CN108864266A

CN108864266A - One kind Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and application

Info

Publication number: CN108864266A
Application number: CN201810757562.9A
Authority: CN
Inventors: 谭禄宾; 蒋丽芸; 刘凤霞; 付永彩; 顾凭; 朱作峰; 孙传清
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2018-07-11
Filing date: 2018-07-11
Publication date: 2018-11-23
Anticipated expiration: 2038-07-11
Also published as: CN108864266B

Abstract

The invention discloses a kind of Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and applications.Plant phenotype can be regulated and controled using the relevant Protein S SH1 of plant phenotype provided by the invention and its encoding gene：Silencing strain (RNAi-SSH1-1, RNAi-SSH1-2) and the phenotype of mutant ssh1 are almost the same, show as seed holding decline, and seed is elongated；T₁It shows as seed holding for SSH1 gene complementation strain (GC-SSH1-1, GC-SSH1-2), overexpression plant (OE-SSH1-1, OE-SSH1-2) to increase, seed shortens.The result shows that plant fallen and/or the relevant Protein S SH1 of grain shape and its encoding gene energy regulating plant fallen and/or grain shape.The present invention is of great significance for rice breeding.

Description

A kind of Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and Using

Technical field

The present invention relates to plant genetic engineering fields, and in particular to a kind of albumen relevant to rice seed holding and grain shape SSH1 and its encoding gene and application.

Background technique

It is also one of the cereal crops tamed earliest, the whole world about one that rice (Oryza sativa L.), which is most important, The half above population is food with rice.As world population increases year by year, and available cultivated area declines year by year, grain The unbalanced contradiction of relation between supply and demand becomes increasingly conspicuous.Therefore, more high yields, stable yields, good rice varieties gesture are cultivated must Row.

Seed holding is one of the Main Agronomic Characters for influencing crop yield and building up, and is all crop genetics research all the time Emphasis and hot spot, and it is one of critical event during Crop Domestication that seed holding, which reduces or loses,.Seed is after maturation Natural shattering, this has important ecological significance for it raises up seed, however people are more in Crop Domestication process The kind for tending to that seed holding is selected to reduce further cultivates to avoid crop loss while improving crop efficiency of crop. Genetics research the result shows that, rice seed holding is the complicated quantitative character of a typical controlled by multiple genes.

Grain shape is also an important factor for influencing rice yield, and by grain length, grain is wide, grain is thick constitutes.In domesticated breeding, grain Type is also one of character of artificial selection, provides excellent model for domestication research.

Rice seed holding and grain shape are the Main Agronomic Characters for influencing yield.Therefore, further separation control rice is fallen The gene of graininess, grain shape is not only to illustrate the molecular regulation mechanism offer reference of seed holding and grain shape, and help to pass through Molecular breeding means cultivate the moderate new rice variety of new high yield, seed holding.

Summary of the invention

The object of the present invention is to provide a kind of Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and Using.

Protein provided by the invention is obtained from rice, is named as SSH1 albumen, is following (a1) or (a2)：

(a1) protein that the amino acid sequence shown in sequence 1 in sequence table forms；

(a2) amino acid sequence of sequence 1 by the substitution of one or several amino acid residues and/or missing and/or is added Add and the protein as derived from sequence 1 relevant to vegetable seeds seed holding and/or grain shape.

In order to make SSH1 albumen in (a1) convenient for purifying and detection, can in as sequence table amino acid shown in sequence 1 The amino terminal or carboxyl terminal of the protein of sequence composition connect upper label as shown in Table 1.

The sequence of 1 label of table

SSH1 albumen in above-mentioned (a2) can be artificial synthesized, can also first synthesize its encoding gene, then carries out biological expression and obtain It arrives.The encoding gene of SSH1 albumen in above-mentioned (a2) can be by will lack one in DNA sequence shown in sequence 4 in sequence table The codon of a or several amino acid residues, and/or the missense mutation of one or several base-pairs is carried out, and/or at its 5 ' end And/or 3 ' end connect the coded sequence of label shown in table 1 and obtain.

The gene (SSH1 gene) for encoding the SSH1 albumen also belongs to protection scope of the present invention.

The gene is any DNA molecular in following (b1)-(b5)：

(b1) code area DNA molecular as shown in sequence 4 in sequence table；

(b2) DNA molecular shown in 2310-5997 nucleotide of sequence 2 in sequence table；

(b3) DNA molecular shown in 2310-5997 nucleotide of sequence 3 in sequence table；

(b4) hybridize and encode and vegetable seeds with (b1) or (b2) or (b3) DNA sequence dna limited under strict conditions The DNA molecular of seed holding and/or grain shape GAP-associated protein GAP；

(b5) with (b1) or (b2) or (b3) or (b4) limit DNA sequence dna have 90% or more homology and coding with The DNA molecular of vegetable seeds seed holding and/or grain shape GAP-associated protein GAP.

Above-mentioned stringent condition can be with 0.1 × SSPE (or 0.1 × SSC), the solution of 0.1%SDS, in DNA or RNA Hybridize at 65 DEG C in hybrid experiment and washes film.

Recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium containing the SSH1 gene belong to this hair Bright protection scope.

The recombinant expression carrier of SSH1 gene can be contained with existing plant expression vector construction.The plant expression carries Body includes double base agrobacterium vector and the carrier etc. that can be used for plant micropellet bombardment.It is carried using the gene constructed recombinant expression of SSH1 It, can be before its transcription initiation nucleotide plus any enhanced, composing type, organizing specific type or induction type starting when body Son, they can be used alone or are used in combination with other plant promoters；In addition, using the gene constructed recombinant expression of SSH1 When carrier, enhancer, including translational enhancer or transcriptional enhancer also can be used, these enhancer regions can be ATG starting Codon or neighboring region initiation codon etc., but must be identical as the reading frame of coded sequence, to guarantee entire sequence just Really translation.The source of the translation control signal and initiation codon be it is extensive, can be natural, be also possible to synthesize 's.Translation initiation region can come from transcription initiation region or structural gene.For the ease of to transgenic plant cells or plant It is identified and is screened, plant expression vector used can be processed, the expression in plant, which is such as added, can produce color change Enzyme or gene, resistant antibiotic marker or the anti-chemical reagent marker gene of luminophor etc..

The recombinant expression carrier is concretely by the piece between BmaHI the and SpeI restriction enzyme site of plasmid pCAMBIA1301 Section replaces with the recombinant expression carrier that DNA molecular shown in the sequence 4 of sequence table obtains.

The gene or SSH1 gene that the present invention also protects SSH1 albumen are in regulation vegetable seeds seed holding and/or grain shape Application.

The present invention also protects a kind of method for cultivating genetically modified plants, is the expression for inhibiting SSH1 gene in purpose plant, Obtain genetically modified plants；The genetically modified plants meet the phenotype of following (c1) and/or (c2)：

(c1) seed shattering is lower than the purpose plant；

(c2) seed length is greater than the purpose plant.

The expression for inhibiting SSH1 gene in purpose plant can be realized by importing interference carrier into purpose plant.

The interference carrier is concretely by the piece between SpeI the and SacI restriction enzyme site of plasmid pTCK303/JL1460 Section replaces with the sequence 4 of the sequence table DNA molecular shown in the 1098th to the 1420th from 5 ' ends, and by plasmid Segment between BamHI the and KpnI restriction enzyme site of pTCK303/JL1460 replaces with the sequence 4 of sequence table from 5 ' ends The interference carrier that the reverse complementary sequence of DNA molecular shown in 1098 to the 1420th obtains.

The present invention also protects a kind of method for reducing plant fallen and/or increasing seed length, includes the following steps：Drop The expression quantity and/or activity of SSH1 albumen in low purpose plant reduce plant fallen and/or increase seed length.

The present invention also protects a kind of method for cultivating genetically modified plants, is to be turned SSH1 channel genes purpose plant Gene plant；The genetically modified plants meet the phenotype of following (d1) and/or (d2)：

(d1) seed shattering is higher than the purpose plant；

(d2) seed length is less than the purpose plant.

It is described that SSH1 gene is imported into purpose plant to pass through any description above recombinant expression carrier.The recombination table Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, mediated by agriculture bacillus can be passed through up to carrier Equal conventional biology methods are transformed into plant cell or tissue.

The present invention also protects a kind of method for increasing plant fallen and/or reducing seed length, includes the following steps：Increase Add the expression quantity and/or activity of SSH1 albumen in purpose plant, increase plant fallen and/or reduces seed length.

