CN109293756B - Protein for controlling spore yield and infection capacity of rice blast fungus - Google Patents

Abstract

The invention discloses a protein for controlling the spore yield and the infection process of rice blast fungus and a coding gene thereof. The protein is the protein shown in the following 1) or 2): 1) protein consisting of an amino acid residue sequence of SEQ ID No. 1 in a sequence table; 2) the SEQ ID No. 1 amino acid residue sequence in the sequence table is substituted and/or lost and/or added by one or more amino acid residues, and the protein related to the spore production amount and the infection capability of the rice blast fungus is controlled, and the protein is prepared from the amino acid sequence shown in SEQ ID No. 1: 1, or a derivative thereof. The knockout of the coding gene of the protein of the invention causes the reduction of the spore yield of the rice blast fungi and the reduction of the infection capacity of infectious hyphae. The sporulation amount of the knockout is reduced to about 34 percent of that of wild type P131.

Description

Protein for controlling spore yield and infection capacity of rice blast fungus

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a protein for controlling spore yield and infection capacity of rice blast fungus and a coding gene thereof.

Background

Magnaporthe oryzae is a fungus of Ascomycotina, and can infect various gramineous plants such as rice, wheat and barley, resulting in pestilence. Generally, the damage of rice blast can reduce the yield of rice by 5-10%, and even can cause the rice to be harvested absolutely. The rice blast is one of the main diseases of rice in China and is also a worldwide rice disease.

The rice blast fungus uses conidia as a primary infection source and a secondary infection source for infecting host plants. Conidia of the magnaporthe grisea are pear-shaped and consist of three cells. Under proper conditions, conidia adsorbed on leaves germinate to form attachment cells, mature attachment cells generate infection nails which directly penetrate plant epidermal cells, the infection nails form infectious hyphae in the plant cells, the infectious hyphae expand and colonize in and among the plant cells, gray or grey brown disease spots with the diameter of 2-3 mm are finally formed on the leaves, and the infectious hyphae in the disease spots penetrate through plant tissues and differentiate into conidiophores to further form conidia. Conidia are released and attached under the action of wind and rain, and re-infection of plants is caused. The severity of the blast disease is positively correlated with the production of conidia. If the production of conidia of rice blast fungi and the infection and spreading capability of infectious hyphae of rice blast fungi can be reduced, the occurrence of rice blast and the like can be controlled or the damage degree of the rice blast can be reduced. Therefore, the research on the molecular genetic mechanism in the conidium production amount and the infection capability of the rice blast fungi has important significance for disclosing the molecular mechanism of the conidium production and infection capability of the rice blast fungi and preventing and treating the rice blast.

Disclosure of Invention

The invention aims to provide a protein for controlling spore yield and infection capacity of rice blast fungus as well as a coding gene and application thereof.

The protein for controlling the spore yield and the infection capacity of the rice blast fungus provided by the invention is derived from the protein of the rice blast fungus (Magnaporthe oryzae), is named as MGG-01427, and is 1) or 2) as follows:

1) a protein consisting of an amino acid sequence shown in a sequence 1 in a sequence table;

2) protein which is derived from the protein 1) and has the same activity with the protein shown in the sequence 1 by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid residue sequence shown in the sequence 1 in the sequence table.

Sequence 1 in the sequence table consists of 613 amino acid residues.

In order to facilitate purification of MGG-01427 encoded by sequence 1, tags as shown in Table 1 can be attached to the amino terminal or the carboxyl terminal of a protein consisting of the amino acid sequence shown in sequence 1 in the sequence table.

TABLE 1 sequences of tags

Label (R)	Residue of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The MGG-01427 can be synthesized artificially, or can be obtained by synthesizing the coding gene and then performing biological expression. The encoding gene of MGG-01427 can be obtained by deleting one or several codons of amino acid residues from the DNA sequence shown in sequence 3 in the sequence table, and/or performing missense mutation of one or several base pairs, and/or connecting the 5 'end and/or 3' end thereof with the encoding sequence of the tag shown in Table 1.

The coding gene of the protein (MGG-01427) for controlling the spore yield and the infection capacity of the rice blast fungus also belongs to the protection scope of the invention.

The method is characterized in that the spore yield of the Magnaporthe grisea is reduced by MGG-01427 deletion, the infection control capability is that the elongation capability of Magnaporthe grisea hyphae is reduced by MGG-01427 deletion, and the infection control capability is that the elongation capability of the Magnaporthe grisea hyphae infection in barley leaf cells is reduced by MGG-01427 deletion compared with the wild type.

The nucleotide sequence of the genome DNA of the protein (MGG-01427) for controlling the sporulation quantity and the infection ability of the rice blast fungus is shown as the following 1), 2) or 3):

1) SEQ ID No: 2;

2) a nucleotide sequence that can hybridize with the DNA sequence of 1) under strict conditions;

3) and SEQ ID No: 2 has more than 90 percent of homology and the coded protein has the function of controlling the spore yield and the infection capacity of the magnaporthe grisea.

The coding gene has the nucleotide 1490-2014 from the 5' end of the sequence 2 as the 1 st exon, the nucleotide 2132-3428 from the 5' end of the sequence 2 as the 2 nd exon, and the nucleotide 2105-2131 from the 5' end of the sequence 2 as the intron.

The cDNA of the protein (MGG-01427) for coding and controlling the sporulation quantity and the infection ability of the rice blast fungus is the DNA molecule of the following 1) or 2) or 3):

1) DNA molecule shown in sequence 3 in the sequence table;

2) a DNA molecule which is hybridized with the DNA sequence limited by 1) and codes the rubber tree disease resistance related protein under strict conditions;

3) the nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence of the sequence 3 in the sequence table and codes protein with rubber tree disease-resistant related functions.

The full length of the sequence 3 in the sequence table is 1842 nucleotides, and one coded amino acid (the sequence 1 in the sequence table) is 613 amino acids, namely the protein (MGG-01427) for controlling the sporulation quantity and the infection capacity of rice blast bacteria.

The stringent conditions can be hybridization and membrane washing at 65 ℃ in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS.

The recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant strain containing the coding gene of the protein (MGG-01427) for controlling the spore yield and the infection capacity of the rice blast fungus belong to the protection scope of the invention.

The invention clones a new gene MGG-01427 for controlling the spore production and the infection ability in the rice blast fungus, and carries out preliminary study on the molecular function of the gene. An important application of MGG-01427 provided by the invention is that the expression of the gene and the cutting of the transcript and the expression, modification and positioning of the protein thereof can be used as an important candidate target site for screening and designing antifungal agents. Furthermore, the molecular mechanism and the signal path of the fungal spore production and the infectivity of the gene are analyzed, candidate target sites can be found for screening and designing antifungal agents, and a certain section of the nucleotide sequence of the gene can be used as a probe or used as the basis of PCR primer design for screening and separating sequences of other fungi with certain sequence homology with the gene. The knockout of MGG-01427 gene results in the reduction of the spore yield of Magnaporthe grisea and the reduction of the infectivity of the infectious hyphae. Sporulation of knockout 1427KO2 decreased to about 34% of wild-type P131. The invention is helpful to analyze the molecular mechanism of the spore yield of the rice blast fungi and the infection capability of infectious hypha, and possibly finds the gene which can be used as a bactericide target and the coding protein thereof, thereby laying theoretical foundation and technical foundation for effectively controlling the rice blast.

