CN109293756A - The albumen of one control rice rice blast fungus sporulation quantity and infection ability - Google Patents

Abstract

The invention discloses the albumen and its encoding gene of control Involved in Sporulation in Magnaporthe grisea amount and infection processs.The albumen, be it is following 1) or 2) shown in protein: 1) protein being made of the amino acid residue sequence of the SEQ ID № .1 in sequence table；2) the SEQ ID № .1 amino acid residue sequence in sequence table by the substitution and/or deletion and/or addition of one or several amino acid residues and had into the protein as derived from SEQ ID №: 1 for controlling rice blast fungus sporulation quantity and infection ability GAP-associated protein GAP function.The knockout of the encoding gene of albumen of the invention leads to the reduction of rice blast fungus sporulation quantity and the infection ability decline of infectivity mycelia.The sporulation quantity for knocking out body drops to 34% or so of wild type P131.

Description

The albumen of one control rice rice blast fungus sporulation quantity and infection ability

Technical field

The invention belongs to field of biotechnology, more particularly it relates to a kind of control Involved in Sporulation in Magnaporthe grisea amount with invade The albumen and its encoding gene of dye ability.

Background technique

Rice blast fungus (Magnaporthe oryzae) is the fungi of Ascomycotina, and it is more to infect rice, wheat, barley etc. Kind gramineae plant, leads to seasonal febrile diseases.Under normal circumstances, the harm of rice blast can make rice underproduction 5-10%, or even can lead to water Rice total crop failure.Rice blast is one of Major Diseases of China's rice and global rice disease.

Rice blast fungus source of infection using conidium as the primary source of infection for infecting host plant and again.The conidium of rice blast fungus It resembles a pear in shape, is made of three cells.Under appropriate conditions, the conidia germination for being adsorbed on blade forms appresorium, mature Appresorium generate and infect nail and be directed through plant epidermis cell, infect nail and form infectivity mycelia in plant cell, infect Property mycelia in plant cell and iuntercellular extension and be colonized, diameter 2-3 millimeters of grey or taupe are formed on final blade Scab, the infectivity mycelia in scab penetrate plant tissue to conidiophore is differentiated to form in the air, are further formed mitogenetic spore Son.Conidium discharges and adheres under the action of wind, rain, causes infecting again for plant again.The severity of rice blast with point Sporogenic yield is positively correlated.If the conidial yield of rice blast fungus can be reduced and reduce rice blast fungus infectivity bacterium Silk infects and spreads ability, so that it may control the generation of rice blast etc. or reduce the extent of injury of rice blast.Therefore, it studies Molecular genetic mechanism in the infection ability of conidium yield and rice blast fungus is generated and is invaded to rice blast fungus conidium is disclosed It the molecule mechanism of dye ability and is of great significance to the prevention of rice blast with improvement.

Summary of the invention

The object of the present invention is to provide a kind of albumen and its encoding gene for controlling Involved in Sporulation in Magnaporthe grisea amount and infection ability With application.

The albumen of control Involved in Sporulation in Magnaporthe grisea amount and infection ability provided by the present invention, derives from rice blast fungus (Magnaporthe oryzae), entitled MGG-01427 are following protein 1) or 2):

1) protein that the amino acid sequence shown in sequence 1 in sequence table forms；

2) by the amino acid residue sequence of sequence 1 in sequence table by one or several amino acid residues substitution and/or It is deleted and/or added and there is the identical active protein as derived from 1) with albumen shown in sequence 1.

Sequence 1 in sequence table is made of 613 amino acid residues.

For the ease of sequence 1 encode MGG-01427 purifying, can in as sequence table amino acid sequence shown in sequence 1 The amino terminal or carboxyl terminal of the protein of composition connect upper label as shown in Table 1.

The sequence of 1 label of table

Label	Residue	Sequence
			Poly-Arg	5-6 (usually 5)	RRRRR
Poly-His	2-10 (usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

Above-mentioned MGG-01427 can be artificial synthesized, can also first synthesize its encoding gene, then carries out biological expression and obtain.It is above-mentioned The encoding gene of MGG-01427 can be residual by will lack one or several amino acid in DNA sequence dna shown in sequence 3 in sequence table The codon of base, and/or the missense mutation of one or several base-pairs is carried out, and/or connect table 1 at its 5 ' end and/or 3 ' ends Shown in the coded sequence of label obtain.

The encoding gene of the albumen (MGG-01427) of the control Involved in Sporulation in Magnaporthe grisea amount and infection ability also belongs to this hair Bright protection scope.

The control rice blast fungus sporulation quantity refers to that MGG-01427 missing can be such that the sporulation quantity of rice blast fungus reduces, the control Infection ability processed refers to that MGG-01427 missing can cause rice blast fungus mycelia extension ability to decline, and further, refers to MGG- 01427 missing can cause rice blast fungus infectivity mycelia in barley leaves cell to be infected under extension ability compares compared with wild type Drop.

The genomic DNA nucleosides of the albumen (MGG-01427) of the coding-control Involved in Sporulation in Magnaporthe grisea amount and infection ability Acid sequence is following 1), 2) or 3) shown:

1) in sequence table SEQ ID №: 2 nucleotide sequence；

2) under strict conditions can with 1) described in the nucleotide sequence that hybridizes of DNA sequence dna；

3) with sequence table in SEQ ID №: 2 nucleotide sequence with 90% or more homology and coding albumen tool There is the nucleotide sequence of control rice blast fungus sporulation quantity and infection ability function.

Above-mentioned encoding gene is the 1st exon, 5 ' end 2132- from 5 ' 1490-2014, end nucleotide of sequence 2 3428 nucleotide are exon 2, are introne from 5 ' 2105-2131, end nucleotide of sequence 2.

The cDNA of the albumen (MGG-01427) of the coding-control Involved in Sporulation in Magnaporthe grisea amount and infection ability be following 1) or 2) DNA molecular or 3):

1) DNA molecular shown in sequence 3 in sequence table；

2) hybridize under strict conditions with the DNA sequence dna 1) limited and encode the DNA of the rubber tree disease-resistance-related protein Molecule；

3) with sequence table in sequence 3 nucleotide sequence with 90% or more homology and encode albumen to rubber The nucleotide sequence of the disease-resistant correlation function of gum.

3 overall length of sequence is 1842 nucleotide in sequence table, and encoding a length is 613 amino acid (sequence in sequence table Column 1), as control the albumen (MGG-01427) of Involved in Sporulation in Magnaporthe grisea amount and infection ability.

Above-mentioned stringent condition can be to hybridize at 65 DEG C in 0.1 × SSPE (or 0.1 × SSC), the solution of 0.1%SDS And wash film.

The recombination of the encoding gene of albumen (MGG-01427) containing the control Involved in Sporulation in Magnaporthe grisea amount and infection ability Expression vector, expression cassette, transgenic cell line or recombinant bacterium all belong to the scope of protection of the present invention.