The present invention also protects SSH1 albumen, or, SSH1 gene, or, any description above method, in plant breeding Using.

The purpose of the breeding is the plant that breeding plant fallen is low and/or seed length is big.

The purpose of the breeding is the plant that breeding plant fallen is high and/or seed length is small.

Any description above plant is dicotyledon or monocotyledon.The monocotyledon can be planted for Poales Object.The Poales plant can be gramineae plant.The gramineae plant can be oryza plant.The oryza plant is specific It can be rice, such as long-grained nonglutinous rice strain YIL100.

Plant phenotype can be regulated and controled using the relevant Protein S SH1 of plant phenotype provided by the invention and its encoding gene：It is heavy Silent strain (RNAi-SSH1-1, RNAi-SSH1-2) and the phenotype of mutant ssh1 are almost the same, show as seed holding decline, Seed is elongated；T₁For SSH1 gene complementation strain (GC-SSH1-1, GC-SSH1-2), it is overexpressed plant (OE-SSH1-1, OE- SSH1-2 seed holding increase) is shown as, seed shortens.The result shows that plant fallen and/or the relevant albumen of grain shape SSH1 and its encoding gene energy regulating plant fallen and/or grain shape.The present invention is of great significance for rice breeding.

Detailed description of the invention

Fig. 1 is long-grained nonglutinous rice strain YIL100 Graphical genotype.

Fig. 2 is the comparison of the phenotype of mutant ssh1 and long-grained nonglutinous rice strain YIL100.

Fig. 3 is the clone of SSH1 gene.

Fig. 4 is mRNA relative expression water of the SSH1 gene in mutant ssh1 and long-grained nonglutinous rice strain YIL100 different tissues Flat comparison.

Fig. 5 is transgenic plant phenotypic evaluation.

Specific embodiment

Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method is unless otherwise specified conventional method.Test material as used in the following examples is unless otherwise specified It is commercially available from routine biochemistry reagent shop.Quantitative test in following embodiment is respectively provided with three repeated experiments, as a result It is averaged.

Long-grained nonglutinous rice strain YIL100 is originated from Yuanjiang County of Yunnan common wild-rice (O.rufipogon Griff.) as donor parents, It take Elite Rice kind special green (Oryza sativa ssp.indica) as the introgression line of receptor parent building, the introgression line table Type is nature shattering.The Yuanjiang County of Yunnan common wild-rice (O.rufipogon Griff.) and Elite Rice kind are special green (Oryza sativa ssp.indica) is recorded in document：Tan,L.,Li,X.,Liu,F.,Sun,X.,Li,C.,Zhu, Z., Fu,Y.,Cai,H.,Wang,X.,Xie,D.,and Sun,C.(2008).Control of a key transition from prostrate to erect growth in rice domestication.Nat.Genet.40:1360–1364. The public can obtain from China Agricultural University, to repeat this experiment.The construction method of long-grained nonglutinous rice strain YIL100 is recorded in as follows In offering：Tan L., Liu F.,Xue W.,Wang G.,Ye S.,Zhu Z.,Fu Y.,Wang X.,and Sun C. (2007).Development of Oryza rufipogon and Oryza sativa introgression lines and assessment for yield-related quantitative trait loci.JIntegr Plant Bio.49:871–884.；Long-grained nonglutinous rice strain YIL100 Graphical genotype is as shown in Fig. 1.

Plasmid pCAMBIA1300 is recorded in following document：Tan,L.,Li,X.,Liu,F.,Sun,X.,Li,C.,Zhu, Z.,Fu,Y.,Cai,H.,Wang,X.,Xie,D.,and Sun,C.(2008).Control of a key transition from prostrate to erect growth in rice domestication.Nat.Genet.40:1360–1364. The public can obtain from China Agricultural University, to repeat this experiment.

Plasmid pCAMBIA1301 is recorded in following document：Yu B.,Lin Z.,Lin H.,Li X.,Li J.,Wang Y., Zhang W., Zhu Z., Zhai W., Wang X., Xie D., Sun C. (2007) .TAC1, a major Quantitative trait locus controlling tiller angle in rice.Plant J, 52:891-898. The public can obtain from China Agricultural University, to repeat this experiment.

Plasmid pTCK303/JL1460 is recorded in following document：Wang Z.,Chen C.,Xu Y.,Jiang R.,Han Y.,Xu Z.,and Chong K.(2004).A Practical Vector for Efficient Knockdown of Gene Expression in Rice(Oryza sativa L.).Plant Mol.Bio.Rep.22:409-417. public can To be obtained from China Agricultural University, to repeat this experiment.

Agrobacterium EHA105 is recorded in following document：WuY.,FuY.,ZhaoS.,GuP.,ZhuZ.,SunC.,and Tan L. (2015).CLUSTERED PRIMARY BRANCH 1,a new allele ofDWARF11,controls panicle architecture and seedsize inrice.Plant Bio.J.14:377-386. public can be therefrom Agriculture university of state obtains, to repeat this experiment.

The acquisition of embodiment 1, control rice rice seed holding and grain shape gene SSH1

Long-grained nonglutinous rice strain YIL100 was handled through methane sulfonamide (Ethyl Methyl Sulfone, EMS) and through excessive generation After selfing and character observation, the mutation system of genotype homozygosis is formed.Screening by being mutated system has found a shattering Property reduce mutant, which is named as ssh1.

The seed holding comparative experiments result of ssh1 and YIL100 is shown in A, B and C in Fig. 2.The seed shape of ssh1 and YIL100 State compares D, E, F and the G seen in Fig. 2.Compared with YIL100, ssh1 mutant seed holding reduces that (YIL100 shattering rate is 78.97 ± 8.93%, ssh1 shattering rate are 10.99 ± 3.61%).The seed holding comparative experiments result of ssh1 and YIL100 is shown in A, B and C in Fig. 2.The Grain Morphology of ssh1 and YIL100 compares D, E, F and the G seen in Fig. 2.Compared with YIL100, ssh1 Seed it is elongated (D and E in Fig. 2).

Mutant ssh1 and long-grained nonglutinous rice strain YIL100 is returned, F₁In generation, shows as shattering, therefore deduces and control the mutation The gene of character is recessive.Hybridize F₁F is generated after selfing₂In offspring, the plant ratio of shattering with not shattering is shown as Close to 3：1 (205 plants of shatterings, 72 plants do not fall, χ²=0.10<χ² _0.05,1=3.84).So the reduction of ssh1 seed holding is hidden by one Property Dominant gene, is named as suppression of shattering 1 (ssh1) for the mutated gene.

From F₂20 plants of dominant shattering single plants of middle selection and 20 plants of recessiveness do not fall single plant and extract DNA respectively, by two groups of DNA points Other mixed in equal amounts constructs dominant pond and recessive pond and utilizes Illumina HiSeq2500 microarray dataset (the auspicious conjunction Kang Sheng of Beijing shellfish Object Technology Co., Ltd., item number BFC2013036) it carries out resurveying sequence, it is detected using MutMap strategy in the 7th chromosome One SNP cluster (A in Fig. 3) chain with not shattering phenotype.Further target gene SSH1 is determined using 72 recessive single plants Between SNP marker SNV4 and SNV8, physical distance between the two about 3104Kb (B in Fig. 3) is tied on this basis for position Conjunction full-length genome resurveys sequence and SNP verifying identifies 3 SNP.Genome (http is referred to according to rice:// Rice.plantbiology.msu.edu) annotation and real-time fluorescence quantitative PCR, know that only SNP marker SNV6 is located at gene It is interior that (there are the single nucleotide variations by base C to A for the 9th introne 3 ' end of LOC Os07g13170, specially In sequence table shown in sequence 2 and/or sequence 3 the 5782nd, C and D in Fig. 3) and in the absciss layer portion of control seed shattering Position expression, therefore using LOC_Os07g13170 as candidate gene, and be SSH1 by the unnamed gene.

