGCGAGTGACGCTCTAGTTC-3’。
Expression of results of the SSH1 gene at long-grained nonglutinous rice strain YIL100 and mutant ssh1 different tissues position is shown in Fig. 4, uses P1
When primer detection, SSH1 gene expression quantity no significant difference in two materials.And P2, P3 primer detection are the result shows that mutation
In body expression of the SSH1 gene in different tissues respectively organized compared with YIL100 in lower, thus speculate SNP SNV6 cause
SSH1 gene mRNA expression changes.Wherein DP indicates that developmental rice tassel, AZ indicate that absciss layer, F indicate that rice is small
Flower, number of days before DBP expression is bloomed, DAP indicate Post flowering number of days.
Above-mentioned MutMap strategy refers to following document:(1)Abe,A.,Kosugi,S.,Yoshida,K.,Natsume,S.,
Takagi,H.,Kanzaki,H.,Matsumura,H.,Yoshida,K.,Mitsuoka,C.,Tamiru,M.,Innan,H.,
Cano,L.,Kamoun,S.,and Terauchi,R.(2012).Genome sequencing reveals
agronomically important loci in rice using MutMap.Nat.Biotechnol.30:174–178.;
(2)Lu,H.,Lin,T., Klein,J.,Wang,S.,Qi,J.,Zhou,Q.,Sun,J.,Zhang,Z.,Weng,Y.,and
Huang,S.(2014). QTL-seq identifies an early flowering QTL located near
Flowering Locus T in cucumber. Theor.Appl.Genet.127:1491–1499.;(3)Takagi,H.,
Abe,A.,Yoshida,K.,Kosugi,S., Natsume,S.,Mitsuoka,C.,Uemura,A.,Utsushi,H.,
Tamiru,M.,Takuno,S.,Innan,H., Cano,L.M.,Kamoun,S.,and Terauchi,R.(2013).QTL-
seq:rapid mapping of quantitative trait loci in rice by whole genome
resequencing of DNA from two bulked populations.Plant J.74:174–183.
Genome sequence (http is referred to according to indica rice 93-11://www.gramene.org/) SSH1 gene and its two
Side flanking sequence design primer, primer sequence are as follows:
F:5 '-GGCTCCAAAGTATAAAACAC-3 ' (in sequence table 1-20 of sequence 2 and/or sequence 3);
R:5 '-TCAATAGCATATGTATGCAA-3 ' (7181-7206 of sequence 2 and/or sequence 3 in sequence table
Reverse complementary sequence).
The complete genome DNA of long-grained nonglutinous rice strain YIL100 and mutant ssh1 are extracted using CTAB method.Respectively with the two DNA
For template, the DNA fragmentation that amplification length is about 7.2kb, sequence is respectively sequence 2 and sequence 3 in sequence table.
1-2309 respectively long-grained nonglutinous rice strain YIL100 and mutant ssh1 of sequence 2 and sequence 3 are endogenous in sequence table
SSH1/ssh1 gene 5 ' flanking sequence, 2310-5997 are the SSH1/ssh1 gene order (the containing introne
2729-2830,2857-2978,3010-3092,3181-3291,3438-4051,4097-4186,
4291-4386,4524-4963,5066-5784 are intron sequences).The corresponding SSH1 gene without introne
CDS sequence is as shown in sequence 4 in sequence table.
It is compared and is analyzed according to the SSH1/ssh1 gene sequencing result of long-grained nonglutinous rice strain YIL100 and mutant ssh1, discovery exists
There are the single nucleotide variations by C to A for the 9th introne 3 ' end of SSH1 gene, specific such as sequence 2 and sequence in sequence table
In column 3 shown in the 5782nd.
In sequence table 2310-5997 of sequence 2 and sequence 3 be respectively SSH1 gene in long-grained nonglutinous rice strain YIL100 and
Sequence in mutant ssh1 genome;Sequence 4 is its cDNA sequence (CDS) in sequence table.Sequence 2, sequence 3 in sequence table
With protein (SSH1 albumen) shown in the equal coded sequence 1 of sequence 4.
The application of embodiment 2, SSH1 gene in regulating plant fallen and grain shape
One, the building of recombinant plasmid GC-SSH1
Segment between the KpnI of plasmid pCAMBIA1300 and XbaI enzyme cutting site is replaced with shown in the sequence 2 of sequence table
DNA molecular, obtain recombinant plasmid GC-SSH1 (sequence verification).
Two, the building of recombinant plasmid OE-SSH1
Segment between BmaHI the and SpeI restriction enzyme site of plasmid pCAMBIA1301 is replaced with to 4 institute of sequence of sequence table
The DNA molecular shown obtains recombinant plasmid OE-SSH1 (sequence verification).
Three, the building of recombinant plasmid RNAi-SSH1
Segment between SpeI the and SacI restriction enzyme site of plasmid pTCK303/JL1460 is replaced with to the sequence of sequence table
4 from 5 ' ends DNA molecular shown in the 1098th to the 1420th, and by the BamHI of plasmid pTCK303/JL1460 and
Segment between KpnI restriction enzyme site replaces with the sequence 4 of the sequence table DNA shown in the 1098th to the 1420th from 5 ' ends
The reverse complementary sequence of molecule obtains recombinant plasmid RNAi-SSH1 (sequence verification).
Four, the acquisition of transgenosis complementation plant
1, the recombinant plasmid GC-SSH1 for obtaining step 1 converts Agrobacterium EHA105 using freeze-thaw method, passes through Agrobacterium
Infect the method for Rice Callus for the Agrobacterium-mediated Transformation mutant ssh1 after conversion, with the NB culture medium containing hygromycin into
The wheel of row 3 screening (it is respectively 15mg/L, 25mg/L and 35mg/L that every wheel, which screens hygromycin concentration used), then through pre- differentiation, differentiation
With take root to obtain transgenic plant.
2, after completing step 1, the total DNA of transgenic plant is extracted, with the hygromycin carried on pCAMBIA1300 carrier
Resistant gene carries out PCR identification (the purpose band size of positive plant is 1,254bp), and primer is as follows:
Hpt_F:5’-TGCATCATCGAAATTGCCGT-3’
Hpt_R:5’-AAACGACGGCCAGTGAATTC-3’
It is identified, obtain 11 plants of positive T0For SSH1 gene complementation strain.By T0It is generated for SSH1 gene complementation strain selfing
Seed is named as T1Generation complementary seed, by T1The rice plant that generation complementary seed grows up to is named as T1For SSH1 gene complementation strain.
Two complement strains are randomly choosed, GC-SSH1-1, GC-SSH1-2 are named as.
3, respectively with 0-4cm children's fringe cDNA of GC-SSH1-1, GC-SSH1-2 and mutant ssh1 for template, by glimmering
The relative expression quantity of Fluorescent Quantitative PCR detection SSH1 gene (using rice ubiquitin gene as reference gene, is specifically shown in above-mentioned reality
Apply primer Ubi used in example 1).Identify that the primer of SSH1 gene relative expression quantity is used in above-described embodiment 1
Primer P3.