The present invention has cloned the new gene MGG-01427 that spore yield and infection ability are controlled in a rice blast fungus, and Primary Study has been carried out to the molecular function of the gene.An important use of MGG-01427 provided by the present invention is the base The expression of cause and the shearing of transcript and its expression of protein, modification and positioning can be used as important candidate targets site and be used for In the screening and design of antifungal medicine.Further, the fungal spore yield of gene participation and the molecule of infecting potential are parsed Mechanism and signal pathway can also be with these therefrom it has also been discovered that candidate target site is used for the screening and design of antifungal medicine Basis of a certain section of gene nucleotide series as probe or as PCR primer design is for screening, separating other fungies With the gene have certain sequence homology sequence.The knockout of MGG-01427 gene leads to the reduction of rice blast fungus sporulation quantity And the infection ability decline of infectivity mycelia.The sporulation quantity for knocking out body 1427KO2 drops to 34% or so of wild type P131. The present invention will be helpful to the molecular mechanism of parsing rice blast fungus sporulation quantity and infectivity mycelia infection ability, and be possible to therefrom find The gene and its coding albumen that can be used as fungicide target, thus for effective control rice blast based theoretical and technology Basis.

Detailed description of the invention

The clustering of Fig. 1 .MGG-01427 and homologous protein in other plant pathogenic fungis.It illustrates: albumen cluster Analyze the albumen used: MGG-01427 (Magnaporthe oryzae), EJT74718.1 (Gaeumannomyces tritici)、KUI69080.1(Valsa mali)、KXH66273.1(Coletotrichum salicis)、EGY19911.1 (Verticilium dahliae), ENH73886.1 (Fusarium oxysporum) albumen clustering be using What clustalx1.83 software was completed.

Fig. 2 gene M GG-01427 knockout carrier construction strategy schematic diagram.Utilize hygromycin HyB gene substitution MGG- 01427 gene.The position primer P1, P2, P3, P4 is as shown in the figure.

The verifying of Fig. 3 gene M GG-01427 knockout body.Figure is the Southern blot verifying that MGG-01427 knocks out body. The PstI digestion of the genomic DNA of P131,1427KO1,1427KO2 and 1427KO3, digestion position is as shown in Fig. 2, hybridization probe For Probe shown in Fig. 2.

The sporulation quantity of Fig. 4 gene M GG-01427 influence rice blast fungus.The method for producing spore according to bacterium is applied using the culture dish of 6cm Production spore is carried out, after washing bacterium, producing spore 48 hours, is counted.Upper figure is P131 and 1427KO bacterial strain sporulation quantity counting statistics table, the following figure For two kinds of bacterial strain sporulation quantity average value histograms.

Fig. 5 gene M GG-01427 complement bacterial strain sporulation quantity is restored to wild-type levels.Using 6cm culture dish according to It applies the method that bacterium produces spore and carries out production spore, after washing bacterium, producing spore 48 hours, count.Figure be wild-type strain, knock out body bacterial strain with it is complementary Body bacterial strain sporulation quantity column comparison diagram.

Fig. 6 gene M GG-01427 influences rice blast fungus infection ability.Upper figure is wild type P131 spore inoculating barley leaves Mycelia infects state under optical microscopy afterwards；The following figure is to knock out mycelia after body bacterial strain 1427KO2 is inoculated with barley leaves to infect state.

The pathogenicity and wild type P131 that Fig. 7 gene M GG-01427 knocks out body bacterial strain 1427KO2 are without significant difference.Left figure The conidium spray inoculation rice leaf rear blade morbidity photo of wild type P131 bacterial strain；Right figure is to knock out body bacterial strain The conidium spray inoculation rice leaf rear blade morbidity photo of 1427KO2.

The colony growth rate and wild type P131 that Fig. 8 gene M GG-01427 knocks out body bacterial strain 1427KO2 are without obvious area Not.Upper figure is wild-type strain P131 and knocks out body bacterial strain 1427KO2 bacterium colony growth conditions on OMA culture medium；The following figure is two Kind bacterial strain bacterium colony size histogram.

Fig. 9 gene M GG-01427 has expression in entire infection processs.Figure is to infect the photo in each stage in phase It finds a view and takes pictures under the poor visual field (DIC) and the fluorescence visual field (GFP).The gene is in mycelia, conidium, appresorium, infectivity mycelia In have expression.

Specific embodiment

Method in following embodiments is unless otherwise instructed conventional method.

Percentage composition in following embodiments is unless otherwise instructed mass percentage.

The acquisition of the albumen and its encoding gene of embodiment 1, control Involved in Sporulation in Magnaporthe grisea amount and infection ability

The present inventor is had found a control Involved in Sporulation in Magnaporthe grisea amount and is infected by screening radom insertion mutant The albumen of ability derives from rice blast bacteria strain P131, can obtain by the following method:

1, cDNA segment clone (sequence 3 in sequence table)

Specific primer design is as follows:

F (5 ' end): GC CATATG GCGACCAACGGCGAAACGCCCA

R (3 ' end): GC GAATTC ATGTCCTCT TGCATCCGATCTGCT

The the first chain cDNA obtained using rice blast fungus P131 random primed reverse transcription is template, dense eventually using F and R as primer Degree is 10 μm of ol/L, carries out PCR amplification in 25 μ l reaction systems.Amplification program are as follows: 95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 2min, totally 35 recycle；72 DEG C of last extension 10min, 4 DEG C of forever.Obtain one section The nucleotide fragments of 1842bp or so are surveyed for the full length gene segment of control Involved in Sporulation in Magnaporthe grisea amount and the albumen of infection ability Sequence shows that the segment has the nucleotide sequence of sequence 3 in sequence table, protein shown in sequence 1 in polynucleotide.

2, clone's (sequence 2 in sequence table) of the protein gene overall length of Involved in Sporulation in Magnaporthe grisea amount and infection ability is controlled

Genome sequence amplimer:

Forward primer: CAACCTGTGGCTCTGGGAGCA；

Reverse primer: CCATTGGAGTAGTATTATGC.

After extracting genomic DNA in wild-type strain P131, using forward and reverse primer, following amplification program is used It carries out PCR amplification and goes out MGG-01427 genome sequence.

95 DEG C of initial denaturation 5min；95 DEG C of denaturation 30s, 58 DEG C of annealing 30s, 72 DEG C of extension 6min, totally 35 recycle；72 DEG C most After extend 10min, 4 DEG C of forever.The genome sequence for finally amplifying 5609bp shows it in sequence table through sequencing The nucleotide sequence of sequence 2, the protein sequence of sequence 1 in polynucleotide.

3, the poly- of homologous protein in the albumen MGG-01427 and other fungies of Involved in Sporulation in Magnaporthe grisea amount and infection ability is controlled Alanysis

By the amino acid sequence of rice blast mycoprotein MGG-01427 at NCBI (http://www.ncbi.nlm.nih.gov/) Upper comparison, finds out its homologs between different plant species: MGG-01427 (Magnaporthe oryzae), EJT74718.1(Gaeumannomyces tritici)、KUI69080.1(Valsa mali)、KXH66273.1 (Colletotrichum salicis)、EGY19911.1(Verticillium dahliae)、ENH73886.1(Fusarium oxysporum).After above-mentioned amino acid sequence is compared with clustalx1.83 software, albumen MGG- is constructed Chadogram between 01427 and its homologs.It is found by comparing, albumen MGG-01427 and the like has one SPRY_ash2 structural domain, this structural domain participate in adjusting histone H 3 K4 transmethylase, turn with chromatin modification with epigenetic Record activation is related.The important role in terms of fungi epigenetic, influences fungal growth and development.It can therefore be concluded that MGG- 01427 albuminoid is a conservative protein generally existing in fungi, as shown in Fig. 1.