Drawings

FIG. 1 Cluster analysis of MGG-01427 with homologous proteins in other plant pathogenic fungi. Illustration of the drawings: protein clustering analysis protein: MGG-01427(Magnaporthe oryzae), EJT74718.1(Gaeumannomyces tritici), KUI69080.1(Valsa mali), KXH66273.1 (Coletrichium salicici), EGY19911.1(Verticillium dahliae), ENH73886.1(Fusarium oxysporum) protein clustering analysis was done using clustalx1.83 software.

FIG. 2 shows the construction strategy of gene MGG-01427 knockout vector. The MGG-01427 gene was replaced with the hygromycin HyB gene. The positions of the primers P1, P2, P3 and P4 are shown in the figure.

FIG. 3 validation of the MGG-01427 knockout of the gene. The graph shows Southern blot validation of MGG-01427 knockouts. The genomic DNAs of P131, 1427KO1, 1427KO2 and 1427KO3 were digested with PstI, the positions of the digestion are shown in FIG. 2, and the hybridization probes are the probes shown in FIG. 2.

FIG. 4. Gene MGG-01427 influences the spore yield of Magnaporthe grisea. And (4) carrying out spore production by using a 6cm culture dish according to a method of coating the bacteria and producing the spores, washing the bacteria, producing the spores for 48 hours, and counting. The upper graph is a statistical table of spore production counts of the strains P131 and 1427KO, and the lower graph is a histogram of the average spore production of the two strains.

FIG. 5. the spore production of the complemented strain of gene MGG-01427 was restored to wild type level. And (4) carrying out spore production by using a 6cm culture dish according to a method of coating the bacteria and producing the spores, washing the bacteria, producing the spores for 48 hours, and counting. The graph shows the comparison between the spore yields of the wild type strain, the knockout strain and the complementation body strain.

FIG. 6. Gene MGG-01427 influences the infectivity of Magnaporthe grisea. The upper diagram shows the hypha infection state under an optical microscope after the barley leaves are inoculated by the wild type P131 spores; the lower panel shows the hyphal invasion status of knockout strain 1427KO2 inoculated with barley leaves.

FIG. 7. the virulence of the MGG-01427 knock-out strain 1427KO2 was not clearly different from wild-type P131. The left picture shows the photograph of the leaf disease after the conidium of the wild type P131 strain is sprayed and inoculated on the rice leaf; the right picture is a photograph of the leaf development of a rice leaf inoculated with conidia by spray spraying of knockout strain 1427KO 2.

FIG. 8 shows that the colony growth rate of MGG-01427 knock-out strain 1427KO2 is not significantly different from that of wild-type P131. The upper panel shows the colony growth status of wild type strain P131 and knockout strain 1427KO2 on OMA medium; the lower panel is a histogram of colony sizes of the two strains.

FIG. 9 Gene MGG-01427 was expressed throughout the infection. The images are photographs of the various stages of infection taken in phase contrast (DIC) and fluorescence (GFP) fields. The gene is expressed in hypha, conidium, adhesion cell and infectious hypha.

Detailed Description

The methods in the following examples are conventional methods unless otherwise specified.

The percentages in the following examples are by mass unless otherwise specified.

Example 1 obtaining of proteins controlling spore yield and infection ability of Pyricularia oryzae and genes encoding the same

The inventor of the invention discovers a protein for controlling the spore yield and the infection capacity of rice blast fungus by screening random insertion mutants, is derived from a rice blast fungus strain P131, and can obtain the protein according to the following method:

1. cDNA fragment cloning (sequence 3 in sequence table)

Specific primers were designed as follows:

f (5' end): GC CATATG GCGACCAACGGCGAAACGCCCA

R (3' -end): GC GAATTC ATGTCCTCT TGCATCCGATCTGCT

Taking first strand cDNA obtained by reverse transcription of a rice blast fungus P131 random primer as a template, taking F and R as primers, and carrying out PCR amplification in a 25 mu L reaction system, wherein the final concentration of the primers is 10 mu mol/L. The amplification procedure was: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 2min for 35 cycles; final extension at 72 ℃ for 10min, 4 ℃ for forever. Obtaining a nucleotide fragment of about 1842bp, which is the gene full-length fragment of the protein for controlling the sporulation quantity and the infection capacity of the rice blast fungus, and sequencing shows that the fragment has a nucleotide sequence of a sequence 3 in a sequence table and encodes the protein shown in the sequence 1 in the sequence table.

2. Full-length cloning of protein gene for controlling spore yield and infection capacity of rice blast fungus (sequence 2 in sequence table)

Genome sequence amplification primers:

CAACCTGTGGCTCTGGGAGCA as a forward primer;

reverse primer CCATTGGAGTAGTATTATGC.

After extracting genomic DNA from the wild type strain P131, the MGG-01427 genomic sequence was amplified by PCR using the following amplification procedure using the forward and reverse primers.

Pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 6min for 35 cycles; final extension at 72 ℃ for 10min, 4 ℃ for forever. Finally amplifying a 5609bp genome sequence, and sequencing the genome sequence to show that the genome sequence has a nucleotide sequence of a sequence 2 in a sequence table and a protein sequence of a sequence 1 in a coding sequence table.

3. Cluster analysis of protein MGG-01427 for controlling spore yield and infection capacity of magnaporthe grisea and homologous protein in other fungi

The amino acid sequence of the isoprothiolane MGG-01427 was aligned at NCBI (http:// www.ncbi.nlm.nih.gov /) to find its homologous analogs across different species: MGG-01427(Magnaporthe oryzae), EJT74718.1(Gaeumannomyces tritici), KUI69080.1(Valsa mali), KXH66273.1 (Colletrichum salicici), EGY19911.1(Verticillium dahliae), ENH73886.1(Fusarium oxysporum). After alignment analysis of the above amino acid sequences with clustalx1.83 software, a tree of evolutions between the protein MGG-01427 and its homologous analogues was constructed. Through comparison, the protein MGG-01427 and the analogues thereof have a SPRY _ ash2 domain, the domain is involved in regulating histone H3K4 methyltransferase, and chromatin modification and epigenetic transcription activation are related. Has important function in the aspect of fungus epigenetics and influences the growth and development of fungi. It can therefore be concluded that the MGG-01427 type protein is a conserved protein ubiquitous in fungi, as shown in FIG. 1.