Wherein, using rice ubiquitin gene, (LOC_Os03g13170.1 is reference gene to real-time fluorescence quantitative PCR. Identify primer following P1, P2 and P3 used in SSH1 gene expression amount：

P1_F：5 '-TGACTATGAGGACGACTTGA-3 ' (sequence 4 735-754 in sequence table)

P1_R：5 '-AGATGTACTTCTTGCCGAGC-3 ' (the reverse complemental sequence of sequence 4 894-913 in sequence table Column)

P2_F：5 '-ATGTCCCAGCATCCACATTT-3 ' (sequence 4 1234-1253 in sequence table)

P2_R：5 '-the GGAGTAATGGCAAAGGGGAG3 ' (reverse complemental of sequence 4 1368-1387 in sequence table Sequence)

P3_F：5 '-GCCACCACCAGTTCTACTTC-3 ' (sequence 4 1472-1491 in sequence table)

P3_R：5 '-the CTCTCTGGACAAACGACGAA3 ' (reverse complemental of sequence 4 1569-1588 in sequence table Sequence)

Detection ubiquitin gene primer be：

Ubi_F:5'-CTGTCAACTGCCGCAAGAAG-3'；

Ubi_R:5’-GGCGAGTGACGCTCTAGTTC-3’。

Expression of results of the SSH1 gene at long-grained nonglutinous rice strain YIL100 and mutant ssh1 different tissues position is shown in Fig. 4, uses P1 When primer detection, SSH1 gene expression quantity no significant difference in two materials.And P2, P3 primer detection are the result shows that mutation In body expression of the SSH1 gene in different tissues respectively organized compared with YIL100 in lower, thus speculate SNP SNV6 cause SSH1 gene mRNA expression changes.Wherein DP indicates that developmental rice tassel, AZ indicate that absciss layer, F indicate that rice is small Flower, number of days before DBP expression is bloomed, DAP indicate Post flowering number of days.

Above-mentioned MutMap strategy refers to following document：(1)Abe,A.,Kosugi,S.,Yoshida,K.,Natsume,S., Takagi,H.,Kanzaki,H.,Matsumura,H.,Yoshida,K.,Mitsuoka,C.,Tamiru,M.,Innan,H., Cano,L.,Kamoun,S.,and Terauchi,R.(2012).Genome sequencing reveals agronomically important loci in rice using MutMap.Nat.Biotechnol.30:174–178.； (2)Lu,H.,Lin,T., Klein,J.,Wang,S.,Qi,J.,Zhou,Q.,Sun,J.,Zhang,Z.,Weng,Y.,and Huang,S.(2014). QTL-seq identifies an early flowering QTL located near Flowering Locus T in cucumber. Theor.Appl.Genet.127:1491–1499.；(3)Takagi,H., Abe,A.,Yoshida,K.,Kosugi,S., Natsume,S.,Mitsuoka,C.,Uemura,A.,Utsushi,H., Tamiru,M.,Takuno,S.,Innan,H., Cano,L.M.,Kamoun,S.,and Terauchi,R.(2013).QTL- seq:rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations.Plant J.74:174–183.

Genome sequence (http is referred to according to indica rice 93-11://www.gramene.org/) SSH1 gene and its two Side flanking sequence design primer, primer sequence are as follows：

F：5 '-GGCTCCAAAGTATAAAACAC-3 ' (in sequence table 1-20 of sequence 2 and/or sequence 3)；

R：5 '-TCAATAGCATATGTATGCAA-3 ' (7181-7206 of sequence 2 and/or sequence 3 in sequence table Reverse complementary sequence).

The complete genome DNA of long-grained nonglutinous rice strain YIL100 and mutant ssh1 are extracted using CTAB method.Respectively with the two DNA For template, the DNA fragmentation that amplification length is about 7.2kb, sequence is respectively sequence 2 and sequence 3 in sequence table.

1-2309 respectively long-grained nonglutinous rice strain YIL100 and mutant ssh1 of sequence 2 and sequence 3 are endogenous in sequence table SSH1/ssh1 gene 5 ' flanking sequence, 2310-5997 are the SSH1/ssh1 gene order (the containing introne 2729-2830,2857-2978,3010-3092,3181-3291,3438-4051,4097-4186, 4291-4386,4524-4963,5066-5784 are intron sequences).The corresponding SSH1 gene without introne CDS sequence is as shown in sequence 4 in sequence table.

It is compared and is analyzed according to the SSH1/ssh1 gene sequencing result of long-grained nonglutinous rice strain YIL100 and mutant ssh1, discovery exists There are the single nucleotide variations by C to A for the 9th introne 3 ' end of SSH1 gene, specific such as sequence 2 and sequence in sequence table In column 3 shown in the 5782nd.

In sequence table 2310-5997 of sequence 2 and sequence 3 be respectively SSH1 gene in long-grained nonglutinous rice strain YIL100 and Sequence in mutant ssh1 genome；Sequence 4 is its cDNA sequence (CDS) in sequence table.Sequence 2, sequence 3 in sequence table With protein (SSH1 albumen) shown in the equal coded sequence 1 of sequence 4.

The application of embodiment 2, SSH1 gene in regulating plant fallen and grain shape

One, the building of recombinant plasmid GC-SSH1

Segment between the KpnI of plasmid pCAMBIA1300 and XbaI enzyme cutting site is replaced with shown in the sequence 2 of sequence table DNA molecular, obtain recombinant plasmid GC-SSH1 (sequence verification).

Two, the building of recombinant plasmid OE-SSH1

Segment between BmaHI the and SpeI restriction enzyme site of plasmid pCAMBIA1301 is replaced with to 4 institute of sequence of sequence table The DNA molecular shown obtains recombinant plasmid OE-SSH1 (sequence verification).

Three, the building of recombinant plasmid RNAi-SSH1

Segment between SpeI the and SacI restriction enzyme site of plasmid pTCK303/JL1460 is replaced with to the sequence of sequence table 4 from 5 ' ends DNA molecular shown in the 1098th to the 1420th, and by the BamHI of plasmid pTCK303/JL1460 and Segment between KpnI restriction enzyme site replaces with the sequence 4 of the sequence table DNA shown in the 1098th to the 1420th from 5 ' ends The reverse complementary sequence of molecule obtains recombinant plasmid RNAi-SSH1 (sequence verification).

Four, the acquisition of transgenosis complementation plant

1, the recombinant plasmid GC-SSH1 for obtaining step 1 converts Agrobacterium EHA105 using freeze-thaw method, passes through Agrobacterium Infect the method for Rice Callus for the Agrobacterium-mediated Transformation mutant ssh1 after conversion, with the NB culture medium containing hygromycin into The wheel of row 3 screening (it is respectively 15mg/L, 25mg/L and 35mg/L that every wheel, which screens hygromycin concentration used), then through pre- differentiation, differentiation With take root to obtain transgenic plant.

2, after completing step 1, the total DNA of transgenic plant is extracted, with the hygromycin carried on pCAMBIA1300 carrier Resistant gene carries out PCR identification (the purpose band size of positive plant is 1,254bp), and primer is as follows：

Hpt_F:5’-TGCATCATCGAAATTGCCGT-3’

Hpt_R:5’-AAACGACGGCCAGTGAATTC-3’

It is identified, obtain 11 plants of positive T₀For SSH1 gene complementation strain.By T₀It is generated for SSH1 gene complementation strain selfing Seed is named as T₁Generation complementary seed, by T₁The rice plant that generation complementary seed grows up to is named as T₁For SSH1 gene complementation strain. Two complement strains are randomly choosed, GC-SSH1-1, GC-SSH1-2 are named as.

3, respectively with 0-4cm children's fringe cDNA of GC-SSH1-1, GC-SSH1-2 and mutant ssh1 for template, by glimmering The relative expression quantity of Fluorescent Quantitative PCR detection SSH1 gene (using rice ubiquitin gene as reference gene, is specifically shown in above-mentioned reality Apply primer Ubi used in example 1).Identify that the primer of SSH1 gene relative expression quantity is used in above-described embodiment 1 Primer P3.

Using the relative expression quantity of SSH1 gene in mutant ssh1 as 1, T₁SSH1 base in 2 strains of generation complementary strain The relative expression quantity of cause is shown in H in Fig. 5.The result shows that T₁Expression quantity in two strains of generation complementary strain significantly improves, respectively It is 14.8 times and 36.1 times of SSH1 gene in mutant ssh1.

Five, transgenosis is overexpressed the acquisition of plant

1, the recombinant plasmid OE-SSH1 for obtaining step 2 converts Agrobacterium EHA105 using freeze-thaw method, passes through Agrobacterium Infect the method for Rice Callus for the Agrobacterium-mediated Transformation mutant ssh1 after conversion, with the NB culture medium containing hygromycin into The wheel of row 3 screening (it is respectively 15mg/L, 25mg/L and 35mg/L that every wheel, which screens hygromycin concentration used), then through pre- differentiation, differentiation With take root to obtain transgenic plant.