The gene M GG-01427 of embodiment 2, present invention control Involved in Sporulation in Magnaporthe grisea amount and infection ability produces spore in rice blast fungus The proof that amount aspect acts on

The present invention proves MGG-01427 in terms of rice blast fungus sporulation quantity using gene knockout experiment and gene complementation experiment Effect.This partial content includes the building of knockout carrier and complementing vector, rice blast fungus protoplast transformation, corresponding transformant It obtains, the measurement of sporulation quantity.

1. the building of knockout carrier

The building of knockout carrier, which refers to, is connected into the section of DNA sequence for being located at gene coding region two sides in one carrier, and two It is separated between person with hygromycin gene.Occurred by the flanking sequence of gene two sides and the corresponding sequence of wild-type strain genome Homologous recombination, so that corresponding site genomic gene sequence in genome and hygromycin gene be replaced.

When constructing the knockout carrier of gene M GG-01427, PCR primer is designed, expands left arm segment respectively (from sequence table 515-1606 nucleotide sequences of sequence 2) and right arm segment (from sequence table 3456-4551 nucleotide of sequence 2 Sequence), left arm forward primer 5'-CATGGTACCGCCACCTGGCAAAG-3', 5 ' have KpnI restriction enzyme site, reverse primer For 5'-CATGTCGACGCCGGTTGTATGCTC-3', 5 ' ends have restriction enzyme site；Right arm forward primer 5'- CATGAATTCGGAAGATGCGGGAGGTG-3 ' its 5 ' have EcoRI restriction enzyme site, reverse primer 5'- CATACTAGTGGCTGGCTTGGTCTCTG-3', 5 ' have SpeI restriction enzyme site.Left arm KpnI and SalI digestion, right arm Two segments of left arm and right arm are obtained after EcoRI and SpeI digestion.Left arm is first coupled to equally with after KpnI and SalI double digestion The left side of pKOV21 carrier hygromycin gene, then again right arm be connected to previous step acquisition pKOV21- left arm this Intermediate vector just obtains gene knockout carrier with the right side for being connected to hygromycin gene after EcoRI and SpeI digestion PKO-01427 (such as Fig. 2).

Restriction enzyme involved in building process, ligase are produced by NEB (Beijing) Co., Ltd, are said referring to product Bright book uses；Taq enzyme is produced by Takara (Dalian) Co., Ltd, is used referring to product description.

2. rice blast fungus gene M GG-01427 knocks out conversion

In the present invention, the method for the protoplast transformation that the conversion of rice blast fungus uses CaCl2/PEG to mediate, it is primary The preparation of plastid and method for transformation are as follows:

A. the preparation of protoplast

500 milliliters of conical flasks it is bottled enter 200 milliliters of liquid CM culture medium (yeast extract 0.6%, enzyme hydrolysis casein 0.03%, sour hydrolysed casein 0.03%, sucrose 1%), the appropriate thallospore of access wild type P131 mixes body, in 26-28 DEG C, training 30-36 hours is shaken under the conditions of 100rpm, mycelium, mycelium 0.7M sodium chloride is collected by filtration in three layers of sterilizing lens wiping paper It is transferred in 50 milliliters of centrifuge tubes of sterilizing after solution washing, the enzyme penetrating fluid that every 1 gram of mycelia is added 1 milliliter (is collapsed containing 20mg/ml Burst enzyme, prepared with 0.7M sodium chloride), 26-28 DEG C, digest 3-4 hours under the conditions of 100rpm after, with 0.7M NaCl mycelia Body, after being filtered with three layers of sterilizing lens wiping paper, supernatant is abandoned in 4,000rpm centrifugations 15 minutes, and precipitating first uses 25ml STC (1.2M sorb Alcohol, 10mM Tris-pH7.5.50mM calcium chloride) washing plasm is twice.Precipitating is dissolved with STC, and protoplast concentration is adjusted to 0.5-1×10⁸It is spare after a/ml.

B. rice blast fungus converts

Wild type P131 protoplast is sub-packed in 50 milliliters of centrifuge tubes of sterilizing, 300 microlitres of every pipe, it is micro- to be added about 2 Gram linearisation knockout carrier (with restriction enzyme NotI linearize knockout carrier pKO-01427), on ice place 20 points 2 milliliters/pipe PTC solution (60% polyethylene glycol 3350,10mM Tris-pH7,5.50mM calcium chloride) is added dropwise, on ice in clock 20 minutes are stood, the STC of 25 milliliters/pipe pre-cooling is added, after mixing, 4,000rpm, 4 DEG C are centrifuged 15 minutes, abandon supernatant, and every pipe adds Enter 3 milliliters of LR culture medium (0.1% yeast extract, 0.1% enzyme hydrolysis casein, 1M sucrose), 26-28 DEG C of culture 12-18 Hour, it is transferred to culture dish, 15 milliliters of SR (LR+1.6% agar) for being cooled to 50 DEG C or so are added, mix, after its solidification, on Face spreads 15 milliliters of 0.7% agar, and the inside contains the hygromycin (Millipore company of the U.S.) of 400 mcg/mls, 28 DEG C of cultures 4-6 days, the transformant of appearance is gone into solid CM medium, (U.S. Sigma is public for neomycin of the inside containing 400 mcg/mls Department), the transformant of not anti-neomycin is gone on oat tomato agar culture medium.

3. the verifying of gene M GG-01427 knockout body

Select three knockouts transformant 1427KO1,1427KO2 and 1427KO3 at random, in order to verify 1427KO1, Whether 1427KO2 and 1427KO3 is real knockout body, we have done Southern blot experiment, have used restriction enzyme PstI clear up completely wild type P131, knock out body 1427KO1,1427KO2 and 1427KO3 genomic DNA, use right arm as Probe, probe location are as shown in Figure 2.Using with isotope labelling primer Pr1427F:ACCGTTGACAATCTGGAA and Pr1427R:TCTGCGTTAAGAGTGAGC carries out verification test.Wild type P131 and knockout transformant 1427KO1 swimming lane occur The purpose band of 5078bp；It knocks out transformant 1427KO2 and the purpose band of 6239bp occurs；Transformant 1427KO3 is knocked out to occur Two band.Being indicated above and knocking out transformant 1427KO2 is that gene M GG-01427 really knocks out body, as shown in Figure 3.

4. gene M GG-01427 knocks out the measurement of body sporulation quantity

Gene M GG-01427 knocks out the sporulation quantity decline of body 1427KO2, about the 34% of wild mushroom P131.In the present invention The conidial method of all collections being mentioned to is to apply bacterium to produce spore method.