Using the relative expression quantity of SSH1 gene in mutant ssh1 as 1, T1SSH1 base in 2 strains of generation complementary strain
The relative expression quantity of cause is shown in H in Fig. 5.The result shows that T1Expression quantity in two strains of generation complementary strain significantly improves, respectively
It is 14.8 times and 36.1 times of SSH1 gene in mutant ssh1.
Five, transgenosis is overexpressed the acquisition of plant
1, the recombinant plasmid OE-SSH1 for obtaining step 2 converts Agrobacterium EHA105 using freeze-thaw method, passes through Agrobacterium
Infect the method for Rice Callus for the Agrobacterium-mediated Transformation mutant ssh1 after conversion, with the NB culture medium containing hygromycin into
The wheel of row 3 screening (it is respectively 15mg/L, 25mg/L and 35mg/L that every wheel, which screens hygromycin concentration used), then through pre- differentiation, differentiation
With take root to obtain transgenic plant.
2, after completing step 1, the total DNA of transgenic plant is extracted, with the hygromycin carried on pCAMBIA1301 carrier
Resistant gene carries out PCR identification (the purpose band size of positive plant is 1,254bp), and primer is as follows:
Hpt_F:5’-TGCATCATCGAAATTGCCGT-3’
Hpt_R:5’-AAACGACGGCCAGTGAATTC-3’
It is identified, obtain 17 plants of positive T0For SSH1 gene overexpression plant.By T0Certainly for SSH1 gene overexpression plant
The seed generated is handed over to be named as T1In generation, is overexpressed seed, by T1In generation, is overexpressed the rice plant that seed grows up to and is named as T1For SSH1
Gene overexpression plant.Two overexpression strains are randomly choosed, OE-SSH1-1, OE-SSH1-2 are named as.
3, respectively with 0-4cm children's fringe cDNA of OE-SSH1-1, OE-SSH1-2 and mutant ssh1 for template, by glimmering
The relative expression quantity of Fluorescent Quantitative PCR detection SSH1 gene (using rice ubiquitin gene as reference gene, is specifically shown in above-mentioned reality
Apply primer Ubi used in example 1).Identify that the primer of SSH1 gene relative expression quantity is used in above-described embodiment 1
Primer P3.
Using the relative expression quantity of SSH1 gene in mutant ssh1 as 1, T1In generation, is overexpressed SSH1 in 2 strains of strain
The relative expression quantity of gene is shown in H in Fig. 5.The result shows that T1The expression quantity that generation is overexpressed in two strains of strain significantly improves,
It is 2.2 times and 2.9 times of SSH1 gene in mutant ssh1 respectively.
Six, the acquisition of transgene silencing strain
1, the recombinant plasmid RNAi-SSH1 for obtaining step 3 converts Agrobacterium EHA105 using freeze-thaw method, passes through agriculture bar
Bacterium infects the method for Rice Callus for the Agrobacterium-mediated Transformation wild type YIL100 after conversion, is cultivated with the NB containing hygromycin
3 wheel screening of base progress (it is respectively 15mg/L, 25mg/L and 35 mg/L that every wheel, which screens hygromycin concentration used), then the pre- differentiation of warp,
Break up and takes root to obtain transgenic plant.
2, after completing step 1, the total DNA of transgenic plant is extracted, is directed to pTCK303/JL1460 carrier with following primer
Upper included hygromycin gene carries out PCR identification (the purpose band size of positive plant is 1,254bp):
Hpt_F:5'-TGCATCATCGAAATTGCCGT-3';
Hpt_R:5’-AAACGACGGCCAGTGAATTC-3’。
It is identified, obtain 8 plants of positive T0For SSH1 gene silencing strain.By T0The kind generated for SSH1 gene complementation strain selfing
Son is named as T1For silencing seed, by T1The rice plant grown up to for silencing seed is named as T1For SSH1 gene silencing strain.With
Machine selects two silencing strains, is named as RNAi-SSH1-1, RNAi-SSH1-2.
3, respectively with 0-4cm children's fringe cDNA of RNAi-SSH1-1, RNAi-SSH1-2 and mutant ssh1 for template, lead to
The relative expression quantity for crossing fluorescence quantitative PCR detection SSH1 gene (using rice ubiquitin gene as reference gene, is specifically shown in
State primer Ubi used in embodiment 1).The primer for identifying SSH1 gene is primer P3 used in above-described embodiment 1.
T1See that (wherein WT is long-grained nonglutinous rice strain to H in Fig. 5 for the relative expression quantity of SSH1 gene in 2 strains of silencing strain
YIL100).The result shows that using the relative expression quantity of SSH1 gene in mutant ssh1 as 1, long-grained nonglutinous rice strain YIL100 at this time
The relative expression quantity of middle SSH1 gene is 13.6, T1For the different degrees of downward of the expression quantity in two silencing strains of strain, divide
It Wei not 1.0 (in YIL100 0.074 times of SSH1 gene) and 11.39 (in YIL100 0.84 times of SSH1 gene).
Seven, turn the acquisition of empty carrier plant
1, recombinant plasmid GC-SSH1 is substituted using plasmid pCAMBIA1300, is operated according to step 4, obtains T1Generation
Turn empty carrier plant (pCAMBIA1300).
2, recombinant plasmid OE-SSH1 is substituted using plasmid pCAMBIA1301, is operated according to step 5, obtains T1Generation
Turn empty carrier plant (pCAMBIA1301).
3, recombinant plasmid RNAi-SSH1 is substituted using plasmid pTCK303/JL1460, is operated, is obtained according to step 6
To T1In generation, turns empty carrier plant (pTCK303/JL1460).
Eight, Phenotypic examination
Plant to be measured:Long-grained nonglutinous rice strain YIL100, mutant ssh1, T1For silencing strain (RNAi-SSH1-1, RNAi- SSH1-
2)、T1Generation complementary strain (GC-SSH1-1, GC-SSH1-2), T1In generation, is overexpressed strain (OE-SSH1-1, OE- SSH1-2), T1In generation, turns sky
Carrier plant (pCAMBIA1300), T1In generation, turns empty carrier plant (pCAMBIA1301) and T1In generation, turns empty carrier plant
(pTCK303/JL1460)。
The seed of plant to be measured is seeded into big Tanaka respectively, each strain randomly selects 10 plants, and experiment is in triplicate.
Seed holding, the seed length of plant are investigated after maturation.
Experimental result is shown in Fig. 5, (A figure is stem fringe, and E figure is Grain Morphology, and F is shattering rate, and G is seed length, wherein WT
For long-grained nonglutinous rice strain YIL100).
The result shows that the phenotype of complementary strain, overexpression plant phenotype and YIL100 is almost the same, natural seed holding is extremely strong,
Seed shortens.Silencing strain is consistent with mutant ssh1, and seed holding reduces, and seed is elongated.Turn empty carrier plant
(pCAMBIA1300) and turn empty carrier plant (pCAMBIA1301) phenotype and mutant ssh1 without significant difference.Turn empty carrier
Plant (pTCK303/JL1460) phenotype and wild type YIL100 are without significant difference.
Sequence table
<110>China Agricultural University
<120>One kind Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 436
<212> PRT
<213>Rice (Oryza sativa L.)