Example 2 demonstration of the Effect of the Gene MGG-01427 for controlling spore yield and infection ability of Pyricularia oryzae on spore yield of Pyricularia oryzae

The invention adopts gene knockout experiments and gene complementation experiments to prove that MGG-01427 has the function in the aspect of the spore yield of Magnaporthe grisea. The part of the contents comprises the construction of a knockout vector and a complementary vector, the protoplast transformation of the rice blast fungus, the acquisition of a corresponding transformant and the determination of sporulation quantity.

1. Construction of knockout vectors

Construction of the knock-out vector involves ligating a DNA sequence flanking the coding region of the gene into a vector, separated by the hygromycin gene. Homologous recombination is carried out between flanking sequences on two sides of the gene and corresponding sequences of the genome of the wild strain, so that the genome gene sequence of the corresponding site in the genome is replaced with the hygromycin gene.

When constructing a knockout vector of the gene MGG-01427, designing PCR primers, respectively amplifying a left arm fragment (the 515 th and 1606 th nucleotide sequences of the sequence 2 in the sequence list) and a right arm fragment (the 3456 th and 4551 th nucleotide sequences of the sequence 2 in the sequence list), wherein the 5 'of the left arm forward primer 5'-CATGGTACCGCCACCTGGCAAAG-3'is provided with a KpnI restriction site, the reverse primer is 5'-CATGTCGACGCCGGTTGTATGCTC-3', and the 5' end of the reverse primer is provided with a restriction site; right forward primer 5'-CATGAATTCGGAAGATGCGGGAGGTG-3' contained an EcoRI cleavage site 5 'and reverse primer 5'-CATACTAGTGGCTGGCTTGGTCTCTG-3'contained a SpeI cleavage site 5'. The left arm is cut by KpnI and SalI, and the right arm is cut by EcoRI and SpeI to obtain two fragments of the left arm and the right arm. The left arm was ligated to the left side of hygromycin resistance gene of pKOV21 vector similarly double digested with KpnI and SalI, then the right arm was ligated to the intermediate vector pKOV 21-left arm obtained in the previous step, digested with EcoRI and SpeI, and ligated to the right side of hygromycin resistance gene, to obtain knock-out vector pKO-01427 (see FIG. 2).

Restriction enzymes, ligase, involved in the construction process were produced by NEB (beijing) limited and used with reference to the product specification; taq enzyme is manufactured by Takara, Inc., and used with reference to the product description.

2. Rice blast bacterium gene MGG-01427 knockout transformation

In the present invention, transformation of Pyricularia oryzae is carried out by using CaCl 2/PEG-mediated protoplast transformation, and the protoplast is prepared and transformed by the following method:

a. preparation of protoplasts

Placing a 500 ml conical flask into 200 ml liquid CM culture medium (yeast extract 0.6%, enzyme hydrolysis casein 0.03%, acid hydrolysis casein 0.03%, sucrose 1%), inoculating appropriate amount of wild type P131 mycelium spore mixture, shaking at 26-28 deg.C and 100rpm for 30-36 hr, filtering with three-layer sterilized mirror paper to collect mycelium, washing mycelium with 0.7M sodium chloride solution, transferring to sterilized 50ml centrifuge tube, adding 1 ml enzyme penetrating fluid (containing 20mg/ml of crashing enzyme and prepared with 0.7M sodium chloride) to each 1 g mycelium, performing enzymolysis at 26-28 deg.C and 100rpm for 3-4 hr, washing mycelium with 0.7M sodium chloride, filtering with three-layer sterilized mirror paper, centrifuging at 4,000rpm for 15 min, discarding supernatant, washing protoplast with 25ml STC (1.2M sorbitol, 10mM Tris-7.5.50mM) first, dissolving the precipitate with STC, adjusting protoplast concentration to 0.5-1 to 10. 1 × 10mM⁸The mixture is ready for use after being mixed in each ml.

b. Transformation of Magnaporthe grisea

The wild type P131 protoplast is divided into 50ml sterilized centrifuge tubes, each tube contains 300. mu.l, about 2. mu.g of linearized knockout vector (vector pKO-01427 linearized with restriction enzyme NotI), and is placed on ice for 20 minutes, 2 ml/tube of PTC solution (60% PPO 3350, 10mM Tris-pH7, 5.50mM calcium chloride) is added dropwise, and is left on ice for 20 minutes, 25 ml/tube of precooled STC is added, after mixing, centrifugation is carried out at 4,000rpm and 4 ℃ for 15 minutes, the supernatant is discarded, 3 ml of LR medium (0.1% yeast extract, 0.1% enzymatically hydrolyzed casein, 1M sucrose), after culturing at 26-28 ℃ for 12-18 hours, the mixture is transferred to a petri dish, 15 ml of SR (LR + 1.6% agar) cooled to about 50 ℃ is added, after solidification, 15 ml of 0.7% agar is spread on the mixture, 400. mu.g/ml hygromycin (Millipore, USA) was cultured at 28 ℃ for 4-6 days, the emerging transformants were transferred to solid CM medium, 400. mu.g/ml neomycin (Sigma, USA) was contained, and the non-neomycin resistant transformants were transferred to oat tomato agar medium.

3. Verification of Gene MGG-01427 knockout

Three knockout transformants 1427KO1, 1427KO2 and 1427KO3 were randomly selected, and in order to verify whether 1427KO1, 1427KO2 and 1427KO3 were true knockouts, we performed Southern blot experiments to completely digest genomic DNA of wild-type P131, knockouts 1427KO1, 1427KO2 and 1427KO3 with restriction enzyme PstI, using the right arm as a probe, at the probe positions shown in fig. 2. Using an isotope-labeled primer Pr 1427F: ACCGTTGACAATCTGGAA and Pr 1427R: TCTGCGTTAAGAGTGAGC verification tests were performed. A 5078bp target band appears in lanes of wild type P131 and knockout transformant 1427KO 1; knocking out a 6239bp target band of a transformant 1427KO 2; knockout transformant 1427KO3 shows two bands. This indicated that knockout transformant 1427KO2 is a true knockout of gene MGG-01427, as shown in FIG. 3.