A. rice blast fungus applies bacterium and produces spore method

By required rice blast bacteria strain, in oat tomato culture medium, (every liter of Tomato juice containing 150ml, 50 grams of oatmeals are boiled Boiling filters to take filtrate, 20 grams of agar in 30 minutes) after illumination cultivation 5 days, its mycelia is sufficiently beaten with collarium is applied in 28 DEG C on plate It is disconnected, it is uniformly applied on new Tomato juice's medium oatmeal, 28 DEG C of illumination cultivations.When the visible newborn mycelia of naked eyes grows When media surface, gently mycelia is washed down with cotton swab, and is rinsed with water completely, mono layer gauze is covered, in 28 DEG C of illumination cultivations After 48 hours, in media surface, that is, visible a large amount of rice blast fungus spore.Spore is washed down with sterile purified water, lens wiping paper filtering Conidium spore mycelia mixed liquor collects conidium liquid.

B. the sporulation quantity decline of the knockout body 1427KO2 of gene M GG-01427

Spore method is produced according to bacterium is applied, production spore is carried out to the knockout body 1427KO2 of wild mushroom P131 and gene M GG-01427, is made With the culture dish of 6cm.With distilled water respectively by the mitogenetic spore of the knockout body 1427KO2 of wild mushroom P131 and gene M GG-01427 Son elutes, and constant volume is counted under an optical microscope to 50 milliliters, with blood counting chamber, statistics indicate that gene M GG- The sporulation quantity decline of 01427 knockout body 1427KO2, sporulation quantity is about the 34% of wild mushroom P131, as shown in table 2 and Fig. 4. The spore liquid of every ware bacterium elution counts 3 times, and each bacterial strain is repeated 3 times, and sporulation quantity experiment is independent to be repeated 3 times.

The sporulation quantity of 2. wild type of table and knockout mutations body compares

5. the building of complementing vector

Complementing vector refers to that the DNA segment by the overall length functional sequence comprising MGG-01427 is connected to one with new The carrier of mycin resistant gene.Neomycin resistance gene is not limitation of the present invention herein, other can lead to antibiotic The gene of resistance, i.e., the gene for leading to fungus resistant except neomycin resistance gene can reach same effect.

Design primer first, amplification include the segment of complete MGG-01427, and the forward primer used is 5 '- CTGGATCCGACCTTGACGTTAATAC-3 ', 5 ' have BamHI restriction enzyme site；Reverse primer is 5 '- GCGAATTCACGGCGATAATGATG-3 ', 5 ' have EcoRI restriction enzyme site.Expand from the genomic DNA of wild type P131 Increase out comprising coding MGG-01427 nucleotide sequence segment 3485bp (from sequence table sequence 25 ' end 327-3811 Position nucleotide sequence), wherein including the own promoter of 1163bp, restriction enzyme BamHI and EcoRI digestion mesh will be utilized Segment, connected with restriction enzyme BamHI with the pGTN carrier of EcoRI digestion, finally obtaining includes fusion The plasmid vector pKNTG-01427 of MGG-01427-GFP and selected marker neomycin phosphotransferase gene.This carrier is not only It can be used to the knockout body 1427KO2 of complementary genes MGG-01427, and the subcellular localization that can be used to obtain the gene turns Change body.

Wherein, the construction method of pGTN carrier are as follows: using pBluescript II KS (-) carrier is the carrier that sets out, more GFP sequence (No. GENEBANK: NC_011521.1) is inserted between cloning site XbaI and NotI；Between NotI and SacII restriction enzyme site It is inserted into TrpC promoter (sequence 4)；It is inserted into Neo (neomycin resistance gene, sequence 5) between SacII and SacI restriction enzyme site, thus PGTN carrier is constructed.

6. the acquisition of complement and the measurement of complement sporulation quantity

The production spore that the sporulation quantity of gene M GG-01427 complement is restored to wild type P131 is horizontal.

After the complementing vector pKNTG-01427 of building is linearized with restriction enzyme Not I, it is added to knockout body In the protoplast of 1427KO2, CaCl is carried out according to the protoplast transformation method for knocking out experiment₂The conversion that/PEG is mediated is real It tests, upper layer Antibiotic medium uses the neomycin of 400 mcg/mls.

Next according to the method for measuring of body sporulation quantity is knocked out, complement sporulation quantity is measured.Statistics indicate that gene M GG- The production spore that the sporulation quantity of 01427 complement is restored to wild type P131 is horizontal, as shown in Figure 5.

The knockout body 1427KO2 influence rice blast fungus infection ability of embodiment 3, gene M GG-01427

1. the in vitro barley leaves of inoculated by hypha block

It cuts wild type P131 respectively with knife blade and knocks out the newborn mycelia block of body 1427KO2, mycelia block size is about For 2mm × 2mm, mycelia is face-down, is inoculated with the barley leaves of scuffing respectively, after dark moisturizing 24 hours, light and shade alternate culture 5 days After observe.

2. the knockout body 1427KO2 rice blast fungus infection ability of gene M GG-01427 declines

Wild type P131 is taken respectively and knocks out the barley leaves after body 1427KO2 infects, and observes mycelia with optical microscopy Infect state.It was found that knocking out body 1427KO2 infectivity mycelia in barley leaves cell infects extension ability compared with wild type P131 Compared to being declined, as shown in Figure 6.

Embodiment 4, the pathogenicity for knocking out body 1427KO2 of gene M GG-01427 are without significant change

By wild type P131 and body 1427KO2 is knocked out according to bacterium production spore method production spore is applied, with 0.25% geltin solution point Conidium is not washed down, filters conidium spore mycelia mixed liquor with lens wiping paper, collects conidium liquid.Use blood count Conidial concentration is transferred to 5 × 104 spore/milliliters, Lijiang xintuanheigu rice of the spray inoculation to growth 28 days by plate On blade.After 24 hours, light and shade replaces moisturizing culture 5 days 28 DEG C of dark moisturizing cultures, wild type P131 and knockout body 1427KO2 Largely there is typical rice blast fungus scab, as shown in Figure 7.Show gene M GG-01427 to rice blast fungus pathogenicity without obvious shadow It rings.

Embodiment 5, gene M GG-01427 knockout body 1427KO2 colony growth rate without significant change

It cuts wild type P131 respectively with knife blade and knocks out the newborn mycelia block of body 1427KO2, mycelia block size is about For 3mm × 3mm.Mycelia ferfas is face-down, it is transferred to the OMA culture medium center prepared with a batch.The open country that will have been transferred Raw type P131 and knockout body 1427KO2 observe and measure bacterium colony size after (28 DEG C of illumination) is cultivated 5 days under the same conditions.As a result table Bright, wild type P131 and the bacterium colony size for knocking out body 1427KO2 are almost the same, and the speed of growth is without significant change, such as 8 institute of attached drawing Show.