<400> 1
Met Val Leu Asp Leu Asn Val Glu Ser Pro Gly Gly Ser Ala Ala Thr
1 5 10 15
Ser Ser Ser Ser Thr Pro Pro Pro Pro Pro Asp Gly Gly Gly Gly Gly
20 25 30
Tyr Phe Arg Phe Asp Leu Leu Gly Gly Ser Pro Asp Glu Asp Gly Cys
35 40 45
Ser Leu Pro Val Met Thr Arg Gln Leu Phe Pro Ser Pro Ser Ala Val
50 55 60
Val Ala Leu Ala Gly Asp Gly Ser Ser Thr Pro Pro Pro Thr Met Pro
65 70 75 80
Thr Pro Ala Ala Ala Gly Glu Gly Pro Trp Pro Arg Arg Ala Ala Asp
85 90 95
Leu Gly Val Ala Gln Ser Gln Arg Ser Pro Ala Gly Gly Lys Lys Ser
100 105 110
Arg Arg Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr Phe
115 120 125
Tyr Arg Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly Lys
130 135 140
Gln Val Tyr Leu Gly Gly Phe Asp Thr Ala His Ala Ala Ala Arg Ala
145 150 155 160
Tyr Asp Arg Ala Ala Ile Lys Phe Arg Gly Leu Asp Ala Asp Ile Asn
165 170 175
Phe Asn Leu Asn Asp Tyr Glu Asp Asp Leu Lys Gln Met Arg Asn Trp
180 185 190
Thr Lys Glu Glu Phe Val His Ile Leu Arg Arg Gln Ser Thr Gly Phe
195 200 205
Ala Arg Gly Ser Ser Lys Tyr Arg Gly Val Thr Leu His Lys Cys Gly
210 215 220
Arg Trp Glu Ala Arg Met Gly Gln Leu Leu Gly Lys Lys Tyr Ile Tyr
225 230 235 240
Leu Gly Leu Phe Asp Ser Glu Ile Glu Ala Ala Arg Ala Tyr Asp Arg
245 250 255
Ala Ala Ile Arg Phe Asn Gly Arg Glu Ala Val Thr Asn Phe Asp Pro
260 265 270
Ser Ser Tyr Asp Gly Asp Val Leu Pro Glu Thr Asp Asn Glu Val Val
275 280 285
Asp Gly Asp Ile Ile Asp Leu Asn Leu Arg Ile Ser Gln Pro Asn Val
290 295 300
His Glu Leu Lys Ser Asp Gly Thr Leu Thr Gly Phe Gln Leu Asn Cys
305 310 315 320
Asp Ser Pro Glu Ala Ser Ser Ser Val Val Thr Gln Pro Ile Ser Pro
325 330 335
Gln Trp Pro Val Leu Pro Gln Gly Thr Ser Met Ser Gln His Pro His
340 345 350
Leu Tyr Ala Ser Pro Cys Pro Gly Phe Phe Val Asn Leu Arg Glu Val
355 360 365
Pro Met Glu Lys Arg Pro Glu Leu Gly Pro Gln Ser Phe Pro Thr Ser
370 375 380
Trp Ser Trp Gln Met Gln Gly Ser Pro Leu Pro Leu Leu Pro Thr Ala
385 390 395 400
Ala Ser Ser Gly Phe Ser Thr Gly Thr Val Ala Asp Ala Ala Arg Ala
405 410 415
Pro Ser Ser Arg Pro His Pro Phe Pro Gly His His Gln Phe Tyr Phe
420 425 430
Pro Pro Thr Thr
435
<210> 2
<211> 7206
<212> DNA
<213>Rice (Oryza sativa L.)
<400> 2
ggctccaaag tataaaacac acaaattctc tcaaattttt aaaaatgttc aaattgtgag 60
tatataccta ggaatataaa tttgattcat ccaaatacct aacaacaaaa caactcaaac 120
tcaactttat ttcacaattc attattacat acctaactaa ttatatgttt ggatgttata 180
tatctagaac caaaatctaa caaaaaaaag ttcaaacttg ttagtaaaga agttaatgtt 240
catatctaaa catttaaaaa aaatttcata ctcattcaac atacacagtg aaaacaacat 300
atccgtttcc ttgtttgtgt aacaagtgtt tggtacttcc tgcccattac tgcacgctgg 360
tggtggacag tagcagcaca ggagaagaca gccatgggga tggggcggcc aatgggaaac 420
tataccggtg gatattttgc cgacaggaaa tgctgcacgc actaaccaat gttgctcaca 480
aagttttttt ttaaaatttt taatttctcc ctcgcatcat gtggtccctg cagatacatc 540
atgtcataaa agtttttctt aacagtgaag tattattatt attattgttt gctcctttga 600
tatttatact tgattatgaa atcaagttta ttgtattatg tagaatatgc agtgccatgc 660
ttgggtgtct ctctcgtcca gaagctgagt tagacttcat ttttttaaaa gattgtacat 720
taatttaacc acaacctaga aagtgcttgt cttgtgcata taaaaacatg tatgttatat 780
tatttttttg tgaggaatat tatggaatgg tggaatatat ttatctcctt ttaaagaagc 840
accttgtttc tatatttcat atccatacct ttaaaaacat cacgttgtat tttgctcctt 900
cgtttgcccg ttagcttatg agtcaaagca aaatttgaat ttttagactt aattctagag 960
ttaattttga ggcatttttt ttattatagt ttagttttca gcattggttt ttaaaattgc 1020
caagagcaca tatatacaaa ttttatacat aaatcaattt ttgttgcttc attctatttt 1080
acaacttaat ggcagagcaa acgatgaaaa taatttatat cgtgtgctct agaaatgttg 1140
ttttcactat atcatggatc agtttaggta gccgtgtaga tatccttact ccgtaataaa 1200
acgagccaac aatgctagct tagagccgtt aattattgtt acaagtaaat gcaaccttaa 1260
tctatatatg cttatctgac ttcaaaagaa gtactccaac catgtaacca aaatccaacc 1320
atgttataag tcgatttaat tattctctag ctacttacta aagtttgata tactcttata 1380
tagagaaaat tagcaacatc tacaatacaa aattagtttt attctaacat tcaacacatt 1440
ttgataatac gttttaaaca ttagtatata attctaaaaa ataaattaaa gcaatgtcga 1500
gtggaaaata caacttttat cactgtgatg caatcctata tacgactacc tttatatact 1560
actccatttt gggttacaag acgtttttac tttggtcaaa atcaaactct ttcaaattta 1620
actaaattta tagatacata tagtaatatt tataatacta aattagtttg attcaatcaa 1680
taattgaata tatattcata ataaatttgt cttgggttga aaatgtatta ttttttttac 1740
aaacttggtt aaacctaaag cagtttaact ttgataaaag gtcaaaacgt cttataatct 1800
agattagagg gaatagtacc agtagtcggc aaacacattg caactattgg gccagagtca 1860
agtcaaacta agcatagcac actcctcctt aatacaccct acatacacaa aaccatacta 1920
ctactactag taggagtctc caccgttctg aaaaaagaaa aagaaaaaaa aaaccctcca 1980
tctcccgccc agtgccgccg cgccacgtca cccctccccc gccgcgcgtg tgtgtacgcg 2040
tagcctttcc ggcggagacg cagcacaaaa atggttttac ctgcgatacc cttcgtctcc 2100
ctcacgtccc atccatccct cccccccctt ttccctcctc ctccacctcc actgccatgg 2160
ccgcctccgc cgctcctctc tcccgcgtgg tagccgccgc cggttgccgc cgctagggga 2220
gcgcgacggg ggagcggtag gggcgaccca gctcgctctg tcgccccgcg gctggtgggg 2280