4. Sporulation amount determination of gene MGG-01427 knockout

The sporulation amount of the gene MGG-01427 knockout 1427KO2 is reduced and is about 34 percent of that of wild bacteria P131. All methods for collecting conidia mentioned in the present invention are smear spore production methods.

a. Rice blast bacterium coating spore production method

Culturing the required Magnaporthe grisea strain on oat tomato culture medium (containing 150ml tomato juice and 50 g oatmeal per liter, boiling for 30 min, filtering to obtain filtrate, and 20 g agar) at 28 deg.C under illumination for 5 days, cutting off the mycelia with bacteria-coating ring, uniformly coating on new tomato juice oatmeal culture medium, and culturing at 28 deg.C under illumination. When the new mycelia grow out of the surface of the culture medium, the mycelia are washed off by a cotton swab lightly and washed clean by water, a single-layer gauze is covered, and after the culture medium is subjected to illumination culture at 28 ℃ for 48 hours, a large amount of rice blast fungus spores can be seen on the surface of the culture medium. Washing the conidia with sterilized distilled water, wiping the lens paper to filter the conidia spore and hypha mixed solution, and collecting the conidia solution.

b. Reduction in sporulation yield of knockout 1427KO2 of gene MGG-01427

According to the smear spore production method, wild fungi P131 and knockout 1427KO2 of gene MGG-01427 were sporulated using a 6cm petri dish. Conidia of the knockout 1427KO2 of the wild strain P131 and the gene MGG-01427 were eluted with distilled water, and the volumes were determined to 50ml, and counted under an optical microscope using a hemacytometer, and the data showed that the sporulation of the knockout 1427KO2 of the gene MGG-01427 was decreased, and the sporulation was about 34% of that of the wild strain P131, as shown in table 2 and fig. 4. Spore liquid eluted by each dish of bacteria is counted for 3 times, each strain is repeated for 3 times, and the spore yield experiment is independently repeated for 3 times.

TABLE 2 comparison of sporulation yields of wild-type and knockout mutants

5. Construction of complementary vectors

Complementary vector means that a DNA fragment containing the full-length functional sequence of MGG-01427 was ligated to a vector carrying a neomycin resistance gene. The neomycin resistance gene is not a limitation of the present invention, and other genes causing antibiotic resistance, i.e., genes causing fungal resistance other than the neomycin resistance gene, can achieve the same effect.

Firstly, designing a primer, amplifying a fragment containing complete MGG-01427, wherein the used forward primer is 5'-CTGGATCCGACCTTGACGTTAATAC-3', and the 5' of the forward primer has a BamHI enzyme cutting site; the reverse primer is 5'-GCGAATTCACGGCGATAATGATG-3', which carries an EcoRI cleavage site at the 5' end. A fragment 3485bp (nucleotide sequence 327-3811 at the 5' end of the sequence 2 in the sequence list) containing the nucleotide sequence coding MGG-01427 is amplified from the genome DNA of the wild type P131, wherein the self-promoter contains 1163bp, the target fragment is cut by using restriction enzymes BamHI and EcoRI, and the pGTN vector is cut by using the restriction enzymes BamHI and EcoRI, and finally the plasmid vector pKNTG-01427 containing the fusion gene MGG-01427-GFP and the selection marker neomycin phosphotransferase gene is obtained. This vector can be used not only to complement knockout 1427KO2 of gene MGG-01427, but also to obtain subcellular-localized transformants of the gene.

The construction method of the pGTN vector comprises the following steps: the GFP sequence (GENEBANK No.: NC-011521.1) was inserted between XbaI and NotI at the multiple cloning site using pBluescript II KS (-) vector as the starting vector; inserting a TrpC promoter (sequence 4) between the NotI restriction enzyme cutting sites and the SacII restriction enzyme cutting sites; neo (neomycin resistance gene, sequence 5) was inserted between the SacII and SacI cleavage sites, thereby constructing a pGTN vector.

6. Production of complement and determination of spore production of complement

The sporulation of the gene MGG-01427 complement is restored to the level of wild type P131.

The constructed complementary vector pKNTG-01427 was linearized with restriction endonuclease Not I and added to knockout 1427KO2 protoplasts, and CaCl was transformed according to the knockout protoplast transformation method₂PEG-mediated transformation experiments, the upper antibiotic medium used 400. mu.g/ml neomycin.

Next, the amount of produced spores of the complement was determined according to the method for determining the amount of produced spores of the knockout. The data show that the sporulation of the complement of gene MGG-01427 returns to the level of wild-type P131, as shown in FIG. 5.

Example 3 knock-out 1427KO2 of Gene MGG-01427 influences the infection ability of Magnaporthe grisea

1. In-vitro barley leaf inoculated with mycelium block

Cutting fresh hypha blocks of wild type P131 and knockout 1427KO2 with scalpel blade, respectively, the hypha block size is about 2mm × 2mm, the hypha face is downward, inoculating scratched barley leaf, keeping moisture in dark for 24 hr, culturing in dark and dark alternately for 5 days, and observing.

2. Knockout 1427KO2 rice blast fungus infection ability of gene MGG-01427 is reduced

Respectively taking the infected barley leaves of the wild P131 and the knockout 1427KO2, and observing the hypha infection state by using an optical microscope. Knockout 1427KO2 was found to have a reduced invasive hyphal invasion elongation ability in barley leaf cells compared to wild-type P131, as shown in fig. 6.

Example 4 No significant changes in the virulence of knockout 1427KO2 of gene MGG-01427

The wild type P131 and the knockout 1427KO2 were sporulated according to the Blastomyces dermativus method, the conidia were washed with 0.25% geltin solution, and the mixture of conidia spore and hyphae was filtered with a glass-wiping paper to collect the conidia solution. Conidia concentration was adjusted to 5X 104 spores/ml using a hemocytometer, and sprayed onto 28-day-old Lijiang Xinjiang black rice leaves. After 24 hours of dark moisturizing culture at 28 ℃, after 5 days of light and shade alternate moisturizing culture, typical rice blast fungus lesions appeared in large quantities in both wild type P131 and knockout 1427KO2, as shown in fig. 7. The gene MGG-01427 shows no obvious influence on the pathogenicity of rice blast fungi.

Example 5 No significant change in colony growth Rate of knockout 1427KO2 of Gene MGG-01427

New mycelia of wild type P131 and knockout 1427KO2 were cut with a scalpel blade, and the size of each mycelia was about 3 mm. times.3 mm. The mycelial piece is placed face down and transferred to the center of OMA culture medium prepared in the same batch. The transferred wild-type P131 and knockout 1427KO2 were cultured under the same conditions (28 ℃ C. light) for 5 days, and then observed to measure the colony size. The results showed that the colony sizes of wild type P131 and knockout 1427KO2 were substantially the same with no significant change in growth rate, as shown in FIG. 8.