Embodiment 6, the analysis of gene M GG-01427 expression trend

The mycelia block that 1427HB1 bacterial strain contains newborn mycelia top is placed on glass slide, mycelia is face-down, moisturizing culture After 48 hours, the expression of GFP in the observation of Nikon Eclipse 800 and shooting mycelia.With aseptic distillation water elution 1427HB1's Conidium, after lens wiping paper filtering, point is connected on glass slide, prepares simple slide, the observation of Nikon Eclipse 800 and shooting The expression of GFP in conidium.Conidial suspension point is connected on coverslip, dark moisturizing culture is shown after 24 hours The expression of GFP in micro- microscopic observation and shooting appresorium.60 days or so rice plants are selected, successively along its natural texture Leaf sheath is pushed aside, is inoculated with that (the innermost leaf heart is first, is from inside outwards followed successively by second leaf using second leaf sheath Sheath, third leaf sheath).Concentration is transferred to 106 spore/milliliters, so by the conidium of the bacterial strain needed for aseptic distillation water elution Spore liquid is filled into second leaf sheath with pipettor afterwards.With wet blotting paper by the root moisturizing of rice plant, 25 DEG C of dark After culture 48 hours, the expression of GFP in the observation of Nikon Eclipse 800 and shooting infectivity mycelia.MGG-01427-GFP melts The transformant 1427HB1 for closing carrier is not apparent with wild mushroom P131 in conidium form and infectivity mycelia isophenous Difference illustrates that MGG-01427-GFP can travel the function of gene M GG-01427.In the conidium of 1427HB1, appresorium and The expression that can observe GFP in mycelia is infected, illustrates that gene M GG-01427 has expression, such as Fig. 9 in entire infection processs It is shown.

<110>Beijing Agricultural College

The albumen of<120>controls a rice rice blast fungus sporulation quantities and infection ability

<130> WHOI180066

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 613

<212> PRT

<213>rice blast fungus (Magnaporthe oryzae)

<400> 1

Met Ala Thr Asn Gly Glu Thr Pro Lys Arg Glu Leu Thr Pro Ala Ala

1 5 10 15

Ala Thr Ser Thr Ala Pro Ala Ala Thr Arg Ser Thr Ser Pro Arg Ala

20 25 30

Gly Thr Pro Pro Ala Ser Ser Leu Pro Gln Lys Arg Val Leu Met Glu

35 40 45

Asp Asp His Ala Pro Ala Val Arg Ser Pro Leu Asn Pro Asp Ala Arg

50 55 60

Ser Ala Pro Ala Arg Ala Gln Ser Gln Ala Arg Asp Glu Gln Gln Pro

65 70 75 80

Ser Gly Val Ala Ala Arg Glu Lys Arg Thr Lys Lys Glu Ser Leu Lys

85 90 95

Lys Arg Glu Ser Lys Gly Val Val Gly Gly Ala Gly Gly Ser Ala Thr

100 105 110

Val Glu Ser Ser Arg Ala Thr Pro Asp Pro Arg Gln Lys Asp Gln Ser

115 120 125

Pro Ile Asp Pro Asn Lys Ala Ala Pro Ala Arg Tyr Pro Gln Leu Leu

130 135 140

Pro Ala Met Arg Ser Ser Asp Phe Glu Ala Pro Arg Ala Pro Thr Phe

145 150 155 160

Thr Ser His His Glu Val Thr Gly Pro Asp Gly Glu Thr Ile Glu Phe

165 170 175

Gly Glu Thr Thr Glu Gln Ser Val Asn Arg Lys Gly Tyr Val Tyr Asn

180 185 190

Tyr Cys Ile Ala Asp Pro Ala Phe Pro Ser Met Val Tyr Tyr Arg His

195 200 205

Thr Asp Gln Leu Pro Tyr Thr Ala His Leu Ser Val Glu Asp Ala Ala

210 215 220

Gln Gln Met Tyr Phe Asp Arg Ser Ala Met His Val Thr Gly Glu Leu

225 230 235 240

Gly Phe Arg Met Ala Arg Ala Asn Val Gly Val Arg Glu Gly Arg Trp

245 250 255

Tyr Trp Glu Cys Lys Val Thr Arg Gly Val Ile Asn Pro Glu Arg Ser

260 265 270

Lys Gln Lys Ser Ala Glu Asn Asp Ala Glu Gly Glu Val Asn Glu Ala

275 280 285

Lys Ser His Gly His Val Arg Met Gly Trp Ala Arg Arg Glu Ala Ser

290 295 300

Arg Asp Ala Pro Val Gly Leu Asp Ala Tyr Ser Tyr Ala Ile Arg Asp

305 310 315 320

Val Gly Gly Gln Lys Val His Met Ser Arg Pro Lys Asp Phe Phe Pro

325 330 335

Pro Gly Glu Asp Val Arg Glu Gly Asp Val Ile Gly Leu Glu Ile Cys

340 345 350

Leu Pro Ser Glu Gln Leu His Arg Lys Val Val Gln Gly His Tyr Asn

355 360 365

Pro Ala Val Asp Leu Leu Asp Glu Glu Thr Pro Asp Leu His Ala Ala

370 375 380

Ala Glu Ala Ser Asn Ile Val Arg Glu Arg Val Val Ile Arg Gly Lys

385 390 395 400

Thr Asn Leu Phe Ser Glu Val Phe Asp Tyr His Pro Ile Lys Glu Leu

405 410 415

Glu Asp Leu Met Asn Pro Ser Pro Met Ala Ala Ala Gly Ala Gly His

420 425 430

Gly His Leu Ser Glu Arg Pro Asn Pro Asn His Arg Val Pro Cys Leu

435 440 445

Arg Thr Leu Pro Lys Ser Tyr Ile Lys Ile Tyr Lys Asn Gly Val Leu

450 455 460

Met Gly Thr Pro Phe Glu Asp Leu Leu Ser Phe Leu Pro Pro Ala Ser

465 470 475 480

Thr Pro Asn Ala Lys Leu Gln Asp Gly Ala Lys Glu Gly Phe Asp Asp

485 490 495

Gly Thr Val Gly Tyr Tyr Pro Ala Val Ser Val Phe Arg Gly Gly Ala

500 505 510

Ala Glu Val Asn Phe Gly Pro Asp Phe Trp Tyr Pro Pro Pro Gly Tyr

515 520 525

Gly Ser Ser Thr Ser Ala Thr Ala Thr Asn Gly Asp Val Glu Met Thr

530 535 540

Asp Ala Asp Ala Ala Ala Val Pro Asn Thr Ser Thr Gly Pro Ser Ala

545 550 555 560

Pro Pro Thr Val Lys Pro Met Phe Glu Arg Tyr Asn Glu Gln Ile Ala

565 570 575

Glu Asp Ile Val Tyr Asp Ile Ile Asp Glu Val His Phe Trp Val Gln

580 585 590

Asp Gly Arg Lys Ala Asp Gly Asn Ile Asp Gly Val Asp Ala Ala Asp

595 600 605

Arg Met Gln Glu Asp

610

<210> 2

<211> 5609

<212> DNA

<213>rice blast fungus (Magnaporthe oryzae)