2, after completing step 1, the total DNA of transgenic plant is extracted, with the hygromycin carried on pCAMBIA1301 carrier Resistant gene carries out PCR identification (the purpose band size of positive plant is 1,254bp), and primer is as follows：

Hpt_F:5’-TGCATCATCGAAATTGCCGT-3’

Hpt_R:5’-AAACGACGGCCAGTGAATTC-3’

It is identified, obtain 17 plants of positive T₀For SSH1 gene overexpression plant.By T₀Certainly for SSH1 gene overexpression plant The seed generated is handed over to be named as T₁In generation, is overexpressed seed, by T₁In generation, is overexpressed the rice plant that seed grows up to and is named as T₁For SSH1 Gene overexpression plant.Two overexpression strains are randomly choosed, OE-SSH1-1, OE-SSH1-2 are named as.

3, respectively with 0-4cm children's fringe cDNA of OE-SSH1-1, OE-SSH1-2 and mutant ssh1 for template, by glimmering The relative expression quantity of Fluorescent Quantitative PCR detection SSH1 gene (using rice ubiquitin gene as reference gene, is specifically shown in above-mentioned reality Apply primer Ubi used in example 1).Identify that the primer of SSH1 gene relative expression quantity is used in above-described embodiment 1 Primer P3.

Using the relative expression quantity of SSH1 gene in mutant ssh1 as 1, T₁In generation, is overexpressed SSH1 in 2 strains of strain The relative expression quantity of gene is shown in H in Fig. 5.The result shows that T₁The expression quantity that generation is overexpressed in two strains of strain significantly improves, It is 2.2 times and 2.9 times of SSH1 gene in mutant ssh1 respectively.

Six, the acquisition of transgene silencing strain

1, the recombinant plasmid RNAi-SSH1 for obtaining step 3 converts Agrobacterium EHA105 using freeze-thaw method, passes through agriculture bar Bacterium infects the method for Rice Callus for the Agrobacterium-mediated Transformation wild type YIL100 after conversion, is cultivated with the NB containing hygromycin 3 wheel screening of base progress (it is respectively 15mg/L, 25mg/L and 35 mg/L that every wheel, which screens hygromycin concentration used), then the pre- differentiation of warp, Break up and takes root to obtain transgenic plant.

2, after completing step 1, the total DNA of transgenic plant is extracted, is directed to pTCK303/JL1460 carrier with following primer Upper included hygromycin gene carries out PCR identification (the purpose band size of positive plant is 1,254bp)：

Hpt_F:5'-TGCATCATCGAAATTGCCGT-3'；

Hpt_R:5’-AAACGACGGCCAGTGAATTC-3’。

It is identified, obtain 8 plants of positive T₀For SSH1 gene silencing strain.By T₀The kind generated for SSH1 gene complementation strain selfing Son is named as T₁For silencing seed, by T₁The rice plant grown up to for silencing seed is named as T₁For SSH1 gene silencing strain.With Machine selects two silencing strains, is named as RNAi-SSH1-1, RNAi-SSH1-2.

3, respectively with 0-4cm children's fringe cDNA of RNAi-SSH1-1, RNAi-SSH1-2 and mutant ssh1 for template, lead to The relative expression quantity for crossing fluorescence quantitative PCR detection SSH1 gene (using rice ubiquitin gene as reference gene, is specifically shown in State primer Ubi used in embodiment 1).The primer for identifying SSH1 gene is primer P3 used in above-described embodiment 1.

T₁See that (wherein WT is long-grained nonglutinous rice strain to H in Fig. 5 for the relative expression quantity of SSH1 gene in 2 strains of silencing strain YIL100).The result shows that using the relative expression quantity of SSH1 gene in mutant ssh1 as 1, long-grained nonglutinous rice strain YIL100 at this time The relative expression quantity of middle SSH1 gene is 13.6, T₁For the different degrees of downward of the expression quantity in two silencing strains of strain, divide It Wei not 1.0 (in YIL100 0.074 times of SSH1 gene) and 11.39 (in YIL100 0.84 times of SSH1 gene).

Seven, turn the acquisition of empty carrier plant

1, recombinant plasmid GC-SSH1 is substituted using plasmid pCAMBIA1300, is operated according to step 4, obtains T₁Generation Turn empty carrier plant (pCAMBIA1300).

2, recombinant plasmid OE-SSH1 is substituted using plasmid pCAMBIA1301, is operated according to step 5, obtains T₁Generation Turn empty carrier plant (pCAMBIA1301).

3, recombinant plasmid RNAi-SSH1 is substituted using plasmid pTCK303/JL1460, is operated, is obtained according to step 6 To T₁In generation, turns empty carrier plant (pTCK303/JL1460).

Eight, Phenotypic examination

Plant to be measured：Long-grained nonglutinous rice strain YIL100, mutant ssh1, T₁For silencing strain (RNAi-SSH1-1, RNAi- SSH1- 2)、T₁Generation complementary strain (GC-SSH1-1, GC-SSH1-2), T₁In generation, is overexpressed strain (OE-SSH1-1, OE- SSH1-2), T₁In generation, turns sky Carrier plant (pCAMBIA1300), T₁In generation, turns empty carrier plant (pCAMBIA1301) and T₁In generation, turns empty carrier plant (pTCK303/JL1460)。

The seed of plant to be measured is seeded into big Tanaka respectively, each strain randomly selects 10 plants, and experiment is in triplicate. Seed holding, the seed length of plant are investigated after maturation.

Experimental result is shown in Fig. 5, (A figure is stem fringe, and E figure is Grain Morphology, and F is shattering rate, and G is seed length, wherein WT For long-grained nonglutinous rice strain YIL100).

The result shows that the phenotype of complementary strain, overexpression plant phenotype and YIL100 is almost the same, natural seed holding is extremely strong, Seed shortens.Silencing strain is consistent with mutant ssh1, and seed holding reduces, and seed is elongated.Turn empty carrier plant (pCAMBIA1300) and turn empty carrier plant (pCAMBIA1301) phenotype and mutant ssh1 without significant difference.Turn empty carrier Plant (pTCK303/JL1460) phenotype and wild type YIL100 are without significant difference.

Sequence table

<110>China Agricultural University

<120>One kind Protein S SH1 relevant to rice seed holding and grain shape and its encoding gene and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 436

<212> PRT

<213>Rice (Oryza sativa L.)