Example 6 dynamic analysis of expression of Gene MGG-01427

A hypha piece of the 1427HB1 strain containing the tip of a nascent hypha was placed on a glass slide with the hypha facing down, and after incubation for 48 hours, the expression of GFP in the hypha was observed and photographed by Nikon Eclipse 800. The conidia of 1427HB1 were eluted with sterile distilled water, filtered with a glass-wiping paper, spotted on glass slides to prepare simple slides, and observed and photographed by Nikon Eclipse 800 for GFP expression in conidia. The conidia suspension was spotted on cover glass, and after 24 hours of dark moist culture, the expression of GFP in the adherent cells was observed and photographed under a microscope. The rice plants of about 60 days are selected, the leaf sheaths are sequentially pulled apart along the natural textures, and the second leaf sheath is used for inoculation (the innermost leaf core is the first, and the second leaf sheath and the third leaf sheath are sequentially arranged from inside to outside). Conidia of the desired strain were eluted with sterile distilled water to adjust the concentration to 106 spores/ml, and then the spore liquid was poured into the second leaf sheath by a pipette. After the roots of rice plants were moisturized with a moist absorbent paper and cultured in the dark at 25 ℃ for 48 hours, the expression of GFP in the infectious hyphae was observed and photographed by Nikon Eclipse 800. The transformant 1427HB1 of the MGG-01427-GFP fusion vector has no obvious difference from the wild strain P131 in the phenotypes such as conidium morphology and infectious hypha, and the like, thereby indicating that the MGG-01427-GFP can drive the function of the gene MGG-01427. GFP expression was observed in conidia, anchorage cells and infected hyphae of 1427HB1, indicating that gene MGG-01427 was expressed throughout the infection, as shown in FIG. 9.

<110> Beijing college of agriculture

<120> a protein for controlling the spore yield and infection ability of Magnaporthe grisea

<130>WHOI180066

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>613

<212>PRT

<213> Magnaporthe oryzae (Magnaporthe oryzae)

<400>1

Met Ala Thr Asn Gly Glu Thr Pro Lys Arg Glu Leu Thr Pro Ala Ala

1 5 10 15

Ala Thr Ser Thr Ala Pro Ala Ala Thr Arg Ser Thr Ser Pro Arg Ala

20 25 30

Gly Thr Pro Pro Ala Ser Ser Leu Pro Gln Lys Arg Val Leu Met Glu

35 40 45

Asp Asp His Ala Pro Ala Val Arg Ser Pro Leu Asn Pro Asp Ala Arg

50 55 60

Ser Ala Pro Ala Arg Ala Gln Ser Gln Ala Arg Asp Glu Gln Gln Pro

65 70 75 80

Ser Gly Val Ala Ala Arg Glu Lys Arg Thr Lys Lys Glu Ser Leu Lys

85 90 95

Lys Arg Glu Ser Lys Gly Val Val Gly Gly Ala Gly Gly Ser Ala Thr

100 105 110

Val Glu Ser Ser Arg Ala Thr Pro Asp Pro Arg Gln Lys Asp Gln Ser

115 120 125

Pro Ile Asp Pro Asn Lys Ala Ala Pro Ala Arg Tyr Pro Gln Leu Leu

130 135 140

Pro Ala Met Arg Ser Ser Asp Phe Glu Ala Pro Arg Ala Pro Thr Phe

145 150 155 160

Thr Ser His His Glu Val Thr Gly Pro Asp Gly Glu Thr Ile Glu Phe

165 170 175

Gly Glu Thr Thr Glu Gln Ser Val Asn Arg Lys Gly Tyr Val Tyr Asn

180 185 190

Tyr Cys Ile Ala Asp Pro Ala Phe Pro Ser Met Val Tyr Tyr Arg His

195 200 205

Thr Asp Gln Leu Pro Tyr Thr Ala His Leu Ser Val Glu Asp Ala Ala

210 215 220

Gln Gln Met Tyr Phe Asp Arg Ser Ala Met His Val Thr Gly Glu Leu

225 230 235 240

Gly Phe Arg Met Ala Arg Ala Asn Val Gly Val Arg Glu Gly Arg Trp

245 250 255

Tyr Trp Glu Cys Lys Val Thr Arg Gly Val Ile Asn Pro Glu Arg Ser

260 265 270

Lys Gln Lys Ser Ala Glu Asn Asp Ala Glu Gly Glu Val Asn Glu Ala

275 280 285

Lys Ser His Gly His Val Arg Met Gly Trp Ala Arg Arg Glu Ala Ser

290 295 300

Arg Asp Ala Pro Val Gly Leu Asp Ala Tyr Ser Tyr Ala Ile Arg Asp

305 310 315 320

Val Gly Gly Gln Lys Val His Met Ser Arg Pro Lys Asp Phe Phe Pro

325 330 335

Pro Gly Glu Asp Val Arg Glu Gly Asp Val Ile Gly Leu Glu Ile Cys

340 345 350

Leu Pro Ser Glu Gln Leu HisArg Lys Val Val Gln Gly His Tyr Asn

355 360 365

Pro Ala Val Asp Leu Leu Asp Glu Glu Thr Pro Asp Leu His Ala Ala

370 375 380

Ala Glu Ala Ser Asn Ile Val Arg Glu Arg Val Val Ile Arg Gly Lys

385 390 395 400

Thr Asn Leu Phe Ser Glu Val Phe Asp Tyr His Pro Ile Lys Glu Leu

405 410 415

Glu Asp Leu Met Asn Pro Ser Pro Met Ala Ala Ala Gly Ala Gly His

420 425 430

Gly His Leu Ser Glu Arg Pro Asn Pro Asn His Arg Val Pro Cys Leu

435 440 445

Arg Thr Leu Pro Lys Ser Tyr Ile Lys Ile Tyr Lys Asn Gly Val Leu

450 455 460

Met Gly Thr Pro Phe Glu Asp Leu Leu Ser Phe Leu Pro Pro Ala Ser

465 470 475 480

Thr Pro Asn Ala Lys Leu Gln Asp Gly Ala Lys Glu Gly Phe Asp Asp

485 490 495

Gly Thr Val Gly Tyr Tyr Pro Ala Val Ser Val Phe Arg Gly Gly Ala

500 505 510

Ala Glu Val Asn Phe Gly Pro Asp Phe Trp Tyr Pro Pro Pro Gly Tyr

515 520 525

Gly Ser Ser Thr Ser Ala Thr Ala Thr Asn Gly Asp Val Glu Met Thr

530 535 540

Asp Ala Asp Ala Ala Ala Val Pro Asn Thr Ser Thr Gly Pro Ser Ala

545 550 555 560

Pro Pro Thr Val Lys Pro Met Phe Glu Arg Tyr Asn Glu Gln Ile Ala

565 570 575

Glu Asp Ile Val Tyr Asp Ile Ile Asp Glu Val His Phe Trp Val Gln

580 585 590

Asp Gly Arg Lys Ala Asp Gly Asn Ile Asp Gly Val Asp Ala Ala Asp

595 600 605

Arg Met Gln Glu Asp

610

<210>2

<211>5609

<212>DNA

<213> Magnaporthe oryzae (Magnaporthe oryzae)