<400> 2

caacctgtgg ctctgggagc accaaggccc gacgcttgct actctgctca gcctcgcgca 60

tcttttgcat acggccagct ttgagcgctt cttgtagaga tgcagactgt gacccttcct 120

tgtcgttctt cctcctcttc cgatccgcgt cctcgtcctg gtcgcccttg cgtttggtgg 180

caagttggac ctttttggga tcgaaagcgg cgcgttcgcg ctcgttccgg gcaagctctt 240

ctgatgtgtc gtagaaacca ggtgcgggct tctgttcgaa aggaatgtcg gcgttgtagt 300

ccatctggcc cggtttcctg gttgtgacct tgacgttaat accagccgtc ttgagctcac 360

gcctcttctg cagcgcagcc agccggcgtg actcttcctg ttggcgttcc cgagccttcc 420

tcttggcttt ctttccttga gtgtttgcca aacgggcgcg cgcttcgctc agcatttctt 480

tctcgtcctc gtcgaggtcg actgtgtcgg ccttggctgg cttggtctct gggtccgggt 540

cgatctctcc agggcgcaga cgacggacag aatcggcagt cggtgcgcta gcctcaccag 600

tcccggtgag gcccagtgct gccgcggcct ccttctgctc ggcctcgtcg agaagcttct 660

ggtagcgctc aaggcactgg ttcgccgtgc ggcccacgat gggggcgatc gtgcgccatt 720

gggtcggcat caatttagcc aggtgcagca gtttttcgtc ctcatccttg ctccactcga 780

tcttgcggat gctcgggtcc agccactcgt tccatcgcgc cttgcactgc tttggcgtct 840

tgcgcgccag cagtgacgag acgcgtgccc attgattcaa accatatttg gagacggatg 900

ccttgagtat ctcgtcctcg atgttggtcc aaacccctcc tttgacgaca ggcatgatgg 960

cggctggctc ggcgggcacc gaggtgggtg gtttgtgatg gcgttgctgt cgggagtaga 1020

aacgcgattg caaaccagat gaaattcacg ccctaaaaga tgtatgtttg caagggttcc 1080

aattatcgaa gtttacgagt tggagatgag cggcgactgg taaaaagatc caataaaatg 1140

tggccatgcc attggtgtac ggacctgtaa agtggggaca aacgtcaccc ctgctgcagg 1200

gaagttgaag gcaccaaagg gactgcgggc tttctggttg ctcaattgag ctccaagcta 1260

caggaaagta atcgcattgt acctgcagct acgaaacttg cttcaaattc agaccgattt 1320

acctgcgtag actaagagct gggtatcaga acgaccaagt ctattcgtct gtggaaactt 1380

gtcctttgca tcaagtttag tcttttccgt ttcttgtcag cgggctttat tgccctcaac 1440

ttaacatttt ctacagcata caaatgatca ggtagcgctc accaacagca tggcgaccaa 1500

cggcgaaacg cccaaaaggg aattgactcc agcagcagcg acaagcacag cgccagcagc 1560

caccagatcg acctcgccca gagccggcac acctcccgca tcttcccttc cccagaagcg 1620

cgtcctgatg gaggacgacc acgcgcccgc cgtccggtcc ccgctcaacc cagacgcgag 1680

gtccgccccg gccagggcgc agtctcaagc ccgcgatgag cagcaaccat ccggcgttgc 1740

tgcgcgcgag aagcgcacca agaaggagtc tttgaagaaa cgcgagagca agggtgttgt 1800

tgggggtgcg ggtggttccg cgacggtcga gagctcgagg gctacgcctg atcctaggca 1860

aaaggatcag agccccattg acccaaacaa agccgctcca gcgcgatatc cccagctgct 1920

ccccgccatg aggagtagcg actttgaggc tcctcgcgcg ccaactttta caagtcacca 1980

tgaggttaca gggcctgacg gcgagactat cgagtttggt gagacgacag agcagtgagt 2040

ttatgtccta ccacccgtcc agggtttgtc aaacaagcca aatgcaaata ttaagagcat 2100

acagctgact gttatctcgt tgccaatgta gatcagtgaa cagaaaaggt tatgtctaca 2160

actactgcat agctgatcca gcgtttccct ccatggtcta ctaccgtcat accgaccagc 2220

tcccatacac cgcccatctc agcgtagaag acgcggcaca acaaatgtac ttcgaccgat 2280

ccgccatgca cgttactggt gagctgggct tccgcatggc gcgagcgaat gtaggagtgc 2340

gtgagggccg ctggtattgg gaatgcaagg tgacgcgcgg tgtaataaac cccgaacgaa 2400

gcaaacaaaa atccgcagaa aacgatgctg aaggggaggt gaacgaggca aagtcacacg 2460

gtcacgtgcg aatgggttgg gcgcgcaggg aggcatcgcg ggatgcgccg gtcggtctgg 2520

acgcatacag ctatgcgata cgtgacgttg gcggtcagaa ggtgcacatg tcacggccaa 2580

aggacttctt cccgcccgga gaggacgtgc gggaaggcga cgtaataggc ctggagatat 2640

gccttccatc ggagcagctg catcgcaagg ttgttcaggg ccactacaac cccgccgtcg 2700

atcttctaga cgaggagaca ccggacctcc acgctgccgc cgaagcgtcc aacattgtgc 2760

gggagcgggt ggtaatacgg ggcaagacga atcttttctc ggaagttttc gactaccatc 2820

cgatcaagga gttggaagac ctcatgaatc cgtcgccaat ggctgcagcc ggcgccgggc 2880

acggccactt gtcagaaagg ccaaacccaa accaccgtgt cccgtgccta cggacactgc 2940

ctaaatcata catcaaaatc tacaaaaacg gtgttctcat gggcactcca ttcgaggacc 3000

tactgagctt cttgccccct gcttcgacac cgaatgcaaa actacaagac ggcgccaagg 3060

agggtttcga cgacggtaca gtgggctact acccagcagt gagcgtgttc cgtggagggg 3120

cggccgaggt aaatttcggc cccgatttct ggtacccgcc gccgggctat gggagctcaa 3180

catctgcgac ggcgacaaac ggcgacgtgg agatgacgga tgcagacgct gccgccgtcc 3240

ccaacacaag tactggacca tcggccccgc caaccgtgaa gcctatgttc gagagataca 3300

acgagcagat agccgaggac atcgtttacg acatcataga tgaggtgcat ttctgggtgc 3360

aagacggccg caaggcggac gggaatatcg atggggttga tgcagcagat cggatgcaag 3420

aggactgagc aacttggatt ctgaatatca ggaaggccgg ttgtatgctc tagactctag 3480

ccccaagtcc tacatatcga tagagagttg gctaggtcat gggccagtgt ctacgcatac 3540

acggtcgccc agcctcttct ttgagcattt tggctcgggt tttcggatct atgagggtaa 3600

tttggcgtaa aagggatacc ccgcggctca gcagctgcgc tttacgagac atgaaatgac 3660

cgttgacaat ctggaagacg tactcgagct ccaaacttat cacctgccgt aggaatcctc 3720

acagtgaaca aaagcaattg ctgcttgatg cataaactaa actaaagtac gattggggtc 3780

ataaacgggt attaaacatc attatcgccg taatatccat gttgccatct gacgcattaa 3840

ttttcgcagt cgggtccgac cagaagagtg tctacatttg tcaagtcctg ctcaagaatt 3900

gactcgcgtc aacgagtatg tcatctgaac tgcatatttc atctgacctc tcacttgcta 3960

ccgctaccct ggcctacagg tggtggcggc agcttggacg atgaggcgga tcccgaagct 4020

tcacctgccg gtggagcggg gagtagaggg tcatcaggca gctcctcgat ccggtcacct 4080

gcctcggtcg tccgttctcc ttcgaggcga acctcacggc cacgtttgtg gcagtaccaa 4140

agtacgaaaa gcagcactaa ggaattattt tgcggttagc cagatagctc actcttaacg 4200

cagaacatga aagatcctgc gtgcaagact tacaaaatat ggctatactc caaatcacgt 4260