gtgcgcgcgg gggagagcgg ttggttagta tggtgctgga tctcaatgtg gagtcgccgg 2340
gtgggtcggc ggcgacgtcg agctcgtcca cgccgccgcc gccgcccgac ggtggcggcg 2400
gggggtactt ccggttcgac ctgctcggcg ggagccccga cgaggacggg tgctccctgc 2460
ctgtcatgac gcgccagctc ttcccttcgc cgtctgcggt ggtggcgctg gcgggggacg 2520
ggtcgtcgac gccaccgccg acgatgccga cgccggcggc ggctggggag gggccgtggc 2580
cgcgccgcgc ggcggatctc ggggtggcgc agagccagag gtcccccgcc ggcgggaaga 2640
agagccgccg cggcccgagg tctcggagct cccagtacag gggcgtcacc ttctacagga 2700
ggaccgggcg atgggagtcg cacatctggt tagcttcgcc ttgctcgatt tccctcacgc 2760
tgacttcctc tgcttgactc tgcttgattg gagtagtaat ctcttcgttt gtctcgtcca 2820
attttggcag ggactgcggg aagcaggtgt acctgggtga gctcctattt ctagtctccc 2880
aagctaaatt cgctcgcatg actgctaaat ttggctctct acttagcttg attccgattt 2940
gtttgctcct gccttgtttt ttttttttct gttttcaggt ggtttcgata cagctcatgc 3000
cgcagcgagg ttactataga tggtcaccaa ttgtatctta attgttgctc tggtttgccc 3060
tgtgtgctga gattgtagaa ccccttgtgc agggcctatg atcgcgcggc gatcaagttc 3120
agaggcctcg acgcggatat caactttaat ctgaatgact atgaggacga cttgaagcag 3180
gttgtttgga atatagttca attgtcatgt gtgattcttt aggttctaag gggaggttca 3240
gtcaccggcc tgtgatggtt tatgatggat tggttcgtgc tgtgttgtta gatgcgcaat 3300
tggaccaagg aggagtttgt gcacatactt cggcgccaaa gcacaggatt tgcaaggggg 3360
agctcaaagt accggggtgt gacactgcac aagtgtggcc ggtgggaagc tcggatgggc 3420
cagctgctcg gcaagaagta agatccctga aacattgatt gttcttgcta gtaacttaca 3480
atacaataca ttttagatta gttcaggacc atttttcatg ccatgaacga aaactgtgtc 3540
aagtttgctt ttcaaaaagg gaaagaaaaa aaatgtgtca ctaccaagct ggagaatggt 3600
aggctacccc tggagtccac atccacctga agatttggca ccttgatgtt gactcttcac 3660
acactggcca tttactattg gaacaccaca ggtgttcagt gattatagat tgctagcttc 3720
tttaggaaag aactaagtga atcggaatgg ctcaacggaa ttaattgagg ggaaatgttt 3780
ttgtttcctt ggggattgtg ttttgcgtcc taagtcagtg acaggtgaaa agcttcattt 3840
caatgctctt ggttgttttt gccactaaga atgttctgct tatttacgtt gaatttttga 3900
ttggctgttc gtatcatagt tgtgcatttc ctatatatta caatctttgt gaactttaga 3960
taattctggc atgagctctc tctgtggtat tgttctatta acagaagtat cattctgtca 4020
attccccact gataagtgat cttttgtgca ggtacatcta tctaggattg tttgacagtg 4080
aaattgaggc tgcaaggttc agctagtagt actttgctct tctcagtttg atatgtgctt 4140
gctattccta tacttctctc actttcatct actcttcaac ttgtagagca tatgaccggg 4200
cagctatccg cttcaatgga agggaagctg ttactaattt tgatcctagt tcttatgatg 4260
gagatgttct acctgaaacc gacaatgaag gtatttcttt tgtactatgt atattgtgct 4320
ttatccacta gaacgacaaa tccaaatttt atattaacaa aagcacactg gggattgtct 4380
tagcagtggt tgatggagac atcattgact taaatctgag aatttcacag cctaacgttc 4440
atgagctgaa aagtgatggt accctaactg ggttccagtt gaattgtgat tctcctgaag 4500
cttcaagttc tgttgttact caggtaaata tgctacaata tttggtgttt gtaaccgcta 4560
taccatttga gatttgaccg tcttcagatt cttttgatca ggtggttagt cctttttcat 4620
aacattatac tatcactttc aaaataatta gtacactaat tgtatgtgtc actagaattg 4680
ttgtatgaaa ccatctggga accatcttat gcagcttatt gacaaatgac aactcactgt 4740
tgatgtattc ccaaatcaag aaaagccaat ctttttattc aatttctcca gttcattgaa 4800
ttgaaaaaga aattgccgaa caactaccac ctgaagagac tggctagata ttttgtttat 4860
ctgtgtattt ttataaccta taacagttcc aaagccacaa agctctttta ccttgattct 4920
gataacgtta actgaggtat cattttgtga ttgttttctg tagccaataa gtcctcagtg 4980
gcctgtgctt cctcagggca catcgatgtc ccagcatcca catttatatg catctccttg 5040
tccgggcttc tttgtgaacc tcagggtata tctatcatca aaacttatat gcaatttgaa 5100
aagacagtta aacttgtttc aagttaacat tcgattgcta attagctact acttccatgc 5160
tcctatttct tgagatgacg aaccatatgt ttgttccttt aattacataa tggtagccgt 5220
agatactgtt tgccttgtga actgtcagat atagcaggaa gtaaatctgt cagcttgcaa 5280
ctttccatga accacagctg tccaacttta tacagtggat gatgacttgc atttgataca 5340
tcctagtact ttcttgttgc actctgcagc tttagctctg aagatgctct atatttccat 5400
gaatgctcac gttagctctg aaatttcgaa ctttcactcc ataacatgct catttaggct 5460
gtgtttagat ccaaacttca gttcttttcc atcacatcaa cctgtcatac acacacaact 5520
tttcagtcac atcatctcta atttcaacca aaatccaaac tttgccatca actaaacaca 5580
gccttattca ttgttccacc ttttatttct gccattgcta tggtccaatc ttgatacctc 5640
agagagctgc atgatgtgta gaagtcctaa cttaggtccg ttggttagaa tcatccattc 5700
atgtttagga aaagtgatta acaacgtgtg ctgcattaac cattaatgtg gtcaactctg 5760
atgcttgtgc tatggtcact gcaggaagta cctatggaga aaagacctga gttgggtccc 5820
cagtcgttcc ctacttcgtg gtcatggcaa atgcagggct cccctttgcc attactccct 5880
actgcagcat catcaggatt ctctacgggc accgtcgccg acgccgcccg cgcgccttcc 5940
tcccgccccc atccatttcc cggccaccac cagttctact tccccccgac cacctgactg 6000
ccacctattc tggtggaggc gacgcctcac cgtgcatcca ccgccgcttg ccgataacat 6060
tcgtcgtttg tccagagagg gaccttctcc atatgatatc cctctctatg ttccacctgg 6120
ttatgatcag aattctcacg ctcatgattc ttttatcttc atttttgagt gcgaaaccac 6180
caatcgtgac cgtgctacca ggtaaacacc cttgtacctc tttgactcta caataaaatt 6240
attgtaagat attctggcta aaagtgattg gccctcccta ctgtattttt acagagttgt 6300
aattgaacag tgggcactaa agctggggcc cactcgcacc agtgtctagt ggagcgaagc 6360