<400>2

caacctgtgg ctctgggagc accaaggccc gacgcttgct actctgctca gcctcgcgca 60

tcttttgcat acggccagct ttgagcgctt cttgtagaga tgcagactgt gacccttcct 120

tgtcgttctt cctcctcttc cgatccgcgt cctcgtcctg gtcgcccttg cgtttggtgg 180

caagttggac ctttttggga tcgaaagcggcgcgttcgcg ctcgttccgg gcaagctctt 240

ctgatgtgtc gtagaaacca ggtgcgggct tctgttcgaa aggaatgtcg gcgttgtagt 300

ccatctggcc cggtttcctg gttgtgacct tgacgttaat accagccgtc ttgagctcac 360

gcctcttctg cagcgcagcc agccggcgtg actcttcctg ttggcgttcc cgagccttcc 420

tcttggcttt ctttccttga gtgtttgcca aacgggcgcg cgcttcgctc agcatttctt 480

tctcgtcctc gtcgaggtcg actgtgtcgg ccttggctgg cttggtctct gggtccgggt 540

cgatctctcc agggcgcaga cgacggacag aatcggcagt cggtgcgcta gcctcaccag 600

tcccggtgag gcccagtgct gccgcggcct ccttctgctc ggcctcgtcg agaagcttct 660

ggtagcgctc aaggcactgg ttcgccgtgc ggcccacgat gggggcgatc gtgcgccatt 720

gggtcggcat caatttagcc aggtgcagca gtttttcgtc ctcatccttg ctccactcga 780

tcttgcggat gctcgggtcc agccactcgt tccatcgcgc cttgcactgc tttggcgtct 840

tgcgcgccag cagtgacgag acgcgtgccc attgattcaa accatatttg gagacggatg 900

ccttgagtat ctcgtcctcg atgttggtcc aaacccctcc tttgacgaca ggcatgatgg 960

cggctggctc ggcgggcacc gaggtgggtg gtttgtgatg gcgttgctgt cgggagtaga 1020

aacgcgattg caaaccagat gaaattcacg ccctaaaaga tgtatgtttg caagggttcc 1080

aattatcgaa gtttacgagt tggagatgag cggcgactgg taaaaagatc caataaaatg 1140

tggccatgcc attggtgtac ggacctgtaa agtggggaca aacgtcaccc ctgctgcagg 1200

gaagttgaag gcaccaaagg gactgcgggc tttctggttg ctcaattgag ctccaagcta 1260

caggaaagta atcgcattgt acctgcagct acgaaacttg cttcaaattc agaccgattt 1320

acctgcgtag actaagagct gggtatcaga acgaccaagt ctattcgtct gtggaaactt 1380

gtcctttgca tcaagtttag tcttttccgt ttcttgtcag cgggctttat tgccctcaac 1440

ttaacatttt ctacagcata caaatgatca ggtagcgctc accaacagca tggcgaccaa 1500

cggcgaaacg cccaaaaggg aattgactcc agcagcagcg acaagcacag cgccagcagc 1560

caccagatcg acctcgccca gagccggcac acctcccgca tcttcccttc cccagaagcg 1620

cgtcctgatg gaggacgacc acgcgcccgc cgtccggtcc ccgctcaacc cagacgcgag 1680

gtccgccccg gccagggcgc agtctcaagc ccgcgatgag cagcaaccat ccggcgttgc 1740

tgcgcgcgag aagcgcacca agaaggagtc tttgaagaaa cgcgagagca agggtgttgt 1800

tgggggtgcg ggtggttccg cgacggtcga gagctcgagg gctacgcctg atcctaggca 1860

aaaggatcag agccccattg acccaaacaa agccgctcca gcgcgatatc cccagctgct 1920

ccccgccatg aggagtagcg actttgaggc tcctcgcgcg ccaactttta caagtcacca 1980

tgaggttaca gggcctgacg gcgagactat cgagtttggt gagacgacag agcagtgagt 2040

ttatgtccta ccacccgtcc agggtttgtc aaacaagcca aatgcaaata ttaagagcat 2100

acagctgact gttatctcgt tgccaatgta gatcagtgaa cagaaaaggt tatgtctaca 2160

actactgcat agctgatcca gcgtttccct ccatggtcta ctaccgtcat accgaccagc 2220

tcccatacac cgcccatctc agcgtagaag acgcggcaca acaaatgtac ttcgaccgat 2280

ccgccatgcacgttactggt gagctgggct tccgcatggc gcgagcgaat gtaggagtgc 2340

gtgagggccg ctggtattgg gaatgcaagg tgacgcgcgg tgtaataaac cccgaacgaa 2400

gcaaacaaaa atccgcagaa aacgatgctg aaggggaggt gaacgaggca aagtcacacg 2460

gtcacgtgcg aatgggttgg gcgcgcaggg aggcatcgcg ggatgcgccg gtcggtctgg 2520

acgcatacag ctatgcgata cgtgacgttg gcggtcagaa ggtgcacatg tcacggccaa 2580

aggacttctt cccgcccgga gaggacgtgc gggaaggcga cgtaataggc ctggagatat 2640

gccttccatc ggagcagctg catcgcaagg ttgttcaggg ccactacaac cccgccgtcg 2700

atcttctaga cgaggagaca ccggacctcc acgctgccgc cgaagcgtcc aacattgtgc 2760

gggagcgggt ggtaatacgg ggcaagacga atcttttctc ggaagttttc gactaccatc 2820