tggtgccaat aaaggcgggc caacgcagct tgagcgcatt cacaatggct ttgagcatgc 4320

tcaagatagc gcccggctta gttatgagct cctgaaggtt gcctggcttg atcagtttta 4380

tggccgtctc cttgatcccg cccttggagt tgtccgtgtg ctccatgccc tgcgacttgg 4440

ccgccgcggc gaggagctcc ggcgccaggc tgccggaaat cttatcgggc atctgctgca 4500

ccagcttctt gaggctggcc ggcagcttct cgtagttctt tgccaggtgg ccgtccgggt 4560

cctcgagaag cgtcttgagg tcgttggcgg ccgtcggcac accattcacc aggtccttca 4620

gcacctgcgt gaagtcattg acgagctcgg tcgactcctt ggacagcgag aagacgcggt 4680

tgttttgtgc ggagaggttc aggtcgtcga ggacgcgggt caggtcgtcc ttttcccgct 4740

cggcgtcttc ttccgagacg ggggccttgg ggttcggctt gacgtcgggc tgcttcttgc 4800

ccgggcgacg aactagcacc gagatgcggc ggccgatgcg attcgcaaac ttgccatcgc 4860

cgtcctttgg tttgtccgcg acagcagacg ccgcagcttc ctctcccgcc ttttctttac 4920

ccttgccctt gttcgcaacc atgaaggatt cggcatcgct gtcccaacca atctcaggcg 4980

tctttatgcg tggaggcaag ggcggcctgg ggccctcgtc gtcgtcgcca ttctgcgcat 5040

ccctaagggt gatgagcgat gagtcctggg ttgtcaggag cctaaagaac ctctcgtcct 5100

cgtcctggag gagcggcgac ctgggctctg ttgttgtcgt cgccgacgcg ctgggctcga 5160

cgatttgtgg gatgttgctg gtgctggctg gagtgcctgt ggcctcttga ctcaggcgtt 5220

tctgctctgc ctcctgcttt tgtgcttgat gcttcttgaa ctttctgtaa gtgaaatatt 5280

caagcatcgt tgtggtcttt agcggcccta ctggctgcca agttgtgtcg gtttgagatt 5340

atttgctgtt tagtttgatc tgcacgcagc acaatcagag agtgcgtccc gctcgtgtcg 5400

gttgatttgt gagaaacctc tccttgcggg ggagggagct agctcagtag aatagtggct 5460

tgtctcggtt tttaagatgc ggtctagacc agtagaccaa atgcgaccgt gaggaggcag 5520

ctcaatagtc gattgatttt tcgcgaacta ctcctttaga gccctccgtt agtgcacaga 5580

ggaggccttg cataatacta ctccaatgg 5609

<210> 3

<211> 1842

<212> DNA

<213>rice blast fungus (Magnaporthe oryzae)

<400> 3

atggcgacca acggcgaaac gcccaaaagg gaattgactc cagcagcagc gacaagcaca 60

gcgccagcag ccaccagatc gacctcgccc agagccggca cacctcccgc atcttccctt 120

ccccagaagc gcgtcctgat ggaggacgac cacgcgcccg ccgtccggtc cccgctcaac 180

ccagacgcga ggtccgcccc ggccagggcg cagtctcaag cccgcgatga gcagcaacca 240

tccggcgttg ctgcgcgcga gaagcgcacc aagaaggagt ctttgaagaa acgcgagagc 300

aagggtgttg ttgggggtgc gggtggttcc gcgacggtcg agagctcgag ggctacgcct 360

gatcctaggc aaaaggatca gagccccatt gacccaaaca aagccgctcc agcgcgatat 420

ccccagctgc tccccgccat gaggagtagc gactttgagg ctcctcgcgc gccaactttt 480

acaagtcacc atgaggttac agggcctgac ggcgagacta tcgagtttgg tgagacgaca 540

gagcaatcag tgaacagaaa aggttatgtc tacaactact gcatagctga tccagcgttt 600

ccctccatgg tctactaccg tcataccgac cagctcccat acaccgccca tctcagcgta 660

gaagacgcgg cacaacaaat gtacttcgac cgatccgcca tgcacgttac tggtgagctg 720

ggcttccgca tggcgcgagc gaatgtagga gtgcgtgagg gccgctggta ttgggaatgc 780

aaggtgacgc gcggtgtaat aaaccccgaa cgaagcaaac aaaaatccgc agaaaacgat 840

gctgaagggg aggtgaacga ggcaaagtca cacggtcacg tgcgaatggg ttgggcgcgc 900

agggaggcat cgcgggatgc gccggtcggt ctggacgcat acagctatgc gatacgtgac 960

gttggcggtc agaaggtgca catgtcacgg ccaaaggact tcttcccgcc cggagaggac 1020

gtgcgggaag gcgacgtaat aggcctggag atatgccttc catcggagca gctgcatcgc 1080

aaggttgttc agggccacta caaccccgcc gtcgatcttc tagacgagga gacaccggac 1140

ctccacgctg ccgccgaagc gtccaacatt gtgcgggagc gggtggtaat acggggcaag 1200

acgaatcttt tctcggaagt tttcgactac catccgatca aggagttgga agacctcatg 1260

aatccgtcgc caatggctgc agccggcgcc gggcacggcc acttgtcaga aaggccaaac 1320

ccaaaccacc gtgtcccgtg cctacggaca ctgcctaaat catacatcaa aatctacaaa 1380

aacggtgttc tcatgggcac tccattcgag gacctactga gcttcttgcc ccctgcttcg 1440

acaccgaatg caaaactaca agacggcgcc aaggagggtt tcgacgacgg tacagtgggc 1500

tactacccag cagtgagcgt gttccgtgga ggggcggccg aggtaaattt cggccccgat 1560

ttctggtacc cgccgccggg ctatgggagc tcaacatctg cgacggcgac aaacggcgac 1620

gtggagatga cggatgcaga cgctgccgcc gtccccaaca caagtactgg accatcggcc 1680

ccgccaaccg tgaagcctat gttcgagaga tacaacgagc agatagccga ggacatcgtt 1740

tacgacatca tagatgaggt gcatttctgg gtgcaagacg gccgcaaggc ggacgggaat 1800

atcgatgggg ttgatgcagc agatcggatg caagaggact ga 1842

<210> 4

<211> 718

<212> DNA

<213> Artificial sequence

<400> 4

ggatccactt aacgttactg aaatcatcaa acagcttgac gaatctggat ataagatcgt 60

tggtgtcgat gtcagctccg gagttgagac aaatggtgtt caggatctcg ataagatacg 120

ttcatttgtc caagcagcaa agagtgcctt ctagtgattt aatagctcca tgtcaacaag 180

aataaaacgc gttttcgggt ttacctcttc cagatacagc tcatctgcaa tgcattaatg 240

cattgactgc aacctagtaa cgccttcagg ctccggcgaa gagaagaata gcttagcaga 300

gctattttca ttttcgggag acgagatcaa gcagatcaac ggtcgtcaag agacctacga 360

gactgaggaa tccgctcttg gctccacgcg actatatatt tgtctctaat tgtactttga 420

catgctcctc ttctttactc tgatagcttg actatgaaaa ttccgtcacc agccctgggt 480

tcgcaaagat aattgcatgt ttcttccttg aactctcaag cctacaggac acacattcat 540

cgtaggtata aacctcgaaa tcattcctac taagatggta tacaatagta accatggttg 600

cctagtgaat gctccgtaac acccaatacg ccggccgaaa cttttttaca actctcctat 660

gagtcgttta cccagaatgc acaggtacac ttgtttagag gtaatccttc tttctaga 718

<210> 5

<211> 2059

<212> DNA

<213> Artificial sequence

<400> 5

tctagattaa cgcttacaat ttccattcgc cattcaggct gcgcaactgt tgggaagggc 60

gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa agggggatgt gctgcaaggc 120