tttgcccttt tcttgctatc cagcaactat tcctccgcct gcctccattg ctgacagtgg 6420
agatagcttc ccagtggtca ctgttccact gtactctgtc atagtttctg atcaccccta 6480
ttgtgccttg tctctttcac ctcctccctc acttgtgctg cctctggcca ctagagtggc 6540
gccctgcact gttgccatgc atggctgcca cttcgagagt ggagatgggg gttggccttt 6600
gggtgatttc tgtgtgccat cttttggctc aatgtcgttt tgggactggt gcatgtactg 6660
gcaataggtg agatgagata tgaaatgtcc tctgctgctt tttctatcta aggagtagct 6720
tagctatcac cagctgcctt tctcttctca aataaggttg ttaaaagggg gggtcttaaa 6780
gctaccccaa ctgctgccag gggccctctt caatgccctc ccagctgccg tttctttctt 6840
tattggtttg cttctctgct gcttcttttg cctggttgga tggatgtttg tttgttcgta 6900
tgaattgggg gagctactag tatcattcat gagtagaggc aggcagggca gcgcaggctg 6960
ctggctggcc aggcactgat gtgccaacag ctatttccag tgaaacggct gccatttttc 7020
tttgctggga ttgtgatagt ggtaggctgg tagtactagc tagcagtgta ttgggggaaa 7080
tactggtggt ccatttgcct gttagccaat ctgatgcttg cctttccatc cgctggtgat 7140
ggtccatttg ctttggcatc ttgcttgcct gttagtacta caaaagttgc atacatatgc 7200
tattga 7206
<210> 3
<211> 7206
<212> DNA
<213>Rice (Oryza sativa L.)
<400> 3
ggctccaaag tataaaacac acaaattctc tcaaattttt aaaaatgttc aaattgtgag 60
tatataccta ggaatataaa tttgattcat ccaaatacct aacaacaaaa caactcaaac 120
tcaactttat ttcacaattc attattacat acctaactaa ttatatgttt ggatgttata 180
tatctagaac caaaatctaa caaaaaaaag ttcaaacttg ttagtaaaga agttaatgtt 240
catatctaaa catttaaaaa aaatttcata ctcattcaac atacacagtg aaaacaacat 300
atccgtttcc ttgtttgtgt aacaagtgtt tggtacttcc tgcccattac tgcacgctgg 360
tggtggacag tagcagcaca ggagaagaca gccatgggga tggggcggcc aatgggaaac 420
tataccggtg gatattttgc cgacaggaaa tgctgcacgc actaaccaat gttgctcaca 480
aagttttttt ttaaaatttt taatttctcc ctcgcatcat gtggtccctg cagatacatc 540
atgtcataaa agtttttctt aacagtgaag tattattatt attattgttt gctcctttga 600
tatttatact tgattatgaa atcaagttta ttgtattatg tagaatatgc agtgccatgc 660
ttgggtgtct ctctcgtcca gaagctgagt tagacttcat ttttttaaaa gattgtacat 720
taatttaacc acaacctaga aagtgcttgt cttgtgcata taaaaacatg tatgttatat 780
tatttttttg tgaggaatat tatggaatgg tggaatatat ttatctcctt ttaaagaagc 840
accttgtttc tatatttcat atccatacct ttaaaaacat cacgttgtat tttgctcctt 900
cgtttgcccg ttagcttatg agtcaaagca aaatttgaat ttttagactt aattctagag 960
ttaattttga ggcatttttt ttattatagt ttagttttca gcattggttt ttaaaattgc 1020
caagagcaca tatatacaaa ttttatacat aaatcaattt ttgttgcttc attctatttt 1080
acaacttaat ggcagagcaa acgatgaaaa taatttatat cgtgtgctct agaaatgttg 1140
ttttcactat atcatggatc agtttaggta gccgtgtaga tatccttact ccgtaataaa 1200
acgagccaac aatgctagct tagagccgtt aattattgtt acaagtaaat gcaaccttaa 1260
tctatatatg cttatctgac ttcaaaagaa gtactccaac catgtaacca aaatccaacc 1320
atgttataag tcgatttaat tattctctag ctacttacta aagtttgata tactcttata 1380
tagagaaaat tagcaacatc tacaatacaa aattagtttt attctaacat tcaacacatt 1440
ttgataatac gttttaaaca ttagtatata attctaaaaa ataaattaaa gcaatgtcga 1500
gtggaaaata caacttttat cactgtgatg caatcctata tacgactacc tttatatact 1560
actccatttt gggttacaag acgtttttac tttggtcaaa atcaaactct ttcaaattta 1620
actaaattta tagatacata tagtaatatt tataatacta aattagtttg attcaatcaa 1680
taattgaata tatattcata ataaatttgt cttgggttga aaatgtatta ttttttttac 1740
aaacttggtt aaacctaaag cagtttaact ttgataaaag gtcaaaacgt cttataatct 1800
agattagagg gaatagtacc agtagtcggc aaacacattg caactattgg gccagagtca 1860
agtcaaacta agcatagcac actcctcctt aatacaccct acatacacaa aaccatacta 1920
ctactactag taggagtctc caccgttctg aaaaaagaaa aagaaaaaaa aaaccctcca 1980
tctcccgccc agtgccgccg cgccacgtca cccctccccc gccgcgcgtg tgtgtacgcg 2040
tagcctttcc ggcggagacg cagcacaaaa atggttttac ctgcgatacc cttcgtctcc 2100
ctcacgtccc atccatccct cccccccctt ttccctcctc ctccacctcc actgccatgg 2160
ccgcctccgc cgctcctctc tcccgcgtgg tagccgccgc cggttgccgc cgctagggga 2220
gcgcgacggg ggagcggtag gggcgaccca gctcgctctg tcgccccgcg gctggtgggg 2280
gtgcgcgcgg gggagagcgg ttggttagta tggtgctgga tctcaatgtg gagtcgccgg 2340
gtgggtcggc ggcgacgtcg agctcgtcca cgccgccgcc gccgcccgac ggtggcggcg 2400
gggggtactt ccggttcgac ctgctcggcg ggagccccga cgaggacggg tgctccctgc 2460
ctgtcatgac gcgccagctc ttcccttcgc cgtctgcggt ggtggcgctg gcgggggacg 2520
ggtcgtcgac gccaccgccg acgatgccga cgccggcggc ggctggggag gggccgtggc 2580
cgcgccgcgc ggcggatctc ggggtggcgc agagccagag gtcccccgcc ggcgggaaga 2640
agagccgccg cggcccgagg tctcggagct cccagtacag gggcgtcacc ttctacagga 2700
ggaccgggcg atgggagtcg cacatctggt tagcttcgcc ttgctcgatt tccctcacgc 2760
tgacttcctc tgcttgactc tgcttgattg gagtagtaat ctcttcgttt gtctcgtcca 2820
attttggcag ggactgcggg aagcaggtgt acctgggtga gctcctattt ctagtctccc 2880
aagctaaatt cgctcgcatg actgctaaat ttggctctct acttagcttg attccgattt 2940
gtttgctcct gccttgtttt ttttttttct gttttcaggt ggtttcgata cagctcatgc 3000
cgcagcgagg ttactataga tggtcaccaa ttgtatctta attgttgctc tggtttgccc 3060
tgtgtgctga gattgtagaa ccccttgtgc agggcctatg atcgcgcggc gatcaagttc 3120
agaggcctcg acgcggatat caactttaat ctgaatgact atgaggacga cttgaagcag 3180