<400> 1

Met Val Leu Asp Leu Asn Val Glu Ser Pro Gly Gly Ser Ala Ala Thr

1 5 10 15

Ser Ser Ser Ser Thr Pro Pro Pro Pro Pro Asp Gly Gly Gly Gly Gly

20 25 30

Tyr Phe Arg Phe Asp Leu Leu Gly Gly Ser Pro Asp Glu Asp Gly Cys

35 40 45

Ser Leu Pro Val Met Thr Arg Gln Leu Phe Pro Ser Pro Ser Ala Val

50 55 60

Val Ala Leu Ala Gly Asp Gly Ser Ser Thr Pro Pro Pro Thr Met Pro

65 70 75 80

Thr Pro Ala Ala Ala Gly Glu Gly Pro Trp Pro Arg Arg Ala Ala Asp

85 90 95

Leu Gly Val Ala Gln Ser Gln Arg Ser Pro Ala Gly Gly Lys Lys Ser

100 105 110

Arg Arg Gly Pro Arg Ser Arg Ser Ser Gln Tyr Arg Gly Val Thr Phe

115 120 125

Tyr Arg Arg Thr Gly Arg Trp Glu Ser His Ile Trp Asp Cys Gly Lys

130 135 140

Gln Val Tyr Leu Gly Gly Phe Asp Thr Ala His Ala Ala Ala Arg Ala

145 150 155 160

Tyr Asp Arg Ala Ala Ile Lys Phe Arg Gly Leu Asp Ala Asp Ile Asn

165 170 175

Phe Asn Leu Asn Asp Tyr Glu Asp Asp Leu Lys Gln Met Arg Asn Trp

180 185 190

Thr Lys Glu Glu Phe Val His Ile Leu Arg Arg Gln Ser Thr Gly Phe

195 200 205

Ala Arg Gly Ser Ser Lys Tyr Arg Gly Val Thr Leu His Lys Cys Gly

210 215 220

Arg Trp Glu Ala Arg Met Gly Gln Leu Leu Gly Lys Lys Tyr Ile Tyr

225 230 235 240

Leu Gly Leu Phe Asp Ser Glu Ile Glu Ala Ala Arg Ala Tyr Asp Arg

245 250 255

Ala Ala Ile Arg Phe Asn Gly Arg Glu Ala Val Thr Asn Phe Asp Pro

260 265 270

Ser Ser Tyr Asp Gly Asp Val Leu Pro Glu Thr Asp Asn Glu Val Val

275 280 285

Asp Gly Asp Ile Ile Asp Leu Asn Leu Arg Ile Ser Gln Pro Asn Val

290 295 300

His Glu Leu Lys Ser Asp Gly Thr Leu Thr Gly Phe Gln Leu Asn Cys

305 310 315 320

Asp Ser Pro Glu Ala Ser Ser Ser Val Val Thr Gln Pro Ile Ser Pro

325 330 335

Gln Trp Pro Val Leu Pro Gln Gly Thr Ser Met Ser Gln His Pro His

340 345 350

Leu Tyr Ala Ser Pro Cys Pro Gly Phe Phe Val Asn Leu Arg Glu Val

355 360 365

Pro Met Glu Lys Arg Pro Glu Leu Gly Pro Gln Ser Phe Pro Thr Ser

370 375 380

Trp Ser Trp Gln Met Gln Gly Ser Pro Leu Pro Leu Leu Pro Thr Ala

385 390 395 400

Ala Ser Ser Gly Phe Ser Thr Gly Thr Val Ala Asp Ala Ala Arg Ala

405 410 415

Pro Ser Ser Arg Pro His Pro Phe Pro Gly His His Gln Phe Tyr Phe

420 425 430

Pro Pro Thr Thr

435

<210> 2

<211> 7206

<212> DNA

<213>Rice (Oryza sativa L.)