cgatcaagga gttggaagac ctcatgaatc cgtcgccaat ggctgcagcc ggcgccgggc 2880

acggccactt gtcagaaagg ccaaacccaa accaccgtgt cccgtgccta cggacactgc 2940

ctaaatcata catcaaaatc tacaaaaacg gtgttctcat gggcactcca ttcgaggacc 3000

tactgagctt cttgccccct gcttcgacac cgaatgcaaa actacaagac ggcgccaagg 3060

agggtttcga cgacggtaca gtgggctact acccagcagt gagcgtgttc cgtggagggg 3120

cggccgaggt aaatttcggc cccgatttct ggtacccgcc gccgggctat gggagctcaa 3180

catctgcgac ggcgacaaac ggcgacgtgg agatgacgga tgcagacgct gccgccgtcc 3240

ccaacacaag tactggacca tcggccccgc caaccgtgaa gcctatgttc gagagataca 3300

acgagcagat agccgaggac atcgtttacg acatcataga tgaggtgcat ttctgggtgc 3360

aagacggccg caaggcggac gggaatatcg atggggttga tgcagcagat cggatgcaag 3420

aggactgagc aacttggatt ctgaatatca ggaaggccgg ttgtatgctc tagactctag 3480

ccccaagtcc tacatatcga tagagagttg gctaggtcat gggccagtgt ctacgcatac 3540

acggtcgccc agcctcttct ttgagcattt tggctcgggt tttcggatct atgagggtaa 3600

tttggcgtaa aagggatacc ccgcggctca gcagctgcgc tttacgagac atgaaatgac 3660

cgttgacaat ctggaagacg tactcgagct ccaaacttat cacctgccgt aggaatcctc 3720

acagtgaaca aaagcaattg ctgcttgatg cataaactaa actaaagtac gattggggtc 3780

ataaacgggt attaaacatc attatcgccg taatatccat gttgccatct gacgcattaa 3840

ttttcgcagt cgggtccgac cagaagagtg tctacatttg tcaagtcctg ctcaagaatt 3900

gactcgcgtc aacgagtatg tcatctgaac tgcatatttc atctgacctc tcacttgcta 3960

ccgctaccct ggcctacagg tggtggcggc agcttggacg atgaggcgga tcccgaagct 4020

tcacctgccg gtggagcggg gagtagaggg tcatcaggca gctcctcgat ccggtcacct 4080

gcctcggtcg tccgttctcc ttcgaggcga acctcacggc cacgtttgtg gcagtaccaa 4140

agtacgaaaa gcagcactaa ggaattattt tgcggttagc cagatagctc actcttaacg 4200

cagaacatga aagatcctgc gtgcaagact tacaaaatat ggctatactc caaatcacgt 4260

tggtgccaat aaaggcgggc caacgcagct tgagcgcatt cacaatggct ttgagcatgc 4320

tcaagatagc gcccggctta gttatgagct cctgaaggtt gcctggcttg atcagtttta 4380

tggccgtctc cttgatcccg cccttggagt tgtccgtgtg ctccatgccc tgcgacttgg 4440

ccgccgcggc gaggagctcc ggcgccaggc tgccggaaat cttatcgggc atctgctgca 4500

ccagcttctt gaggctggcc ggcagcttct cgtagttctt tgccaggtgg ccgtccgggt 4560

cctcgagaag cgtcttgagg tcgttggcgg ccgtcggcac accattcacc aggtccttca 4620

gcacctgcgt gaagtcattg acgagctcgg tcgactcctt ggacagcgag aagacgcggt 4680

tgttttgtgc ggagaggttc aggtcgtcga ggacgcgggt caggtcgtcc ttttcccgct 4740

cggcgtcttc ttccgagacg ggggccttgg ggttcggctt gacgtcgggc tgcttcttgc 4800

ccgggcgacg aactagcacc gagatgcggc ggccgatgcg attcgcaaac ttgccatcgc 4860

cgtcctttgg tttgtccgcg acagcagacg ccgcagcttc ctctcccgcc ttttctttac 4920

ccttgccctt gttcgcaacc atgaaggatt cggcatcgct gtcccaacca atctcaggcg 4980

tctttatgcg tggaggcaag ggcggcctgg ggccctcgtc gtcgtcgcca ttctgcgcat 5040

ccctaagggt gatgagcgat gagtcctggg ttgtcaggag cctaaagaac ctctcgtcct 5100

cgtcctggag gagcggcgac ctgggctctg ttgttgtcgt cgccgacgcg ctgggctcga 5160

cgatttgtgg gatgttgctg gtgctggctg gagtgcctgt ggcctcttga ctcaggcgtt 5220

tctgctctgc ctcctgcttt tgtgcttgat gcttcttgaa ctttctgtaa gtgaaatatt 5280

caagcatcgt tgtggtcttt agcggcccta ctggctgcca agttgtgtcg gtttgagatt 5340

atttgctgtt tagtttgatc tgcacgcagc acaatcagag agtgcgtccc gctcgtgtcg 5400

gttgatttgt gagaaacctc tccttgcggg ggagggagct agctcagtag aatagtggct 5460

tgtctcggtt tttaagatgc ggtctagacc agtagaccaa atgcgaccgt gaggaggcag 5520

ctcaatagtc gattgatttt tcgcgaacta ctcctttaga gccctccgtt agtgcacaga 5580

ggaggccttg cataatacta ctccaatgg 5609

<210>3

<211>1842

<212>DNA

<213> Magnaporthe oryzae (Magnaporthe oryzae)