gttgtttgga atatagttca attgtcatgt gtgattcttt aggttctaag gggaggttca 3240
gtcaccggcc tgtgatggtt tatgatggat tggttcgtgc tgtgttgtta gatgcgcaat 3300
tggaccaagg aggagtttgt gcacatactt cggcgccaaa gcacaggatt tgcaaggggg 3360
agctcaaagt accggggtgt gacactgcac aagtgtggcc ggtgggaagc tcggatgggc 3420
cagctgctcg gcaagaagta agatccctga aacattgatt gttcttgcta gtaacttaca 3480
atacaataca ttttagatta gttcaggacc atttttcatg ccatgaacga aaactgtgtc 3540
aagtttgctt ttcaaaaagg gaaagaaaaa aaatgtgtca ctaccaagct ggagaatggt 3600
aggctacccc tggagtccac atccacctga agatttggca ccttgatgtt gactcttcac 3660
acactggcca tttactattg gaacaccaca ggtgttcagt gattatagat tgctagcttc 3720
tttaggaaag aactaagtga atcggaatgg ctcaacggaa ttaattgagg ggaaatgttt 3780
ttgtttcctt ggggattgtg ttttgcgtcc taagtcagtg acaggtgaaa agcttcattt 3840
caatgctctt ggttgttttt gccactaaga atgttctgct tatttacgtt gaatttttga 3900
ttggctgttc gtatcatagt tgtgcatttc ctatatatta caatctttgt gaactttaga 3960
taattctggc atgagctctc tctgtggtat tgttctatta acagaagtat cattctgtca 4020
attccccact gataagtgat cttttgtgca ggtacatcta tctaggattg tttgacagtg 4080
aaattgaggc tgcaaggttc agctagtagt actttgctct tctcagtttg atatgtgctt 4140
gctattccta tacttctctc actttcatct actcttcaac ttgtagagca tatgaccggg 4200
cagctatccg cttcaatgga agggaagctg ttactaattt tgatcctagt tcttatgatg 4260
gagatgttct acctgaaacc gacaatgaag gtatttcttt tgtactatgt atattgtgct 4320
ttatccacta gaacgacaaa tccaaatttt atattaacaa aagcacactg gggattgtct 4380
tagcagtggt tgatggagac atcattgact taaatctgag aatttcacag cctaacgttc 4440
atgagctgaa aagtgatggt accctaactg ggttccagtt gaattgtgat tctcctgaag 4500
cttcaagttc tgttgttact caggtaaata tgctacaata tttggtgttt gtaaccgcta 4560
taccatttga gatttgaccg tcttcagatt cttttgatca ggtggttagt cctttttcat 4620
aacattatac tatcactttc aaaataatta gtacactaat tgtatgtgtc actagaattg 4680
ttgtatgaaa ccatctggga accatcttat gcagcttatt gacaaatgac aactcactgt 4740
tgatgtattc ccaaatcaag aaaagccaat ctttttattc aatttctcca gttcattgaa 4800
ttgaaaaaga aattgccgaa caactaccac ctgaagagac tggctagata ttttgtttat 4860
ctgtgtattt ttataaccta taacagttcc aaagccacaa agctctttta ccttgattct 4920
gataacgtta actgaggtat cattttgtga ttgttttctg tagccaataa gtcctcagtg 4980
gcctgtgctt cctcagggca catcgatgtc ccagcatcca catttatatg catctccttg 5040
tccgggcttc tttgtgaacc tcagggtata tctatcatca aaacttatat gcaatttgaa 5100
aagacagtta aacttgtttc aagttaacat tcgattgcta attagctact acttccatgc 5160
tcctatttct tgagatgacg aaccatatgt ttgttccttt aattacataa tggtagccgt 5220
agatactgtt tgccttgtga actgtcagat atagcaggaa gtaaatctgt cagcttgcaa 5280
ctttccatga accacagctg tccaacttta tacagtggat gatgacttgc atttgataca 5340
tcctagtact ttcttgttgc actctgcagc tttagctctg aagatgctct atatttccat 5400
gaatgctcac gttagctctg aaatttcgaa ctttcactcc ataacatgct catttaggct 5460
gtgtttagat ccaaacttca gttcttttcc atcacatcaa cctgtcatac acacacaact 5520
tttcagtcac atcatctcta atttcaacca aaatccaaac tttgccatca actaaacaca 5580
gccttattca ttgttccacc ttttatttct gccattgcta tggtccaatc ttgatacctc 5640
agagagctgc atgatgtgta gaagtcctaa cttaggtccg ttggttagaa tcatccattc 5700
atgtttagga aaagtgatta acaacgtgtg ctgcattaac cattaatgtg gtcaactctg 5760
atgcttgtgc tatggtcact gcaggaagta cctatggaga aaagacctga gttgggtccc 5820
cagtcgttcc ctacttcgtg gtaatggcaa atgcagggct cccctttgcc attactccct 5880
actgcagcat catcaggatt ctctacgggc accgtcgccg acgccgcccg cgcgccttcc 5940
tcccgccccc atccatttcc cggccaccac cagttctact tccccccgac cacctgactg 6000
ccacctattc tggtggaggc gacgcctcac cgtgcatcca ccgccgcttg ccgataacat 6060
tcgtcgtttg tccagagagg gaccttctcc atatgatatc cctctctatg ttccacctgg 6120
ttatgatcag aattctcacg ctcatgattc ttttatcttc atttttgagt gcgaaaccac 6180
caatcgtgac cgtgctacca ggtaaacacc cttgtacctc tttgactcta caataaaatt 6240
attgtaagat attctggcta aaagtgattg gccctcccta ctgtattttt acagagttgt 6300
aattgaacag tgggcactaa agctggggcc cactcgcacc agtgtctagt ggagcgaagc 6360
tttgcccttt tcttgctatc cagcaactat tcctccgcct gcctccattg ctgacagtgg 6420
agatagcttc ccagtggtca ctgttccact gtactctgtc atagtttctg atcaccccta 6480
ttgtgccttg tctctttcac ctcctccctc acttgtgctg cctctggcca ctagagtggc 6540
gccctgcact gttgccatgc atggctgcca cttcgagagt ggagatgggg gttggccttt 6600
gggtgatttc tgtgtgccat cttttggctc aatgtcgttt tgggactggt gcatgtactg 6660
gcaataggtg agatgagata tgaaatgtcc tctgctgctt tttctatcta aggagtagct 6720
tagctatcac cagctgcctt tctcttctca aataaggttg ttaaaagggg gggtcttaaa 6780
gctaccccaa ctgctgccag gggccctctt caatgccctc ccagctgccg tttctttctt 6840
tattggtttg cttctctgct gcttcttttg cctggttgga tggatgtttg tttgttcgta 6900
tgaattgggg gagctactag tatcattcat gagtagaggc aggcagggca gcgcaggctg 6960
ctggctggcc aggcactgat gtgccaacag ctatttccag tgaaacggct gccatttttc 7020
tttgctggga ttgtgatagt ggtaggctgg tagtactagc tagcagtgta ttgggggaaa 7080
tactggtggt ccatttgcct gttagccaat ctgatgcttg cctttccatc cgctggtgat 7140
ggtccatttg ctttggcatc ttgcttgcct gttagtacta caaaagttgc atacatatgc 7200
tattga 7206
<210> 4
<211> 1909
<212> DNA
<213>Rice (Oryza sativa L.)