<400> 2

ggctccaaag tataaaacac acaaattctc tcaaattttt aaaaatgttc aaattgtgag 60

tatataccta ggaatataaa tttgattcat ccaaatacct aacaacaaaa caactcaaac 120

tcaactttat ttcacaattc attattacat acctaactaa ttatatgttt ggatgttata 180

tatctagaac caaaatctaa caaaaaaaag ttcaaacttg ttagtaaaga agttaatgtt 240

catatctaaa catttaaaaa aaatttcata ctcattcaac atacacagtg aaaacaacat 300

atccgtttcc ttgtttgtgt aacaagtgtt tggtacttcc tgcccattac tgcacgctgg 360

tggtggacag tagcagcaca ggagaagaca gccatgggga tggggcggcc aatgggaaac 420

tataccggtg gatattttgc cgacaggaaa tgctgcacgc actaaccaat gttgctcaca 480

aagttttttt ttaaaatttt taatttctcc ctcgcatcat gtggtccctg cagatacatc 540

atgtcataaa agtttttctt aacagtgaag tattattatt attattgttt gctcctttga 600

tatttatact tgattatgaa atcaagttta ttgtattatg tagaatatgc agtgccatgc 660

ttgggtgtct ctctcgtcca gaagctgagt tagacttcat ttttttaaaa gattgtacat 720

taatttaacc acaacctaga aagtgcttgt cttgtgcata taaaaacatg tatgttatat 780

tatttttttg tgaggaatat tatggaatgg tggaatatat ttatctcctt ttaaagaagc 840

accttgtttc tatatttcat atccatacct ttaaaaacat cacgttgtat tttgctcctt 900

cgtttgcccg ttagcttatg agtcaaagca aaatttgaat ttttagactt aattctagag 960

ttaattttga ggcatttttt ttattatagt ttagttttca gcattggttt ttaaaattgc 1020

caagagcaca tatatacaaa ttttatacat aaatcaattt ttgttgcttc attctatttt 1080

acaacttaat ggcagagcaa acgatgaaaa taatttatat cgtgtgctct agaaatgttg 1140

ttttcactat atcatggatc agtttaggta gccgtgtaga tatccttact ccgtaataaa 1200

acgagccaac aatgctagct tagagccgtt aattattgtt acaagtaaat gcaaccttaa 1260

tctatatatg cttatctgac ttcaaaagaa gtactccaac catgtaacca aaatccaacc 1320

atgttataag tcgatttaat tattctctag ctacttacta aagtttgata tactcttata 1380

tagagaaaat tagcaacatc tacaatacaa aattagtttt attctaacat tcaacacatt 1440

ttgataatac gttttaaaca ttagtatata attctaaaaa ataaattaaa gcaatgtcga 1500

gtggaaaata caacttttat cactgtgatg caatcctata tacgactacc tttatatact 1560

actccatttt gggttacaag acgtttttac tttggtcaaa atcaaactct ttcaaattta 1620

actaaattta tagatacata tagtaatatt tataatacta aattagtttg attcaatcaa 1680

taattgaata tatattcata ataaatttgt cttgggttga aaatgtatta ttttttttac 1740

aaacttggtt aaacctaaag cagtttaact ttgataaaag gtcaaaacgt cttataatct 1800

agattagagg gaatagtacc agtagtcggc aaacacattg caactattgg gccagagtca 1860

agtcaaacta agcatagcac actcctcctt aatacaccct acatacacaa aaccatacta 1920

ctactactag taggagtctc caccgttctg aaaaaagaaa aagaaaaaaa aaaccctcca 1980

tctcccgccc agtgccgccg cgccacgtca cccctccccc gccgcgcgtg tgtgtacgcg 2040

tagcctttcc ggcggagacg cagcacaaaa atggttttac ctgcgatacc cttcgtctcc 2100

ctcacgtccc atccatccct cccccccctt ttccctcctc ctccacctcc actgccatgg 2160

ccgcctccgc cgctcctctc tcccgcgtgg tagccgccgc cggttgccgc cgctagggga 2220

gcgcgacggg ggagcggtag gggcgaccca gctcgctctg tcgccccgcg gctggtgggg 2280

gtgcgcgcgg gggagagcgg ttggttagta tggtgctgga tctcaatgtg gagtcgccgg 2340

gtgggtcggc ggcgacgtcg agctcgtcca cgccgccgcc gccgcccgac ggtggcggcg 2400

gggggtactt ccggttcgac ctgctcggcg ggagccccga cgaggacggg tgctccctgc 2460

ctgtcatgac gcgccagctc ttcccttcgc cgtctgcggt ggtggcgctg gcgggggacg 2520

ggtcgtcgac gccaccgccg acgatgccga cgccggcggc ggctggggag gggccgtggc 2580

cgcgccgcgc ggcggatctc ggggtggcgc agagccagag gtcccccgcc ggcgggaaga 2640

agagccgccg cggcccgagg tctcggagct cccagtacag gggcgtcacc ttctacagga 2700

ggaccgggcg atgggagtcg cacatctggt tagcttcgcc ttgctcgatt tccctcacgc 2760

tgacttcctc tgcttgactc tgcttgattg gagtagtaat ctcttcgttt gtctcgtcca 2820

attttggcag ggactgcggg aagcaggtgt acctgggtga gctcctattt ctagtctccc 2880

aagctaaatt cgctcgcatg actgctaaat ttggctctct acttagcttg attccgattt 2940

gtttgctcct gccttgtttt ttttttttct gttttcaggt ggtttcgata cagctcatgc 3000

cgcagcgagg ttactataga tggtcaccaa ttgtatctta attgttgctc tggtttgccc 3060

tgtgtgctga gattgtagaa ccccttgtgc agggcctatg atcgcgcggc gatcaagttc 3120

agaggcctcg acgcggatat caactttaat ctgaatgact atgaggacga cttgaagcag 3180

gttgtttgga atatagttca attgtcatgt gtgattcttt aggttctaag gggaggttca 3240

gtcaccggcc tgtgatggtt tatgatggat tggttcgtgc tgtgttgtta gatgcgcaat 3300

tggaccaagg aggagtttgt gcacatactt cggcgccaaa gcacaggatt tgcaaggggg 3360

agctcaaagt accggggtgt gacactgcac aagtgtggcc ggtgggaagc tcggatgggc 3420

cagctgctcg gcaagaagta agatccctga aacattgatt gttcttgcta gtaacttaca 3480

atacaataca ttttagatta gttcaggacc atttttcatg ccatgaacga aaactgtgtc 3540

aagtttgctt ttcaaaaagg gaaagaaaaa aaatgtgtca ctaccaagct ggagaatggt 3600

aggctacccc tggagtccac atccacctga agatttggca ccttgatgtt gactcttcac 3660

acactggcca tttactattg gaacaccaca ggtgttcagt gattatagat tgctagcttc 3720

tttaggaaag aactaagtga atcggaatgg ctcaacggaa ttaattgagg ggaaatgttt 3780

ttgtttcctt ggggattgtg ttttgcgtcc taagtcagtg acaggtgaaa agcttcattt 3840

caatgctctt ggttgttttt gccactaaga atgttctgct tatttacgtt gaatttttga 3900

ttggctgttc gtatcatagt tgtgcatttc ctatatatta caatctttgt gaactttaga 3960

taattctggc atgagctctc tctgtggtat tgttctatta acagaagtat cattctgtca 4020

attccccact gataagtgat cttttgtgca ggtacatcta tctaggattg tttgacagtg 4080

aaattgaggc tgcaaggttc agctagtagt actttgctct tctcagtttg atatgtgctt 4140

gctattccta tacttctctc actttcatct actcttcaac ttgtagagca tatgaccggg 4200

cagctatccg cttcaatgga agggaagctg ttactaattt tgatcctagt tcttatgatg 4260

gagatgttct acctgaaacc gacaatgaag gtatttcttt tgtactatgt atattgtgct 4320

ttatccacta gaacgacaaa tccaaatttt atattaacaa aagcacactg gggattgtct 4380

tagcagtggt tgatggagac atcattgact taaatctgag aatttcacag cctaacgttc 4440

atgagctgaa aagtgatggt accctaactg ggttccagtt gaattgtgat tctcctgaag 4500

cttcaagttc tgttgttact caggtaaata tgctacaata tttggtgttt gtaaccgcta 4560

taccatttga gatttgaccg tcttcagatt cttttgatca ggtggttagt cctttttcat 4620

aacattatac tatcactttc aaaataatta gtacactaat tgtatgtgtc actagaattg 4680

ttgtatgaaa ccatctggga accatcttat gcagcttatt gacaaatgac aactcactgt 4740

tgatgtattc ccaaatcaag aaaagccaat ctttttattc aatttctcca gttcattgaa 4800

ttgaaaaaga aattgccgaa caactaccac ctgaagagac tggctagata ttttgtttat 4860

ctgtgtattt ttataaccta taacagttcc aaagccacaa agctctttta ccttgattct 4920

gataacgtta actgaggtat cattttgtga ttgttttctg tagccaataa gtcctcagtg 4980

gcctgtgctt cctcagggca catcgatgtc ccagcatcca catttatatg catctccttg 5040

tccgggcttc tttgtgaacc tcagggtata tctatcatca aaacttatat gcaatttgaa 5100

aagacagtta aacttgtttc aagttaacat tcgattgcta attagctact acttccatgc 5160

tcctatttct tgagatgacg aaccatatgt ttgttccttt aattacataa tggtagccgt 5220

agatactgtt tgccttgtga actgtcagat atagcaggaa gtaaatctgt cagcttgcaa 5280

ctttccatga accacagctg tccaacttta tacagtggat gatgacttgc atttgataca 5340

tcctagtact ttcttgttgc actctgcagc tttagctctg aagatgctct atatttccat 5400

gaatgctcac gttagctctg aaatttcgaa ctttcactcc ataacatgct catttaggct 5460

gtgtttagat ccaaacttca gttcttttcc atcacatcaa cctgtcatac acacacaact 5520

tttcagtcac atcatctcta atttcaacca aaatccaaac tttgccatca actaaacaca 5580

gccttattca ttgttccacc ttttatttct gccattgcta tggtccaatc ttgatacctc 5640

agagagctgc atgatgtgta gaagtcctaa cttaggtccg ttggttagaa tcatccattc 5700

atgtttagga aaagtgatta acaacgtgtg ctgcattaac cattaatgtg gtcaactctg 5760

atgcttgtgc tatggtcact gcaggaagta cctatggaga aaagacctga gttgggtccc 5820

cagtcgttcc ctacttcgtg gtcatggcaa atgcagggct cccctttgcc attactccct 5880

actgcagcat catcaggatt ctctacgggc accgtcgccg acgccgcccg cgcgccttcc 5940

tcccgccccc atccatttcc cggccaccac cagttctact tccccccgac cacctgactg 6000

ccacctattc tggtggaggc gacgcctcac cgtgcatcca ccgccgcttg ccgataacat 6060

tcgtcgtttg tccagagagg gaccttctcc atatgatatc cctctctatg ttccacctgg 6120

ttatgatcag aattctcacg ctcatgattc ttttatcttc atttttgagt gcgaaaccac 6180

caatcgtgac cgtgctacca ggtaaacacc cttgtacctc tttgactcta caataaaatt 6240

attgtaagat attctggcta aaagtgattg gccctcccta ctgtattttt acagagttgt 6300

aattgaacag tgggcactaa agctggggcc cactcgcacc agtgtctagt ggagcgaagc 6360

tttgcccttt tcttgctatc cagcaactat tcctccgcct gcctccattg ctgacagtgg 6420

agatagcttc ccagtggtca ctgttccact gtactctgtc atagtttctg atcaccccta 6480

ttgtgccttg tctctttcac ctcctccctc acttgtgctg cctctggcca ctagagtggc 6540

gccctgcact gttgccatgc atggctgcca cttcgagagt ggagatgggg gttggccttt 6600

gggtgatttc tgtgtgccat cttttggctc aatgtcgttt tgggactggt gcatgtactg 6660

gcaataggtg agatgagata tgaaatgtcc tctgctgctt tttctatcta aggagtagct 6720

tagctatcac cagctgcctt tctcttctca aataaggttg ttaaaagggg gggtcttaaa 6780

gctaccccaa ctgctgccag gggccctctt caatgccctc ccagctgccg tttctttctt 6840

tattggtttg cttctctgct gcttcttttg cctggttgga tggatgtttg tttgttcgta 6900

tgaattgggg gagctactag tatcattcat gagtagaggc aggcagggca gcgcaggctg 6960

ctggctggcc aggcactgat gtgccaacag ctatttccag tgaaacggct gccatttttc 7020

tttgctggga ttgtgatagt ggtaggctgg tagtactagc tagcagtgta ttgggggaaa 7080

tactggtggt ccatttgcct gttagccaat ctgatgcttg cctttccatc cgctggtgat 7140

ggtccatttg ctttggcatc ttgcttgcct gttagtacta caaaagttgc atacatatgc 7200

tattga 7206

<210> 3

<211> 7206

<212> DNA

<213>Rice (Oryza sativa L.)