<400>3

atggcgacca acggcgaaac gcccaaaagg gaattgactc cagcagcagc gacaagcaca 60

gcgccagcag ccaccagatc gacctcgccc agagccggca cacctcccgc atcttccctt 120

ccccagaagc gcgtcctgat ggaggacgac cacgcgcccg ccgtccggtc cccgctcaac 180

ccagacgcga ggtccgcccc ggccagggcg cagtctcaag cccgcgatga gcagcaacca 240

tccggcgttg ctgcgcgcga gaagcgcacc aagaaggagt ctttgaagaa acgcgagagc 300

aagggtgttg ttgggggtgc gggtggttcc gcgacggtcg agagctcgag ggctacgcct 360

gatcctaggc aaaaggatca gagccccatt gacccaaaca aagccgctcc agcgcgatat 420

ccccagctgc tccccgccat gaggagtagc gactttgagg ctcctcgcgc gccaactttt 480

acaagtcacc atgaggttac agggcctgac ggcgagacta tcgagtttgg tgagacgaca 540

gagcaatcag tgaacagaaa aggttatgtc tacaactact gcatagctga tccagcgttt 600

ccctccatgg tctactaccg tcataccgac cagctcccat acaccgccca tctcagcgta 660

gaagacgcgg cacaacaaat gtacttcgac cgatccgcca tgcacgttac tggtgagctg 720

ggcttccgca tggcgcgagc gaatgtagga gtgcgtgagg gccgctggta ttgggaatgc 780

aaggtgacgc gcggtgtaat aaaccccgaa cgaagcaaac aaaaatccgc agaaaacgat 840

gctgaagggg aggtgaacga ggcaaagtca cacggtcacg tgcgaatggg ttgggcgcgc 900

agggaggcat cgcgggatgc gccggtcggt ctggacgcat acagctatgc gatacgtgac 960

gttggcggtc agaaggtgca catgtcacgg ccaaaggact tcttcccgcc cggagaggac 1020

gtgcgggaag gcgacgtaat aggcctggag atatgccttc catcggagca gctgcatcgc 1080

aaggttgttc agggccacta caaccccgcc gtcgatcttc tagacgagga gacaccggac 1140

ctccacgctg ccgccgaagc gtccaacatt gtgcgggagc gggtggtaat acggggcaag 1200

acgaatcttt tctcggaagt tttcgactac catccgatca aggagttgga agacctcatg 1260

aatccgtcgc caatggctgc agccggcgcc gggcacggcc acttgtcaga aaggccaaac 1320

ccaaaccacc gtgtcccgtg cctacggaca ctgcctaaat catacatcaa aatctacaaa 1380

aacggtgttc tcatgggcac tccattcgag gacctactga gcttcttgcc ccctgcttcg 1440

acaccgaatg caaaactaca agacggcgcc aaggagggtt tcgacgacgg tacagtgggc 1500

tactacccag cagtgagcgt gttccgtgga ggggcggccg aggtaaattt cggccccgat 1560

ttctggtacc cgccgccggg ctatgggagc tcaacatctg cgacggcgac aaacggcgac 1620

gtggagatga cggatgcaga cgctgccgcc gtccccaaca caagtactgg accatcggcc 1680

ccgccaaccg tgaagcctat gttcgagaga tacaacgagc agatagccga ggacatcgtt 1740

tacgacatca tagatgaggt gcatttctgg gtgcaagacg gccgcaaggc ggacgggaat 1800

atcgatgggg ttgatgcagc agatcggatg caagaggact ga 1842

<210>4

<211>718

<212>DNA

<213>Artificial sequence

<400>4

ggatccactt aacgttactg aaatcatcaa acagcttgac gaatctggat ataagatcgt 60

tggtgtcgat gtcagctccg gagttgagac aaatggtgtt caggatctcg ataagatacg 120

ttcatttgtc caagcagcaa agagtgcctt ctagtgattt aatagctcca tgtcaacaag 180

aataaaacgc gttttcgggt ttacctcttc cagatacagc tcatctgcaa tgcattaatg 240

cattgactgc aacctagtaa cgccttcagg ctccggcgaa gagaagaata gcttagcaga 300

gctattttca ttttcgggag acgagatcaa gcagatcaac ggtcgtcaag agacctacga 360

gactgaggaa tccgctcttg gctccacgcg actatatatt tgtctctaat tgtactttga 420

catgctcctc ttctttactc tgatagcttg actatgaaaa ttccgtcacc agccctgggt 480

tcgcaaagat aattgcatgt ttcttccttg aactctcaag cctacaggac acacattcat 540

cgtaggtata aacctcgaaa tcattcctac taagatggta tacaatagta accatggttg 600

cctagtgaat gctccgtaac acccaatacg ccggccgaaa cttttttaca actctcctat 660

gagtcgttta cccagaatgc acaggtacac ttgtttagag gtaatccttc tttctaga 718

<210>5

<211>2059

<212>DNA

<213>Artificial sequence

<400>5

tctagattaa cgcttacaat ttccattcgc cattcaggct gcgcaactgt tgggaagggc 60

gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc 120

gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg 180

agcgcgcgta atacgactca ctatagggcg aattgggtac tcaaattggt tcccgcttga 240

cgacattccg aaacccccaa tttccagccg ccttcgcaag cgctacctga ttggcggcag 300

gaatatgatg ctcgccccag cgccccagca gtgccagtca agcaccaacc tggaaacacc 360

tcgttcccag cctgccagcc agcaacacag ttgacaccac tcgatccgtc accaactcaa 420

ccccatcgaa ccgtaacccc atcactgtcg cgagtcccga ctcttcccaa caacacgcat 480

catcccacac caccactgca cgttccgcac ggcaatctcc aattcattcc atatccaact 540

tattgataca gcttcgcagg aacccaatct tcaaaatgat tgaacaagat ggattgcacg 600

caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa 660

tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg 720

tcaagaccga cctgtccggt gccctgaatg aactgcaaga cgaggcagcg cggctatcgt 780

ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa 840

gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc 900

ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg 960

ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg 1020

aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg 1080

aactgttcgc caggctcaag gcgagcatgc ccgacggcga ggatctcgtc gtgacccatg 1140

gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact 1200

gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg 1260

ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc 1320

ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga atcattccac 1380

tcaacattca ggctcctctg cgcacgtaaa gtgccaaagg caataccctg ctcggtggaa 1440

tgccgccggg cttgtcgatt ttacgcacat atgcgcattc ttgacttgaa gcggaggagt 1500

tcttcgttgc gggttacagt gttttaataa aagaatggtc aaatcaaact gctagatata 1560

cctgtcagac actctagttg ttgaccccta tactcttaat acatcagaca gtacatgcat 1620

gttgcatgat gatgataatg tctgtttaga ttccaagtgt ctactgctgg cctagttttc 1680

ggtactatgc atatgatcca atatcaaagg aaatgatagc attgaaggat gagactaatc 1740

caattgagga gtggcagcat atagaacagc taaagggtag tgctgaagga agcatacgat 1800

accccgcatg gaatgggata atatcacagg aggtactaga ctacctttca tcctacataa 1860

atagacgcat ataagtacgc atttaagcat aaacacgcac tatgccgttc ttctcatgta 1920

tatatatata caggcaacac gcagatatag gtgcgacgtg aacagtgagc tgtatgtgcg 1980

cagctcgcgt tgcattttcg gaagcgctcg ttttcggaaa cgctttgaag ttcctattcc 2040

gaagttccta ttctctaga 2059

Claims (6)

1. The application of the protein consisting of the amino acid residue sequence of SEQ ID No. 1 in a sequence table or the coding gene thereof in reducing the sporulation quantity and the infection capacity of the rice blast bacterial strain P131 is that the coding gene of the protein consisting of the amino acid residue sequence of SEQ ID No. 1 in the sequence table in the rice blast bacterial strain P131 is mutated so as not to be expressed.

2. Use according to claim 1, characterized in that: the genome DNA nucleotide sequence of the coding gene is SEQ ID No: 2.

3. Use according to claim 1, characterized in that: the cDNA nucleotide sequence of the coding gene is SEQ ID No: 3.

4. A method for obtaining rice blast fungus with reduced sporulation amount and/or infection ability is characterized by mutating the coding gene of protein consisting of amino acid residue sequence of SEQ ID No. 1 in a sequence table in the rice blast fungus strain P131 to ensure that the protein cannot be expressed, and screening to obtain the rice blast fungus mutant strain with reduced sporulation amount and infection ability.

5. The method of claim 4, wherein: the method for mutating the coding gene of the protein consisting of the amino acid residue sequence of SEQ ID No. 1 in a sequence table in the rice blast strain P131 so as to ensure that the protein cannot be expressed is to knock out the coding gene of the protein; the method for knocking out is to replace the gene sequence of the genome of the corresponding site in the genome with the hygromycin gene by homologous recombination of flanking sequences on two sides of the gene and the corresponding sequence of the genome of the wild strain.

6. The method of claim 5, wherein: the knockout method is that the knockout carrier is transformed into protoplast of the original rice blast bacterial strain to obtain a transformant which replaces the coding gene of the protein consisting of the amino acid residue sequence of SEQ ID No. 1 in a sequence table and the hygromycin resistance gene in the genome; the knockout vector was constructed as follows: using pKOV21 vector as starting vector, inserting the left arm fragment with the 515 th-through 1606 nucleotide sequence of the sequence 2 in the sequence list between the EcoRI and SpeI enzyme recognition sites of pKOV21 vector to obtain an intermediate vector pKOV 21-left arm, then inserting the right arm fragment with the 3456 th-through 4551 th nucleotide sequence of the sequence 2 in the sequence list between the KpnI and SalI enzyme recognition sites of the left arm of the intermediate vector pKOV 21-left arm to obtain a recombinant vector with the left arm fragment with the 356 th-through 1635 th nucleotide sequence of the sequence 2 in the sequence list, the hygromycin resistance gene fragment and the right arm fragment with the 3456 th-through 4551 th nucleotide sequence of the sequence 2 in the sequence list which are connected in sequence.

Images