gattaagttg ggtaacgcca gggttttccc agtcacgacg ttgtaaaacg acggccagtg 180

agcgcgcgta atacgactca ctatagggcg aattgggtac tcaaattggt tcccgcttga 240

cgacattccg aaacccccaa tttccagccg ccttcgcaag cgctacctga ttggcggcag 300

gaatatgatg ctcgccccag cgccccagca gtgccagtca agcaccaacc tggaaacacc 360

tcgttcccag cctgccagcc agcaacacag ttgacaccac tcgatccgtc accaactcaa 420

ccccatcgaa ccgtaacccc atcactgtcg cgagtcccga ctcttcccaa caacacgcat 480

catcccacac caccactgca cgttccgcac ggcaatctcc aattcattcc atatccaact 540

tattgataca gcttcgcagg aacccaatct tcaaaatgat tgaacaagat ggattgcacg 600

caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa 660

tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg 720

tcaagaccga cctgtccggt gccctgaatg aactgcaaga cgaggcagcg cggctatcgt 780

ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa 840

gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc 900

ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg 960

ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg 1020

aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg 1080

aactgttcgc caggctcaag gcgagcatgc ccgacggcga ggatctcgtc gtgacccatg 1140

gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact 1200

gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg 1260

ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc 1320

ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga atcattccac 1380

tcaacattca ggctcctctg cgcacgtaaa gtgccaaagg caataccctg ctcggtggaa 1440

tgccgccggg cttgtcgatt ttacgcacat atgcgcattc ttgacttgaa gcggaggagt 1500

tcttcgttgc gggttacagt gttttaataa aagaatggtc aaatcaaact gctagatata 1560

cctgtcagac actctagttg ttgaccccta tactcttaat acatcagaca gtacatgcat 1620

gttgcatgat gatgataatg tctgtttaga ttccaagtgt ctactgctgg cctagttttc 1680

ggtactatgc atatgatcca atatcaaagg aaatgatagc attgaaggat gagactaatc 1740

caattgagga gtggcagcat atagaacagc taaagggtag tgctgaagga agcatacgat 1800

accccgcatg gaatgggata atatcacagg aggtactaga ctacctttca tcctacataa 1860

atagacgcat ataagtacgc atttaagcat aaacacgcac tatgccgttc ttctcatgta 1920

tatatatata caggcaacac gcagatatag gtgcgacgtg aacagtgagc tgtatgtgcg 1980

cagctcgcgt tgcattttcg gaagcgctcg ttttcggaaa cgctttgaag ttcctattcc 2040

gaagttccta ttctctaga 2059

Claims (10)

1. a kind of protein, be it is following 1) or 2) shown in protein:

1) protein being made of the amino acid residue sequence of the SEQ ID № .1 in sequence table；

2) by the SEQ ID № .1 amino acid residue sequence in sequence table by one or several amino acid residues substitution and/ Or deletion and/or addition and there is control rice blast fungus sporulation quantity and infection ability GAP-associated protein GAP function to be spread out by SEQ ID №: 1 Raw protein.

2. protein according to claim 1, it is characterised in that: the protein is control rice blast fungus sporulation quantity and infects Ability GAP-associated protein GAP.

3. the encoding gene of albumen of any of claims 1 or 2.

4. encoding gene according to claim 3, it is characterised in that: the genomic DNA nucleotide sequence of the encoding gene It arranges following 1), 2) or 3) shown:

1) in sequence table SEQ ID №: 2 nucleotide sequence；

2) under strict conditions can with 1) described in the nucleotide sequence that hybridizes of DNA sequence dna；

3) with sequence table in SEQ ID №: 2 nucleotide sequence with 90% or more homology and coding albumen have control The nucleotide sequence of rice blast fungus sporulation quantity and infection ability function processed.

5. encoding gene according to claim 3, it is characterised in that: the cDNA nucleotide sequence of the encoding gene is as follows 1) shown in, 2), 3) or 4):

1) in sequence table SEQ ID №: 3 nucleotide sequence；

2) under strict conditions can with 1) described in the nucleotide sequence that hybridizes of DNA sequence dna；

3) with sequence table in SEQ ID №: 3 nucleotide sequence with 90% or more homology and coding albumen have control The nucleotide sequence of rice blast fungus sporulation quantity and infection ability function processed.

6. recombinant expression carrier, transgenic cell line containing encoding gene described in any one of claim 3-5 turn Gene recombination bacterium.

7. the application of albumen described in claim 1 and its encoding gene in control rice blast fungus sporulation quantity and infection ability.

It is the power that will be set out in rice blast bacteria strain 8. a kind of preparation method for the rice blast fungus that sporulation quantity and/or infection ability reduce Benefit require 1 described in the encoding gene mutation of albumen prevent it from expressing, screen, obtain the rice that sporulation quantity and infection ability reduce Pest bacterium mutant strain.

9. according to the method described in claim 8, it is characterized by: claim 1 institute by the rice blast bacteria strain that sets out The encoding gene mutation for the albumen stated prevents it from the method expressed to be to strike the encoding gene of albumen described in claim 1 It removes；The method of the knockout is homologous by the flanking sequence of gene two sides and the corresponding sequence generation of wild-type strain genome Recombination, so that corresponding site genomic gene sequence in genome and hygromycin gene be replaced.

10. according to the method described in claim 8, it is characterized by: it is described set out rice blast bacteria strain be rice blast bacteria strain P131, The method of the knockout be knockout carrier is converted described in set out the protoplast of rice blast bacteria strain, obtain right in genome It is required that the transformant of the encoding gene of albumen described in 1 and hygromycin gene displacement；The knockout carrier is according to following sides Method building: to be the carrier that sets out to pKOV21 carrier, will there are 515-1606 nucleotide sequences of the sequence 2 from sequence table Left arm segment be inserted between EcoRI the and SpeI enzyme recognition site of pKOV21 carrier, it is left to obtain intermediate vector pKOV21- Then will there is arm the right arm segment of 3456-4551 nucleotide sequences of sequence 2 from sequence table to be inserted into intermediate vector Between KpnI the and SalI enzyme recognition site of pKOV21- left arm, obtain that there is the sequence 2 from sequence table with sequentially connected Left arm segment, the hygromycin gene segment, with the sequence 2 from sequence table of 356-1635 nucleotide sequences The recombinant vector of the right arm segment of 3456-4551 nucleotide sequences.