<400> 3

ggctccaaag tataaaacac acaaattctc tcaaattttt aaaaatgttc aaattgtgag 60

tatataccta ggaatataaa tttgattcat ccaaatacct aacaacaaaa caactcaaac 120

tcaactttat ttcacaattc attattacat acctaactaa ttatatgttt ggatgttata 180

tatctagaac caaaatctaa caaaaaaaag ttcaaacttg ttagtaaaga agttaatgtt 240

catatctaaa catttaaaaa aaatttcata ctcattcaac atacacagtg aaaacaacat 300

atccgtttcc ttgtttgtgt aacaagtgtt tggtacttcc tgcccattac tgcacgctgg 360

tggtggacag tagcagcaca ggagaagaca gccatgggga tggggcggcc aatgggaaac 420

tataccggtg gatattttgc cgacaggaaa tgctgcacgc actaaccaat gttgctcaca 480

aagttttttt ttaaaatttt taatttctcc ctcgcatcat gtggtccctg cagatacatc 540

atgtcataaa agtttttctt aacagtgaag tattattatt attattgttt gctcctttga 600

tatttatact tgattatgaa atcaagttta ttgtattatg tagaatatgc agtgccatgc 660

ttgggtgtct ctctcgtcca gaagctgagt tagacttcat ttttttaaaa gattgtacat 720

taatttaacc acaacctaga aagtgcttgt cttgtgcata taaaaacatg tatgttatat 780

tatttttttg tgaggaatat tatggaatgg tggaatatat ttatctcctt ttaaagaagc 840

accttgtttc tatatttcat atccatacct ttaaaaacat cacgttgtat tttgctcctt 900

cgtttgcccg ttagcttatg agtcaaagca aaatttgaat ttttagactt aattctagag 960

ttaattttga ggcatttttt ttattatagt ttagttttca gcattggttt ttaaaattgc 1020

caagagcaca tatatacaaa ttttatacat aaatcaattt ttgttgcttc attctatttt 1080

acaacttaat ggcagagcaa acgatgaaaa taatttatat cgtgtgctct agaaatgttg 1140

ttttcactat atcatggatc agtttaggta gccgtgtaga tatccttact ccgtaataaa 1200

acgagccaac aatgctagct tagagccgtt aattattgtt acaagtaaat gcaaccttaa 1260

tctatatatg cttatctgac ttcaaaagaa gtactccaac catgtaacca aaatccaacc 1320

atgttataag tcgatttaat tattctctag ctacttacta aagtttgata tactcttata 1380

tagagaaaat tagcaacatc tacaatacaa aattagtttt attctaacat tcaacacatt 1440

ttgataatac gttttaaaca ttagtatata attctaaaaa ataaattaaa gcaatgtcga 1500

gtggaaaata caacttttat cactgtgatg caatcctata tacgactacc tttatatact 1560

actccatttt gggttacaag acgtttttac tttggtcaaa atcaaactct ttcaaattta 1620

actaaattta tagatacata tagtaatatt tataatacta aattagtttg attcaatcaa 1680

taattgaata tatattcata ataaatttgt cttgggttga aaatgtatta ttttttttac 1740

aaacttggtt aaacctaaag cagtttaact ttgataaaag gtcaaaacgt cttataatct 1800

agattagagg gaatagtacc agtagtcggc aaacacattg caactattgg gccagagtca 1860

agtcaaacta agcatagcac actcctcctt aatacaccct acatacacaa aaccatacta 1920

ctactactag taggagtctc caccgttctg aaaaaagaaa aagaaaaaaa aaaccctcca 1980

tctcccgccc agtgccgccg cgccacgtca cccctccccc gccgcgcgtg tgtgtacgcg 2040

tagcctttcc ggcggagacg cagcacaaaa atggttttac ctgcgatacc cttcgtctcc 2100

ctcacgtccc atccatccct cccccccctt ttccctcctc ctccacctcc actgccatgg 2160

ccgcctccgc cgctcctctc tcccgcgtgg tagccgccgc cggttgccgc cgctagggga 2220

gcgcgacggg ggagcggtag gggcgaccca gctcgctctg tcgccccgcg gctggtgggg 2280

gtgcgcgcgg gggagagcgg ttggttagta tggtgctgga tctcaatgtg gagtcgccgg 2340

gtgggtcggc ggcgacgtcg agctcgtcca cgccgccgcc gccgcccgac ggtggcggcg 2400

gggggtactt ccggttcgac ctgctcggcg ggagccccga cgaggacggg tgctccctgc 2460

ctgtcatgac gcgccagctc ttcccttcgc cgtctgcggt ggtggcgctg gcgggggacg 2520

ggtcgtcgac gccaccgccg acgatgccga cgccggcggc ggctggggag gggccgtggc 2580

cgcgccgcgc ggcggatctc ggggtggcgc agagccagag gtcccccgcc ggcgggaaga 2640

agagccgccg cggcccgagg tctcggagct cccagtacag gggcgtcacc ttctacagga 2700

ggaccgggcg atgggagtcg cacatctggt tagcttcgcc ttgctcgatt tccctcacgc 2760

tgacttcctc tgcttgactc tgcttgattg gagtagtaat ctcttcgttt gtctcgtcca 2820

attttggcag ggactgcggg aagcaggtgt acctgggtga gctcctattt ctagtctccc 2880

aagctaaatt cgctcgcatg actgctaaat ttggctctct acttagcttg attccgattt 2940

gtttgctcct gccttgtttt ttttttttct gttttcaggt ggtttcgata cagctcatgc 3000

cgcagcgagg ttactataga tggtcaccaa ttgtatctta attgttgctc tggtttgccc 3060

tgtgtgctga gattgtagaa ccccttgtgc agggcctatg atcgcgcggc gatcaagttc 3120

agaggcctcg acgcggatat caactttaat ctgaatgact atgaggacga cttgaagcag 3180

gttgtttgga atatagttca attgtcatgt gtgattcttt aggttctaag gggaggttca 3240

gtcaccggcc tgtgatggtt tatgatggat tggttcgtgc tgtgttgtta gatgcgcaat 3300

tggaccaagg aggagtttgt gcacatactt cggcgccaaa gcacaggatt tgcaaggggg 3360

agctcaaagt accggggtgt gacactgcac aagtgtggcc ggtgggaagc tcggatgggc 3420

cagctgctcg gcaagaagta agatccctga aacattgatt gttcttgcta gtaacttaca 3480

atacaataca ttttagatta gttcaggacc atttttcatg ccatgaacga aaactgtgtc 3540

aagtttgctt ttcaaaaagg gaaagaaaaa aaatgtgtca ctaccaagct ggagaatggt 3600

aggctacccc tggagtccac atccacctga agatttggca ccttgatgtt gactcttcac 3660

acactggcca tttactattg gaacaccaca ggtgttcagt gattatagat tgctagcttc 3720

tttaggaaag aactaagtga atcggaatgg ctcaacggaa ttaattgagg ggaaatgttt 3780

ttgtttcctt ggggattgtg ttttgcgtcc taagtcagtg acaggtgaaa agcttcattt 3840

caatgctctt ggttgttttt gccactaaga atgttctgct tatttacgtt gaatttttga 3900

ttggctgttc gtatcatagt tgtgcatttc ctatatatta caatctttgt gaactttaga 3960

taattctggc atgagctctc tctgtggtat tgttctatta acagaagtat cattctgtca 4020

attccccact gataagtgat cttttgtgca ggtacatcta tctaggattg tttgacagtg 4080

aaattgaggc tgcaaggttc agctagtagt actttgctct tctcagtttg atatgtgctt 4140

gctattccta tacttctctc actttcatct actcttcaac ttgtagagca tatgaccggg 4200

cagctatccg cttcaatgga agggaagctg ttactaattt tgatcctagt tcttatgatg 4260

gagatgttct acctgaaacc gacaatgaag gtatttcttt tgtactatgt atattgtgct 4320

ttatccacta gaacgacaaa tccaaatttt atattaacaa aagcacactg gggattgtct 4380

tagcagtggt tgatggagac atcattgact taaatctgag aatttcacag cctaacgttc 4440

atgagctgaa aagtgatggt accctaactg ggttccagtt gaattgtgat tctcctgaag 4500

cttcaagttc tgttgttact caggtaaata tgctacaata tttggtgttt gtaaccgcta 4560

taccatttga gatttgaccg tcttcagatt cttttgatca ggtggttagt cctttttcat 4620

aacattatac tatcactttc aaaataatta gtacactaat tgtatgtgtc actagaattg 4680

ttgtatgaaa ccatctggga accatcttat gcagcttatt gacaaatgac aactcactgt 4740

tgatgtattc ccaaatcaag aaaagccaat ctttttattc aatttctcca gttcattgaa 4800

ttgaaaaaga aattgccgaa caactaccac ctgaagagac tggctagata ttttgtttat 4860

ctgtgtattt ttataaccta taacagttcc aaagccacaa agctctttta ccttgattct 4920

gataacgtta actgaggtat cattttgtga ttgttttctg tagccaataa gtcctcagtg 4980

gcctgtgctt cctcagggca catcgatgtc ccagcatcca catttatatg catctccttg 5040

tccgggcttc tttgtgaacc tcagggtata tctatcatca aaacttatat gcaatttgaa 5100

aagacagtta aacttgtttc aagttaacat tcgattgcta attagctact acttccatgc 5160

tcctatttct tgagatgacg aaccatatgt ttgttccttt aattacataa tggtagccgt 5220

agatactgtt tgccttgtga actgtcagat atagcaggaa gtaaatctgt cagcttgcaa 5280

ctttccatga accacagctg tccaacttta tacagtggat gatgacttgc atttgataca 5340

tcctagtact ttcttgttgc actctgcagc tttagctctg aagatgctct atatttccat 5400

gaatgctcac gttagctctg aaatttcgaa ctttcactcc ataacatgct catttaggct 5460

gtgtttagat ccaaacttca gttcttttcc atcacatcaa cctgtcatac acacacaact 5520

tttcagtcac atcatctcta atttcaacca aaatccaaac tttgccatca actaaacaca 5580

gccttattca ttgttccacc ttttatttct gccattgcta tggtccaatc ttgatacctc 5640

agagagctgc atgatgtgta gaagtcctaa cttaggtccg ttggttagaa tcatccattc 5700