<400> 4
atccctcccc ccccttttcc ctcctcctcc acctccactg ccatggccgc ctccgccgct 60
cctctctccc gcgtggtagc cgccgccggt tgccgccgct aggggagcgc gacgggggag 120
cggtaggggc gacccagctc gctctgtcgc cccgcggctg gtgggggtgc gcgcggggga 180
gagcggttgg ttagtatggt gctggatctc aatgtggagt cgccgggtgg gtcggcggcg 240
acgtcgagct cgtccacgcc gccgccgccg cccgacggtg gcggcggggg gtacttccgg 300
ttcgacctgc tcggcgggag ccccgacgag gacgggtgct ccctgcctgt catgacgcgc 360
cagctcttcc cttcgccgtc tgcggtggtg gcgctggcgg gggacgggtc gtcgacgcca 420
ccgccgacga tgccgacgcc ggcggcggct ggggaggggc cgtggccgcg ccgcgcggcg 480
gatctcgggg tggcgcagag ccagaggtcc cccgccggcg ggaagaagag ccgccgcggc 540
ccgaggtctc ggagctccca gtacaggggc gtcaccttct acaggaggac cgggcgatgg 600
gagtcgcaca tctgggactg cgggaagcag gtgtacctgg gtggtttcga tacagctcat 660
gccgcagcga gggcctatga tcgcgcggcg atcaagttca gaggcctcga cgcggatatc 720
aactttaatc tgaatgacta tgaggacgac ttgaagcaga tgcgcaattg gaccaaggag 780
gagtttgtgc acatacttcg gcgccaaagc acaggatttg caagggggag ctcaaagtac 840
cggggtgtga cactgcacaa gtgtggccgg tgggaagctc ggatgggcca gctgctcggc 900
aagaagtaca tctatctagg attgtttgac agtgaaattg aggctgcaag agcatatgac 960
cgggcagcta tccgcttcaa tggaagggaa gctgttacta attttgatcc tagttcttat 1020
gatggagatg ttctacctga aaccgacaat gaagtggttg atggagacat cattgactta 1080
aatctgagaa tttcacagcc taacgttcat gagctgaaaa gtgatggtac cctaactggg 1140
ttccagttga attgtgattc tcctgaagct tcaagttctg ttgttactca gccaataagt 1200
cctcagtggc ctgtgcttcc tcagggcaca tcgatgtccc agcatccaca tttatatgca 1260
tctccttgtc cgggcttctt tgtgaacctc agggaagtac ctatggagaa aagacctgag 1320
ttgggtcccc agtcgttccc tacttcgtgg tcatggcaaa tgcagggctc ccctttgcca 1380
ttactcccta ctgcagcatc atcaggattc tctacgggca ccgtcgccga cgccgcccgc 1440
gcgccttcct cccgccccca tccatttccc ggccaccacc agttctactt ccccccgacc 1500
acctgactgc cacctattct ggtggaggcg acgcctcacc gtgcatccac cgccgcttgc 1560
cgataacatt cgtcgtttgt ccagagaggg accttctcca tatgatatcc ctctctatgt 1620
tccacctggt tatgatcaga attctcacgc tcatgattct tttatcttca tttttgagtg 1680
cgaaaccacc aatcgtgacc gtgctaccag gtaaacaccc ttgtacctct ttgactctac 1740
aataaaatta ttgtaagata ttctggctaa aagtgattgg ccctccctac tgtattttta 1800
cagagttgta atttgaacag tgggcactaa agctggggcc cactcgcacc agtgtctagt 1860
ggagcgaagc tttgcccttt tcttgctatc cagcaactat tcctccgcc 1909
Claims (10)
1. a kind of protein is following (a1) or (a2):
(a1) protein that the amino acid sequence shown in sequence 1 in sequence table forms;
(a2) by the amino acid sequence of sequence 1 by one or several amino acid residues substitution and/or deletion and/or addition and
The protein as derived from sequence 1 relevant to vegetable seeds seed holding and/or grain shape.
2. encoding the gene of protein described in claim 1.
3. gene as claimed in claim 2, it is characterised in that:The gene is any DNA in following (b1)-(b5)
Molecule:
(b1) code area DNA molecular as shown in sequence 4 in sequence table;
(b2) DNA molecular shown in 2310-5997 nucleotide of sequence 2 in sequence table;
(b3) DNA molecular shown in 2310-5997 nucleotide of sequence 3 in sequence table;
(b4) hybridize and encode and vegetable seeds seed holding with (b1) or (b2) or (b3) DNA sequence dna limited under strict conditions
And/or the DNA molecular of grain shape GAP-associated protein GAP;
(b5) DNA sequence dna limited with (b1) or (b2) or (b3) or (b4) is with 90% or more homology and coding and plant species
The DNA molecular of sub- seed holding and/or grain shape GAP-associated protein GAP.
4. recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium containing gene described in Claims 2 or 3.
5. protein described in claim 1, or, gene described in Claims 2 or 3, in regulation vegetable seeds seed holding and/or grain
Application in type.
6. a kind of method for cultivating genetically modified plants, is the expression for inhibiting gene described in Claims 2 or 3 in purpose plant, obtains
To genetically modified plants;The genetically modified plants meet the phenotype of following (c1) and/or (c2):
(c1) seed shattering is lower than the purpose plant;
(c2) seed length is greater than the purpose plant.