atgtttagga aaagtgatta acaacgtgtg ctgcattaac cattaatgtg gtcaactctg 5760

atgcttgtgc tatggtcact gcaggaagta cctatggaga aaagacctga gttgggtccc 5820

cagtcgttcc ctacttcgtg gtaatggcaa atgcagggct cccctttgcc attactccct 5880

actgcagcat catcaggatt ctctacgggc accgtcgccg acgccgcccg cgcgccttcc 5940

tcccgccccc atccatttcc cggccaccac cagttctact tccccccgac cacctgactg 6000

ccacctattc tggtggaggc gacgcctcac cgtgcatcca ccgccgcttg ccgataacat 6060

tcgtcgtttg tccagagagg gaccttctcc atatgatatc cctctctatg ttccacctgg 6120

ttatgatcag aattctcacg ctcatgattc ttttatcttc atttttgagt gcgaaaccac 6180

caatcgtgac cgtgctacca ggtaaacacc cttgtacctc tttgactcta caataaaatt 6240

attgtaagat attctggcta aaagtgattg gccctcccta ctgtattttt acagagttgt 6300

aattgaacag tgggcactaa agctggggcc cactcgcacc agtgtctagt ggagcgaagc 6360

tttgcccttt tcttgctatc cagcaactat tcctccgcct gcctccattg ctgacagtgg 6420

agatagcttc ccagtggtca ctgttccact gtactctgtc atagtttctg atcaccccta 6480

ttgtgccttg tctctttcac ctcctccctc acttgtgctg cctctggcca ctagagtggc 6540

gccctgcact gttgccatgc atggctgcca cttcgagagt ggagatgggg gttggccttt 6600

gggtgatttc tgtgtgccat cttttggctc aatgtcgttt tgggactggt gcatgtactg 6660

gcaataggtg agatgagata tgaaatgtcc tctgctgctt tttctatcta aggagtagct 6720

tagctatcac cagctgcctt tctcttctca aataaggttg ttaaaagggg gggtcttaaa 6780

gctaccccaa ctgctgccag gggccctctt caatgccctc ccagctgccg tttctttctt 6840

tattggtttg cttctctgct gcttcttttg cctggttgga tggatgtttg tttgttcgta 6900

tgaattgggg gagctactag tatcattcat gagtagaggc aggcagggca gcgcaggctg 6960

ctggctggcc aggcactgat gtgccaacag ctatttccag tgaaacggct gccatttttc 7020

tttgctggga ttgtgatagt ggtaggctgg tagtactagc tagcagtgta ttgggggaaa 7080

tactggtggt ccatttgcct gttagccaat ctgatgcttg cctttccatc cgctggtgat 7140

ggtccatttg ctttggcatc ttgcttgcct gttagtacta caaaagttgc atacatatgc 7200

tattga 7206

<210> 4

<211> 1909

<212> DNA

<213>Rice (Oryza sativa L.)

<400> 4

atccctcccc ccccttttcc ctcctcctcc acctccactg ccatggccgc ctccgccgct 60

cctctctccc gcgtggtagc cgccgccggt tgccgccgct aggggagcgc gacgggggag 120

cggtaggggc gacccagctc gctctgtcgc cccgcggctg gtgggggtgc gcgcggggga 180

gagcggttgg ttagtatggt gctggatctc aatgtggagt cgccgggtgg gtcggcggcg 240

acgtcgagct cgtccacgcc gccgccgccg cccgacggtg gcggcggggg gtacttccgg 300

ttcgacctgc tcggcgggag ccccgacgag gacgggtgct ccctgcctgt catgacgcgc 360

cagctcttcc cttcgccgtc tgcggtggtg gcgctggcgg gggacgggtc gtcgacgcca 420

ccgccgacga tgccgacgcc ggcggcggct ggggaggggc cgtggccgcg ccgcgcggcg 480

gatctcgggg tggcgcagag ccagaggtcc cccgccggcg ggaagaagag ccgccgcggc 540

ccgaggtctc ggagctccca gtacaggggc gtcaccttct acaggaggac cgggcgatgg 600

gagtcgcaca tctgggactg cgggaagcag gtgtacctgg gtggtttcga tacagctcat 660

gccgcagcga gggcctatga tcgcgcggcg atcaagttca gaggcctcga cgcggatatc 720

aactttaatc tgaatgacta tgaggacgac ttgaagcaga tgcgcaattg gaccaaggag 780

gagtttgtgc acatacttcg gcgccaaagc acaggatttg caagggggag ctcaaagtac 840

cggggtgtga cactgcacaa gtgtggccgg tgggaagctc ggatgggcca gctgctcggc 900

aagaagtaca tctatctagg attgtttgac agtgaaattg aggctgcaag agcatatgac 960

cgggcagcta tccgcttcaa tggaagggaa gctgttacta attttgatcc tagttcttat 1020

gatggagatg ttctacctga aaccgacaat gaagtggttg atggagacat cattgactta 1080

aatctgagaa tttcacagcc taacgttcat gagctgaaaa gtgatggtac cctaactggg 1140

ttccagttga attgtgattc tcctgaagct tcaagttctg ttgttactca gccaataagt 1200

cctcagtggc ctgtgcttcc tcagggcaca tcgatgtccc agcatccaca tttatatgca 1260

tctccttgtc cgggcttctt tgtgaacctc agggaagtac ctatggagaa aagacctgag 1320

ttgggtcccc agtcgttccc tacttcgtgg tcatggcaaa tgcagggctc ccctttgcca 1380

ttactcccta ctgcagcatc atcaggattc tctacgggca ccgtcgccga cgccgcccgc 1440

gcgccttcct cccgccccca tccatttccc ggccaccacc agttctactt ccccccgacc 1500

acctgactgc cacctattct ggtggaggcg acgcctcacc gtgcatccac cgccgcttgc 1560

cgataacatt cgtcgtttgt ccagagaggg accttctcca tatgatatcc ctctctatgt 1620

tccacctggt tatgatcaga attctcacgc tcatgattct tttatcttca tttttgagtg 1680

cgaaaccacc aatcgtgacc gtgctaccag gtaaacaccc ttgtacctct ttgactctac 1740

aataaaatta ttgtaagata ttctggctaa aagtgattgg ccctccctac tgtattttta 1800

cagagttgta atttgaacag tgggcactaa agctggggcc cactcgcacc agtgtctagt 1860

ggagcgaagc tttgcccttt tcttgctatc cagcaactat tcctccgcc 1909

Claims

1. a kind of protein is following (a1) or (a2)：

(a2) by the amino acid sequence of sequence 1 by one or several amino acid residues substitution and/or deletion and/or addition and The protein as derived from sequence 1 relevant to vegetable seeds seed holding and/or grain shape.

2. encoding the gene of protein described in claim 1.

3. gene as claimed in claim 2, it is characterised in that：The gene is any DNA in following (b1)-(b5) Molecule：

(b1) code area DNA molecular as shown in sequence 4 in sequence table；

(b4) hybridize and encode and vegetable seeds seed holding with (b1) or (b2) or (b3) DNA sequence dna limited under strict conditions And/or the DNA molecular of grain shape GAP-associated protein GAP；

(b5) DNA sequence dna limited with (b1) or (b2) or (b3) or (b4) is with 90% or more homology and coding and plant species The DNA molecular of sub- seed holding and/or grain shape GAP-associated protein GAP.

4. recombinant expression carrier, expression cassette, transgenic cell line or recombinant bacterium containing gene described in Claims 2 or 3.

5. protein described in claim 1, or, gene described in Claims 2 or 3, in regulation vegetable seeds seed holding and/or grain Application in type.

6. a kind of method for cultivating genetically modified plants, is the expression for inhibiting gene described in Claims 2 or 3 in purpose plant, obtains To genetically modified plants；The genetically modified plants meet the phenotype of following (c1) and/or (c2)：

(c1) seed shattering is lower than the purpose plant；

(c2) seed length is greater than the purpose plant.

7. a kind of method for reducing plant fallen and/or increasing seed length, includes the following steps：It reduces and is weighed in purpose plant Benefit require 1 described in protein expression quantity and/or activity, reduce plant fallen and/or increase seed length.

8. a kind of method for cultivating genetically modified plants, is to obtain channel genes purpose plant described in Claims 2 or 3 to turn base Because of plant；The genetically modified plants meet the phenotype of following (d1) and/or (d2)：

(d1) seed shattering is higher than the purpose plant；

(d2) seed length is less than the purpose plant.

9. a kind of method for increasing plant fallen and/or reducing seed length, includes the following steps：Increase and is weighed in purpose plant Benefit require 1 described in protein expression quantity and/or activity, increase plant fallen and/or reduce seed length.

10. protein described in claim 1, or, gene described in Claims 2 or 3, or, claim 6-9 is any described Method, the application in plant breeding.