7. a kind of method for reducing plant fallen and/or increasing seed length, includes the following steps:It reduces and is weighed in purpose plant
Benefit require 1 described in protein expression quantity and/or activity, reduce plant fallen and/or increase seed length.
8. a kind of method for cultivating genetically modified plants, is to obtain channel genes purpose plant described in Claims 2 or 3 to turn base
Because of plant;The genetically modified plants meet the phenotype of following (d1) and/or (d2):
(d1) seed shattering is higher than the purpose plant;
(d2) seed length is less than the purpose plant.
9. a kind of method for increasing plant fallen and/or reducing seed length, includes the following steps:Increase and is weighed in purpose plant
Benefit require 1 described in protein expression quantity and/or activity, increase plant fallen and/or reduce seed length.
10. protein described in claim 1, or, gene described in Claims 2 or 3, or, claim 6-9 is any described
Method, the application in plant breeding.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810757562.9A CN108864266B (en) | 2018-07-11 | 2018-07-11 | Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201810757562.9A CN108864266B (en) | 2018-07-11 | 2018-07-11 | Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN108864266A true CN108864266A (en) | 2018-11-23 |
CN108864266B CN108864266B (en) | 2020-08-18 |
Family
ID=64300981
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201810757562.9A Active CN108864266B (en) | 2018-07-11 | 2018-07-11 | Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN108864266B (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109486830A (en) * | 2018-12-11 | 2019-03-19 | 上海市农业生物基因中心 | Rice SNB gene and application, the method for regulating and controlling seed size |
CN109535237A (en) * | 2019-01-07 | 2019-03-29 | 中国农业大学 | A kind of method and its application for cultivating high-yield culturing rice |
CN109628486A (en) * | 2019-02-02 | 2019-04-16 | 中国科学院植物研究所 | OsSYF2 albumen and its encoding gene and its application in adjusting and controlling rice grain length |
CN108864266B (en) * | 2018-07-11 | 2020-08-18 | 中国农业大学 | Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1586652A1 (en) * | 2004-03-25 | 2005-10-19 | Monsanto Technology LLC | Genes and uses for plant improvement |
CN106701778A (en) * | 2015-11-16 | 2017-05-24 | 华中农业大学 | Method for increasing grain number per ear and reducing plant height by use of rice SNB genes |
CN108676796A (en) * | 2018-01-17 | 2018-10-19 | 上海市农业生物基因中心 | The molecular labeling of rice grain shape gene OsSNB and its application |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108864266B (en) * | 2018-07-11 | 2020-08-18 | 中国农业大学 | Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof |
-
2018
- 2018-07-11 CN CN201810757562.9A patent/CN108864266B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1586652A1 (en) * | 2004-03-25 | 2005-10-19 | Monsanto Technology LLC | Genes and uses for plant improvement |
CN106701778A (en) * | 2015-11-16 | 2017-05-24 | 华中农业大学 | Method for increasing grain number per ear and reducing plant height by use of rice SNB genes |
CN108676796A (en) * | 2018-01-17 | 2018-10-19 | 上海市农业生物基因中心 | The molecular labeling of rice grain shape gene OsSNB and its application |
Non-Patent Citations (4)
Title |
---|
LIYUN JIANG,等: "The APETALA2-Like Transcription Factor SUPERNUMERARY BRACT Controls Rice Seed Shattering and Seed Size", 《THE PLANT CELL》 * |
YU J.等: "EEC81767", 《EMBL》 * |
王磊: "水稻全生育期基因表达谱构建与侧生分枝发育的基因调控网络研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
蒋丽芸等: "转录因子 SNB 调控水稻落粒性与粒型的分子机制", 《2019 年中国作物学会学术年会论文摘要集》 * |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108864266B (en) * | 2018-07-11 | 2020-08-18 | 中国农业大学 | Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof |
CN109486830A (en) * | 2018-12-11 | 2019-03-19 | 上海市农业生物基因中心 | Rice SNB gene and application, the method for regulating and controlling seed size |
CN109535237A (en) * | 2019-01-07 | 2019-03-29 | 中国农业大学 | A kind of method and its application for cultivating high-yield culturing rice |
CN109535237B (en) * | 2019-01-07 | 2020-07-14 | 中国农业大学 | Method for cultivating high-yield cultivated rice and application thereof |
CN109628486A (en) * | 2019-02-02 | 2019-04-16 | 中国科学院植物研究所 | OsSYF2 albumen and its encoding gene and its application in adjusting and controlling rice grain length |
CN109628486B (en) * | 2019-02-02 | 2020-07-24 | 中国科学院植物研究所 | OsSYF2 protein, coding gene thereof and application thereof in regulation and control of rice grain length |
Also Published As
Publication number | Publication date |
---|---|
CN108864266B (en) | 2020-08-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9309527B2 (en) | Protein IPA1 related to plant architecture, its coding genes and uses | |
CN105602952B (en) | A kind of fertile gene and its application | |
CN100381465C (en) | Bacterial leaf spot resistance related protein and its coding gene and uses | |
CN106399323B (en) | A kind of Rice Leaf color controlling gene YL1 and its application | |
CN108864266A (en) | One kind Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and application | |
CN101704881B (en) | Plant male fertility-associated protein, coding gene and application thereof | |
CN107164401A (en) | A kind of method and application that rice Os PIL15 mutant is prepared based on CRISPR/Cas9 technologies | |
CN106868021B (en) | Gene OsNAC1 for controlling rice seed size and application thereof | |
CN107205354A (en) | Haploid induction thing | |
CN101379080B (en) | Nucleic acids and methods for producing seeds having a all-diploid of the maternal genome in the embryo | |
CN108822194B (en) | Plant starch synthesis related protein OsFLO10, and coding gene and application thereof | |
US20100043104A1 (en) | Application of fluorescent protein to garden plant | |
CN108642065B (en) | Rice endosperm aleurone related gene OsSecY2 and encoding protein and application thereof | |
CN109912702B (en) | Application of protein OsARE1 in regulation and control of low nitrogen resistance of plants | |
CN109627305A (en) | Encode the application of the gene, recombinant vector, recombinant bacterium of OsbHLH116 albumen in terms of controlling plant type of rice | |
CN101798342A (en) | Rice glume development related protein TRI1 and encoding gene and application thereof | |
CN108841797A (en) | The protein and its encoding gene of a kind of adjusting and controlling rice Chlorophyll synthesis and application | |
CN110777150B (en) | Application of protein GmPLATZ in regulation and control of plant seed yield | |
CN108341857B (en) | Rice yield related protein and coding gene and application thereof | |
CN108441499A (en) | Male fertile related gene HT2925 and its application | |
CN114106129B (en) | Application of rape SWEET15 sugar transporter gene in improving rape yield | |
CN110373418A (en) | Regulate and control gene and its application of size of plant seed | |
CN108456683B (en) | Function and application of gene SID1 for regulating heading stage of rice | |
CN112899302B (en) | Application of rape alpha-6 tubulin gene in improving rape yield | |
CN111499709B (en) | RGN1 protein related to grain number per ear of rice as well as encoding gene and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |