CN103275994B - Fungus pathogenic gene Mosyn8 deriving from magaporthe grisea and application - Google Patents

Abstract

The invention belongs to the fields of phytopathology and microorganism genetic engineering, and provides a nucleotide sequence of a coding area of a new gene Mosyn8 which derives from magaporthe grisea and plays an important role in colonial morphology, spore generation, appressorium turgor pressure and pathogenicity, as well as an amino acid sequence of coded protein. Specifically, the invention discloses the fungus pathogenic gene Mosyn8 deriving from magaporthe grisea, and the nucleotide sequence of the gene Mosyn8 or a nucleotide sequence of a complementary chain of the gene Mosyn8 is SEQ ID NO: 1. The coded protein of the gene Mosyn8 is an amino acid sequence represented by SEQ ID NO: 1; the expression of the gene Mosyn8 serves as a target for designing and screening antifungal drugs; and the expression and the modification of the protein serve as targets for designing and screening the antifungal drugs.

Description

Come from epiphyte pathogenic gene Mosyn8 and the purposes of Pyricularia oryzae

Technical field

The invention belongs to plant pathology and microbiological genetic engineering field, provide one derive from Pyricularia oryzae, produce at colonial morphology, spore, appressorium turgescence and pathogenic in the nucleotide sequence of coding region of new gene Mosyn8 that plays an important role and the aminoacid sequence of coded protein thereof.

Background technology

Rice blast has another name called rice blast, is that global important rice is sick.Same banded sclerotial blight, bacterial leaf-blight are listed in the large disease of paddy rice three.This disease is the prevailing disease propagated by air-flow, threatens greatly Rice Production, and hazard rating has difference, general underproduction 10%-20%, local field total crop failure because of kind, cultivation technique and weather condition difference.This sick typical case is the 7-10 month in 2011, Chinese Longchuan, Zhaoqing, suffers in various degree to Yangjiang infringement, the kind also big area morbidity of Yichuan, Zhejiang etc. " high-yield disease resisting ".Rice blast is caused by Pyricularia oryzae (Magnaporthe oryzae), and along with people are to the understanding of Pyricularia oryzae with deepen continuously, the particularly fast development of Protocols in Molecular Biology means, facilitates the research about rice blast pathogenic mechanism.The genetic map of Pyricularia oryzae and physical map are very detailed, through studying the joint efforts in the several important laboratory of Pyricularia oryzae in the world, complete the drafting of Pyricularia oryzae 70-15 bacterial strain complete sequence sketch in October, 2002.2007, after the 20000 multimutation bodies of Yong-Hwan Lee study group of South Korea Seoul university to rice blast pathogen carry out biological analysis, determine 741 kinds of gene of pathogenic bacteria, wherein 202 kinds is pathogenicity bo gene.By the analysis to genome sequence, scientists has carried out the prediction of sequence and function to gene all possible in Pyricularia oryzae genome and proteins encoded thereof, and data relevant have up till now been updated to the 7th edition.

The research of Pyricularia oryzae becomes Important Economic crop and the interactional research mode of pathogenic fungi gradually.Meanwhile, Pyricularia oryzae, as a desirable research system, also has important scientific research value to other plant pathogenic fungi of understanding and the mutual of host.Pyricularia oryzae has typical infection processs, and therefore Pyricularia oryzae is by the pattern as filamentous fungus molecular biology and pathogenesis.After rice blast pathogen conidiospore maturation, dropping on rice leaf, releases out viscose glue in conidial tip, and the hydrophobic surface of itself and rice leaf is closely pasted together; Within 2 hours, conidia germination, produces germ tube, and germ tube tip forms one " hook-shaped " most advanced and sophisticated also enlargement, then brings out the cellularstructure-appressorium being formed and have infection ability.Along with the continuous maturation of appressorium, note fields infects bolt, penetrates Cuticle, enters mesophyll tissue, forms secondary mycelium intercellular spread in the born of the same parents of host tissue, causes host to move back green and tissue necrosis, show obvious scab; And then, produce conidium at blade surface and again infect host.Appressorium is that rice blast fungus successfully invades host and in host, infects the key of expansion, and it is that one typically invades structure.

Since Pyricularia oryzae first MAPK Pmk1 is analyzed determine closely related with pathogenic growth after (Xu and Hamer, 1996), similar strategy is widely used the research in pathogenic relational approaches such as plant pathogenic fungi MAPK, cAMP.Strategy used first goes out the isogenic sequence of MAPK with degenerate primer pcr amplification, then studies this gene role in pathogenic correlative development process by the method for gene lacks functionality.Recently, the combination of comparative genomics and protein science, molecular genetics and pharmacological test procedures etc., makes the research of plant pathogenic fungi signal transduction path and mechanism of causing a disease become more and more easier.Meanwhile, the DNA of restriction restriction endonuclease mediation transforms (REMI) and ATMT T-DNA transforms, and is also employed for the structure of the systematic a large amount of random mutation transformant of Pyricularia oryzae and seeking of pathogenic related gene.These are attempted and make great efforts greatly to accelerate the explaination of Pathogenic pathway.

The pathogenic gene of qualification, clone plant pathogenic fungi, especially relevant to invasion procedure gene, the target site that can provide for design, screening antifungal drug.In some fungies comprising Pyricularia oryzae, demonstrated the target spot of some medicines at present, if tricyclazole is a kind of very important Pyricularia oryzae sterilant, its effect is the synthesis of check melanin, and target spot is three hydroxyl naphthalene reductase enzymes of Pyricularia oryzae; The action target spot of polypeptide sterilant sorphen A is the demethylase (CYP51) of mould.Therefore, utilize Protocols in Molecular Biology to identify, clone the new pathogenic gene in the pathogenic course of Pyricularia oryzae with critical function, can for designing, screening the drug target that new antifungal drug provides.

Summary of the invention

The technical problem to be solved in the present invention be to provide a kind of newly, the mycelial growth of the fungies such as Pyricularia oryzae, conidium produced and sprout, note fields and pathogenicly have the gene M osyn8 of material impact and the purposes of this gene.

In order to solve the problems of the technologies described above, the invention provides a kind of epiphyte pathogenic gene Mosyn8 coming from Pyricularia oryzae, the nucleotides sequence of the nucleotide sequence of this gene or its complementary strand is classified as SEQ ID NO:1.

Invention also provides the cDNA sequence of said gene Mosyn8 coding, this cDNA sequence has the nucleotide sequence shown in SEQ ID NO:2.

Invention also provides the protein of said gene Mosyn8 coding, this protein has the aminoacid sequence shown in SEQ ID NO:3.

The present invention also provides the purposes of gene M osyn8 simultaneously, and the expression of this gene M osyn8 is as the target for designing and screen antifungal drug.

The present invention also provides the purposes of the protein of gene M osyn8 coding simultaneously, this protein expression and the target modified as design and screening antifungal drug.

The present invention is by homologous sequence comparison, and cloned in Pyricularia oryzae and pathogenic relevant gene M osyn8, the conservative property of this gene in eukaryote is very high.

The present invention, by building Mosyn8 homogenotization carrier, utilizes Agrobacterium-medialed transformation that carrier is transferred to wild-type Pyricularia oryzae, obtains deletion mutant body Δ Mosyn8; In deletion mutant body Δ Mosyn8, be reintroduced back to Mosyn8 gene, the phenotype of mutant is recovered.

The present invention analyzes the basic phenotype of deletion mutant body Δ Mosyn8, Pyricularia oryzae Mosyn8 genetically deficient, and aerial hyphae becomes compacts, colony growthing slow; Produce spore ability to rise, appressorium diminishes; Mycelia is when cell wall degradation ferment treatment, and protoplast liberation speed rises, the destroy integrity of cell walls; To the pathogenic remarkable decline of paddy rice and barley.

Growth of Magnaporthe Grisea is slow, sporulation quantity rises and appressorium diminishes, the fragility that cell walls becomes because the deletion mutant that homologous recombination causes causes for gene involved in the present invention, and the virulence disappearance on susceptible rice varieties.

Accompanying drawing explanation

Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.

Fig. 1: Mosyn8 gene knockout process schematic and Southern hybridization verification Mosyn8 knock out.

Fig. 2: Guy11, Δ Mosyn8, the colonial morphology of Δ Mosyn8c on CM.

Fig. 3: Guy11, the morphology of appressorium of Δ Mosyn8.Scale=10 μm.

Fig. 4: Guy11, the indirect inspection of Δ Mosyn8 mutant appressorium turgescence and hole.

In Fig. 4, after (A) appressorium induces 48 hours, appressorium is subsided for the indirect analysis of appressorium turgescence size.(B) different extraneous percolating solution (1.7 M glycerine, 30% PEG400,36% PEG1000,40% PEG3350 and 40% PEG8000; Be adjusted to 4 constant MPa) for the analysis of appressorium cell walls pore size.

Fig. 5: Guy11, Δ Mosyn8 mutant appressorium class " Newton's rings " phenomenon in percolating solution.Scale=5 μm.

Fig. 6: the situation of cell wall degradation enzyme r e lease protoplastis.

Fig. 7: Δ Mosyn8 mutant carbohydrate is high ooze under upgrowth situation.

Fig. 7 represents, test strain on the CM of interpolation 1 M sorbyl alcohol or sucrose 26 DEG C cultivate after 7 days, statistics colony diameter size Taking Pictures recording.

Fig. 8: the hypotonic or height of Δ Mosyn8 mutant oozes the reaction under environment.

In Fig. 8, mycelia block is placed in containing or does not cultivate 2 days containing on 1.5% water agar of high concentrations of solutes, then is placed in optical microphotograph Microscopic observation.Structure is expanded in arrow instruction Δ Mosyn8 mutant colonies and the front end of conidia germination mycelia or centre.Scale=25 μm.

Fig. 9: Δ Mosyn8 mutant host plant inoculation experiments.

In Fig. 9, (A) conidium is diluted into 1 × 10 ⁵individual/ml, is inoculated in surface that is complete or scratch barley leaves; The pathological consequences of viewing test bacterial strain after 4-5 days.(B) Δ Mosyn8 Mutant Rice blade spraying inoculation pathological consequences.

Embodiment

Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.

The separation of embodiment 1:Mosyn8 gene and clone

The protein sequence of Saccharomyces cerevisiae Syn8 gene is obtained from http://www.yeastgenome.org/ site search, in Pyricularia oryzae genome database, http://www.broadinstitute.org/annotation/genome/magnaporthe_gri sea/MultiHome.html carries out homologous sequence search by blastP, obtain a predicted protein MGG_06521, called after Mosyn8.In order to study the function of Mosyn8 gene, from the genome of Pyricularia oryzae wild type strain Guy11, utilizing primer McDNAp1 and McDNAp2 to clone Mosyn8 gene complete sequence, and being connected on pMD18-T carrier, checking order; Meanwhile, in the cDNA library of wild type strain Guy11, clone the encoding sequence of this gene, 831bp, and be connected on pMD18-T carrier, carry out sequencing analysis.DNA sequence dna is shown in SEQ ID NO:1, and cDNA sequence is shown in SEQ ID NO:2.Aminoacid sequence is shown in SEQ ID NO:3.

The acquisition of embodiment 2:Mosyn8 deletion mutant body and complemented mutant body

Table 1, Primer and sequence thereof

Title	Sequence (5 '-3 ')
		SYN8up-1	TGGAGATCGGTTTCGAGGAT
SYN8up-2	CATTCATTGTTGACCTCCACTAAAAAGGACGGTACGATGGAAT
		SYN8dn-1	GGGCAAAGGAATAGAGTAGATGATCCGGCGTTTGAGCATTTAA
SYN8dn-2	CAGAGGTACCCCGGTGTTAC
		HPH-1	TAGTGGAGGTCAACAATGAATG
HPH-2	CATCTACTCTATTCCTTTGCCC
		nSYN8-1	CACTGCAGGTTTCGAGGATGAGATGAGG
nSYN8-2	CACTCGAGGCATGTTGCACCAGTTGTAG
		SYN8-C1	AAGTCGACCGCTCTATTTGAATGTGGACG
SYN8-C2	CACTGCAGAAGCATCGGGTGAAACCTAGT
		SYN8pb-1	CACTGACCAGCCTGACCTTT
SYN8pb-2	ACGGATGTTGTTGACGGAAC
		SYN8_yz1	AGGAAACGGGCACAGAGTC
SYN8_yz2	CGATCTGGTCACGGAATGT

The structure of 2.1 Mosyn8 gene knockout carriers

With the genome of Guy11 for template, the upstream and downstream fragment of the 1.6kb that increases respectively with primer SYN8up-1/2 and SYN8dn-1/2.

The sequence (see table 1) of primer SYN8up-1/2 and SYN8dn-1/2;

Amplification system is:

PCR reaction system (50 μ l)

Guy11 genomic dna 0.5 μ l (100ng)

Taq polymerase 1 μl (5U/μl)

10×buffer (+MgCl ₂，25mmol/L) 5 μl

dNTP（25mmol/L，each） 0.4 μl

50 μm of ol/L upstream primer 0.5 μ l

50 μm of ol/L downstream primer 0.5 μ l

ddH ₂O to 42.1 μl。

Amplification program is:

PCR reaction conditions:

1. 94 DEG C of denaturation 5min

2. 94℃ 30s

3. 58℃30s

4. 72℃ 1min30s

2-4. 35 circulation

5. 72℃ 10min

6. 4 DEG C of insulations.

Use HPH-1/2 primer, with plasmid pCB1003 for masterplate, the fragment of the 1.4 kb Totomycin that increase.

The sequence of HPH-1/2 primer is in table 1.

PCR reaction system (50 μ l)

PCB1003 plasmid 0.1 μ l

Taq polymerase 1 μl (5U/μl)

10×buffer (+MgCl ₂，25mmol/L) 5 μl

dNTP（25mM，each） 0.4 μl

50 μMs of HPH-1 primer 0.5 μ l

50 μMs of HPH-2 primer 0.5 μ l

ddH ₂O 42.5 μl；

Amplification program is:

PCR reaction conditions:

1. 94 DEG C of denaturation 5min

2. 94℃ 30s

3. 60℃ 30s

4. 72℃ 72s

2-4. 35 circulation

5. 72℃10min

6. 4 DEG C of insulations

Three fragments above utilize the method for PCR to merge, fusion product is as masterplate, carry out increase (sequence of primer is in table 1) with nSYN8-1/2 primer, the fragment of amplification introduces PstI/XhoI site (containing PstI/XhoI site above the primer of design), be connected to pCAMBIA1300 corresponding position, vector construction success.The carrier of gained is the 1300-Mosyn8 carrier comprising Mosyn8 gene upstream sequence-hygromycin gene-segments downstream.

Specific as follows:

The amplification system obtaining fusion product is:

Fragment upstream 1 μ l (about 100ng)

Segments downstream 1 μ l (about 100ng)

Totomycin fragment 3 μ l (about 300ng)

dNTP（25mmol/L，each） 0.5 μl

10×buffer (+MgCl ₂，25mmol/L) 2.5 μl

Taq polymerase 0.5

dd H ₂O 16.5 μl 。

Amplification program is:

Amplification system is carried out with nSYN8-1/2 primer:

Fusion product 0.5 μ l

nSYN8-1（50mM） 0.4 μl

nSYN8-2（50mM） 0.4 μl

dNTP （25mM） 0.4 μl

10×buffer (+MgCl2) 5 μl

Taq polymerase 0.5μl

dd H ₂O 42.8 μl ；

PCR reactions steps is as follows:

Remarks illustrate:

1.6kb fragment upstream is above specially:

TGGAGATCGGTTTCGAGGATGAGATGAGGCAGATCATCAAGATTCTACCAAAGGAGAGACAATCGATGCTCTTCTCGGCTACACAGACAACCAAGGTTGAGGACCTCGCGAGAGTATCTTTGCGTCCAGGACCGCTCTATTTGAATGTGGACGAGGAGAAGGAGTACAGCACAGTGGAGGGGCTGGAACAGGGCTATGTTGTCTGCGAGGCCGACAAGCGCTTCATCCTGCTTTTCTCTTTCCTTCAGAAGATGAAAAAGAAAAAGATTATCGTCTTCTTCAGCAGTTGCAACTCGGTCAAGTACTATGCTGAACTGCTCAACTATATCGACTGCCAAGTCCTGGATCTTCACGGCAAGCAAAAACAGCAGAAGCGAACCAACACCTTCTTTGAATTCTGCAATGCCGACAGGGGAACTCTGATCTGCACAGATGTTGCTGCCCGTGGTCTCGATGTAAGTTGTCGAGCACTCCTTTGGACTTTGGACCTCCCCCTTGATGAGCCACAATCACTGACCAGCCTGACCTTTAGATCCCTGCTGTTGACTGGATTGTGCAGTTTGACCCGCCTGATGACCCCCGCGACTACATTCACCGCGTGGGACGAACAGCCCGTGGCACAAACAAGAAGGGTCGCTCCCTGATGTTTTTGCTGCCCAGCGAAGTCGGCTTCTTGACCTACCTCAAGCAGGCCCGTGTCCCGGTGGTTGAGTTCGACTTCCCGACAAAGAGCATCAAGAACGTGCAATCCCAGCTTGAGAAGCTCATTGGCAAGAACTATTACCTCAACTCTAGCGCCAAGGATGGATTCAGGTCATATCTGCATGCTTATGCGAGCCACAGCCTGCGGTCTGTGTTTGACATCAACAAACTGGATCTCGCAAAGGTTGCCAAAAGCTTTGGCTTTGCAACGCCGCCAAGAGTGGACATCCAACTCGGCGCAAGCATGAGCAAGGACAAGAAAGCCGGAGGAAGGAGAGCGTACGGGAGTCAACCCAGGCAAGGGGGTACATATGGGAAGAGGCGATAATTATGAGAAAGGAACTATTTGATAAAGGCATTCACGCGACTGGCGTTCATTTTTCATGTACGATTCAAACATAATTTCGGCGTCTATTTTTTCTGAGCTACGTTCATGTGCACTATTTTTGGACCTAAGGACTAAGTTACGGTACTTTGGTCTAGTTCTAGCCTACCTATGTCTGTCAAGTGCCTTTACTCAGTATAGGTGTGCCTCATTTATTCACTCGTTTATCCACGTCATAGTTGTTGCGTCGCTTGTGAGGTGCTGACCCTAACCCTGAAAACCTCTGTTGCTTGTCTTGGAGCATCCAGGATCCCCCATGTTCTGCCATGCATCAATTCGTTGCCGACGTAATGCGGCACATGCGCCCGCAGGCAGATGTTCCGTCAACAACATCCGTGTGCTCCGTCATCTCGTACGAATCTTTGACCAAACAATCGCTCGACCGGTCAGAAAAGTTTTGCTTTCCTCACGCTGTTCCTCGCCAAATTCGACCAATTCGGGATTCTTTATCAATCCTTACACAGAGCGACCTAGGCCTGGAGCCAAATTCCATCGTACCGTCCTTTTTAGTGGAGGTCAACAATGAATG 。

1.6kb segments downstream is above specially:

GGGCAAAGGAATAGAGTAGATGATCCGGCGTTTGAGCATTTAACTTTTTTCATCTTTCAAGAAACGATAAAGTCTTTTGTTTCCTTCACTAAATCTGGGGTTTTTTTTTTACAATTGCCCAATGTGATTACCTCTATTATTGCATGTACTTGGCGTTGGGCGAGGTTTTCTCTTCTTTTTTTTTTCTCCTTTTCTTTTCTCTAATATGTGTATGTAAGATATCTATGATCTTTGTCATCTTGTTGAGGTATTTATTTGTACATACACCGTTCAAGGGTGTATATAACGATGGCCTTCTGAAGAGAGTTCGTCTCACATTAAGTTTTCATAATATTTATGTTGAAAAAGCGTTCGTTTACTAGACACTTATACCCGGGGAATGGTGCGACTCTCAGCCTTGTGGATATCTAAAGCATTTTCGACGCAGGCACAACATTTGTGTGAGCCAGCCCAACGCACCCACGAATATCAGTCTTTTACTAGGTTTCACCCGATGCTTCAAAACCCGTTTCCATCCGAGATTTATCTGTACTATTCATTCAACATATTGTCTAACCCTGTACTTCGTCAAAGAATTCACTGGATTGATTCCCACTCTTTTTACCACATATATTAGCAGCAATTACTTGTTCAAGATTGATTGGTCCCGCCCTACATTTTTTATATATAGCGAGCTAGCCCACTTATAGATTCCTTCATAGTGATGCTACGATAAGAGCATTCATTGTCCCATCCGTAAAATTATACATGGTCAAGATTTGAGAATGCTTCTAGAGTAGGGCCAAGGTAATCAAAAGCCAATGGGCTAATAGCATGATGTAATAGGTCCACGTCGACCCGATACAGGAAGATGGAGGAAAATGGGTGAAAAGACATGAAGCCTCCAAGAAACCCAAGTTGGTGTCTGCCGCTCCCGAATAGCCTCGCCCCTGGATAACATATGACCGAATCTATGCAACAGTCCAGCATGTAATTAATTGACGAATGGCCATATTGAAATTCCAATGCAAGCACGTGTCTGCTGTAAGCGGAAAGCTAGCCATTCGATAGAACTAAACTTGGCGCAAAAAAATGGCACCCCATAATCTCCATCCGTCCCCACATCGAATCCGCACCGCACACAGCCCATCGTCCTTTCACAGCCGTGTCTTTGAGCACGGGTTAGAGTGACGACATCTGAGAGGCAGGAAAAGCTAAAAGGCCAAGATATCGATTTGGCAGATATATGATGGATGGCTATCCCACACGGTCTCGTTAGGGCGCGCAGCCGGGTGGTGTTAGCCACCGGCGTGCTGCTCTTCGTCCTCCTCGTCGCTAAGATGCGGTCCAAGTCGTCGCTCTTCATGACCGTTACCGTCGCCGGGCCCGCGAGCCATTCGGCAGCTGCCCAACCCGTGATCGTCGGCGGCGTCGATGTGGGTTGGTACCCGTCCAGCCAGACTGCGTTCAATGACCTCACGGCCGTGGTCGACGGTGCCGGGGTGCCTAAATTCACCTTCGACCCGTCGGGCGAGTGGCAGGATGACGGCTACAACTGGTGCAACATGCCTCATGTGCGGGCGCAGGATTACATGCAACCGTCGACGGATTTTGAGCTGCAGTATGTGGAGATTGTACGTGACCCGCCGTAACACCGGGGTACCTCTG 。

The fragment of 1.4 kb Totomycin is above specific as follows:

TAGTGGAGGTCAACAATGAATGCCTATTTTGGTTTAGTCGTCCAGGCGGTGAGCACAAAATTTGTGTCGTTTGACAAGATGGTTCATTTAGGCAACTGGTCAGATCAGCCCCACTTGTAGCAGTAGCGGCGGCGCTCGAAGTGTGACTCTTATTAGCAGACAGGAACGAGGACATTATTATCATCTGCTGCTTGGTGCACGATAACTTGGTGCGTTTGTCAAGCAAGGTAAGTGGACGACCCGGTCATACCTTCTTAAGTTCGCCCTTCCTCCCTTTATTTCAGATTCAATCTGACTTACCTATTCTACCCAAGCATCCAAATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTGACATTGGGGAGTTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTCCAGCCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCATGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCCTCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGCCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATAGAGTAGATG 。

The acquisition of 2.2 Δ Mosyn8 mutant

The 1300-Mosyn8 vector comprising Mosyn8 gene upstream sequence-hygromycin gene-segments downstream in Agrobacterium after, utilize Agrobacterium-mediated Transformation Pyricularia oryzae wild type strain Guy11 by ATMT method.In gene substitution process, most of foreign DNA is inserted in the genome of Pyricularia oryzae, and due to the existence of two ends homologous sequence, part homologous replacement can occur, and the process of homologous replacement is shown in Fig. 1.20 transformants are altogether obtained in test, extract the genomic dna of gained transformant, SYN8_yz1/2 primer is utilized to carry out PCR checking (sequence of primer is in table 1), wherein the sub-PCR primer electrophoresis of Partial Conversion does not have the object band of 524bp (underlining part in SEQ ID NO1), tentatively concludes that these transformants not having object band are gene substitution mutant (this part is replaced by hygromycin gene).Choose wherein two mutant SYN8-1 and SYN8-2 and extract genomic dna in a large number, carry out Southern hybridization verification.Carry out enzyme with ScaI to the genome of SYN8-1 and SYN8-2 to cut, wild-type Guy11 is contrast, the pcr amplification product of primer SYN8pb-1 and SYN8pb-2, the fragment of 914bp, synthesis hybridization probe.Remarks illustrate: the object band not having 524bp in the PCR primer electrophoresis of mutant SYN8-1 and SYN8-2.

Transformant PCR reaction system:

Transformant genomic dna 0.5 μ l

SYN8_yz1（50mM） 0.2 μl

SYN8_yz2（50mM） 0.2 μl

dNTP （25mM） 0.2 μl

10×buffer (+MgCl2) 2.5 μl

Taq polymerase 0.5μl

dd H ₂O 20.9 μl；

Response procedures

Remarks illustrate: above-mentioned is verify for PCR.

Southern hybridization Roche company's digoxin DNA marker of the present invention and detection kit (DIG-High Prime DNA Labeling and Detection Kit I) are carried out.The synthesis of hybridization probe: reaction system and program, identical with fragment upstream working method (that is, identical with " reaction system " of 2.1 vector construction middle and upper reaches primer amplifications, DNA is genomic dna, and primer is the SYN8pb-1/2 listed in table).The PCR primer obtained, carry out probe synthesis, step is as follows:

1) get 1 μ g probe PCR product and add sterilizing distilled water to 16 μ l.

2) incubation 10min in boiling water bath, makes DNA sex change, and cools in frozen water rapidly.

3) mix DIG-High Prime, add 4 μ l DIG-High Prime in the template DNA of sex change, mixing is also slightly centrifugal.Temperature bath 24h in 37 C water-baths.

Results of hybridization shows, and wild-type Guy11 bacterial strain has hybridization signal at 6.5kb place, and SYN8-1 and SYN8-2 has hybridization signal at 2.6kb place and be single copy, and this results of hybridization confirms that SYN8-1 and SYN8-2 is Mosyn8 deletion mutant body (Fig. 1).Choose SYN8-1 to carry out single spore separation and preserve carrying out follow-up test.

Remarks illustrate: slowly, aerial hyphae is tight, and edge is irregular for mutant SYN8-1 and the SYN8-2 speed of growth; Wild type strain aerial hyphae is more, gray, regular edges.

Remarks illustrate: in the structure of Mosyn8 gene knockout carrier, carry out the sequence content (horizontal line is the probe sequence of Southern hybridization) of the fragment sequence > fusion product that amplification obtains with nSYN8-1/2 primer:

GTTTCGAGGATGAGATGAGGCAGATCATCAAGATTCTACCAAAGGAGAGACAATCGATGCTCTTCTCGGCTACACAGACAACCAAGGTTGAGGACCTCGCGAGAGTATCTTTGCGTCCAGGACCGCTCTATTTGAATGTGGACGAGGAGAAGGAGTACAGCACAGTGGAGGGGCTGGAACAGGGCTATGTTGTCTGCGAGGCCGACAAGCGCTTCATCCTGCTTTTCTCTTTCCTTCAGAAGATGAAAAAGAAAAAGATTATCGTCTTCTTCAGCAGTTGCAACTCGGTCAAGTACTATGCTGAACTGCTCAACTATATCGACTGCCAAGTCCTGGATCTTCACGGCAAGCAAAAACAGCAGAAGCGAACCAACACCTTCTTTGAATTCTGCAATGCCGACAGGGGAACTCTGATCTGCACAGATGTTGCTGCCCGTGGTCTCGATGTAAGTTGTCGAGCACTCCTTTGGACTTTGGACCTCCCCCTTGATGAGCCACAAT CACTGACCAGCCTGACCTTTAGATCCCTGCTGTTGACTGGATTGTGCAGTTTGACCCGCCTGATGACCCCCGCGACTACATTCACCGCGTGGGACGAACAGCCCGTGGCACAAACAAGAAGGGTCGCTCCCTGATGTTTTTGCTGCCCAGCGAAGTCGGCTTCTTGACCTACCTCAAGCAGGCCCGTGTCCCGGTGGTTGAGTTCGACTTCCCGACAAAGAGCATCAAGAACGTGCAATCCCAGCTTGAGAAGCTCATTGGCAAGAACTATTACCTCAACTCTAGCGCCAAGGATGGATTCAGGTCATAT CTGCATGCTTATGCGAGCCACAGCCTGCGGTCTGTGTTTGACATCAACAAACTGGATCTCGCAAAGGTTGCCAAAAGCTTTGGCTTTGCAACGCCGCCAAGAGTGGACATCCAACTCGGCGCAAGCATGAGCAAGGACAAGAAAGCCGGAGGAAGGAGAGCGTACGGGAGTCAACCCAGGCAAGGGGGTACATATGGGAAGAGGCGATAATTATGAGAAAGGAACTATTTGATAAAGGCATTCACGCGACTGGCGTTCATTTTTCATGTACGATTCAAACATAATTTCGGCGTCTATTTTTTCTGAGCTACGTTCATGTGCACTATTTTTGGACCTAAGGACTAAGTTACGGTACTTTGGTCTAGTTCTAGCCTACCTATGTCTGTCAAGTGCCTTTACTCAGTATAGGTGTGCCTCATTTATTCACTCGTTTATCCACGTCATAGTTGTTGCGTCGCTTGTGAGGTGCTGACCCTAACCCTGAAAACCTCTGTTGCTTGTCTTGGAGCATCCAGGATCCCCCATGTTCTGCCATGCATCAATTCGTTGCCGACGTAATGCGGCACATGCGCCCGCAGGCAGATGTTCCGTCAACAACATCCGTGTGCTCCGTCATCTCGTACGAATCTTTGACCAAACAATCGCTCGACCGGTCAGAAAAGTTTTGCTTTCCTCACGCTGTTCCTCGCCAAATTCGACCAATTCGGGATTCTTTATCAATCCTTACACAGAGCGACCTAGGCCTGGAGCCAAATTCCATCGTACCGTCCTTTTTAGTGGAGGTCAACAATGAATGCCTATTTTGGTTTAGTCGTCCAGGCGGTGAGCACAAAATTTGTGTCGTTTGACAAGATGGTTCATTTAGGCAACTGGTCAGATCAGCCCCACTTGTAGCAGTAGCGGCGGCGCTCGAAGTGTGACTCTTATTAGCAGACAGGAACGAGGACATTATTATCATCTGCTGCTTGGTGCACGATAACTTGGTGCGTTTGTCAAGCAAGGTAAGTGGACGACCCGGTCATACCTTCTTAAGTTCGCCCTTCCTCCCTTTATTTCAGATTCAATCTGACTTACCTATTCTACCCAAGCATCCAAATGAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTTCTGATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAAGAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAAATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCGGCCGCGCTCCCGATTCCGGAAGTGCTTGACATTGGGGAGTTCAGCGAGAGCCTGACCTATTGCATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAACCGAACTGCCCGCTGTTCTCCAGCCGGTCGCGGAGGCCATGGATGCGATCGCTGCGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCGGTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTATCACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTCGATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCATGCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTCATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCCTCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGCGGAGGCATCCGGAGCTTGCAGGATCGCCGCGCCTCCGGGCGTATATGCTCCGCATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATGCAGCTTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCGGGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTAGAAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGGAATAGAGTAGATGATCCGGCGTTTGAGCATTTAACTTTTTTCATCTTTCAAGAAACGATAAAGTCTTTTGTTTCCTTCACTAAATCTGGGGTTTTTTTTTTACAATTGCCCAATGTGATTACCTCTATTATTGCATGTACTTGGCGTTGGGCGAGGTTTTCTCTTCTTTTTTTTTTCTCCTTTTCTTTTCTCTAATATGTGTATGTAAGATATCTATGATCTTTGTCATCTTGTTGAGGTATTTATTTGTACATACACCGTTCAAGGGTGTATATAACGATGGCCTTCTGAAGAGAGTTCGTCTCACATTAAGTTTTCATAATATTTATGTTGAAAAAGCGTTCGTTTACTAGACACTTATACCCGGGGAATGGTGCGACTCTCAGCCTTGTGGATATCTAAAGCATTTTCGACGCAGGCACAACATTTGTGTGAGCCAGCCCAACGCACCCACGAATATCAGTCTTTTACTAGGTTTCACCCGATGCTTCAAAACCCGTTTCCATCCGAGATTTATCTGTACTATTCATTCAACATATTGTCTAACCCTGTACTTCGTCAAAGAATTCACTGGATTGATTCCCACTCTTTTTACCACATATATTAGCAGCAATTACTTGTTCAAGATTGATTGGTCCCGCCCTACATTTTTTATATATAGCGAGCTAGCCCACTTATAGATTCCTTCATAGTGATGCTACGATAAGAGCATTCATTGTCCCATCCGTAAAATTATACATGGTCAAGATTTGAGAATGCTTCTAGAGTAGGGCCAAGGTAATCAAAAGCCAATGGGCTAATAGCATGATGTAATAGGTCCACGTCGACCCGATACAGGAAGATGGAGGAAAATGGGTGAAAAGACATGAAGCCTCCAAGAAACCCAAGTTGGTGTCTGCCGCTCCCGAATAGCCTCGCCCCTGGATAACATATGACCGAATCTATGCAACAGTCCAGCATGTAATTAATTGACGAATGGCCATATTGAAATTCCAATGCAAGCACGTGTCTGCTGTAAGCGGAAAGCTAGCCATTCGATAGAACTAAACTTGGCGCAAAAAAATGGCACCCCATAATCTCCATCCGTCCCCACATCGAATCCGCACCGCACACAGCCCATCGTCCTTTCACAGCCGTGTCTTTGAGCACGGGTTAGAGTGACGACATCTGAGAGGCAGGAAAAGCTAAAAGGCCAAGATATCGATTTGGCAGATATATGATGGATGGCTATCCCACACGGTCTCGTTAGGGCGCGCAGCCGGGTGGTGTTAGCCACCGGCGTGCTGCTCTTCGTCCTCCTCGTCGCTAAGATGCGGTCCAAGTCGTCGCTCTTCATGACCGTTACCGTCGCCGGGCCCGCGAGCCATTCGGCAGCTGCCCAACCCGTGATCGTCGGCGGCGTCGATGTGGGTTGGTACCCGTCCAGCCAGACTGCGTTCAATGACCTCACGGCCGTGGTCGACGGTGCCGGGGTGCCTAAATTCACCTTCGACCCGTCGGGCGAGTGGCAGGATGACGGCTACAACTGGTGCAACATGC 。

The structure of 2.3 complementing vector

In order to verify that the phenotype of mutant is because the disappearance of gene M osyn8 causes, construct complementing vector p1300SUR-SYN8.Utilize primer SYN8-C1/2 to increase containing the upstream sequence of 1.5 kb and the total length Mosyn8 gene of 0.5 kb downstream sequence, be cloned into pMD18-T carrier.After XhoI and PstI double digestion, reclaim the Mosyn8 gene fragment of 2.9kb, be connected on XhoI and the PstI site of pCAMBIA1300X-SUR carrier, obtain complementing vector p1300SUR-SYN8.Selectable marker gene SUR(conventional labels gene, from plasmid pCB1532) amplification is from pCB1532 carrier and be connected to the EcoRV/EcoRI site of pCAMBIA1300X, forms pCAMBIA1300X-SUR.After in p1300SUR-SYN8 vector to Agrobacterium, utilize Agrobacterium-mediated Transformation Pyricularia oryzae mutant Δ Mosyn8(and mutant SYN8-1 and SYN8-2 by ATMT method).

Remarks illustrate: p1300SUR-SYN8 transforms pCAMBIA1300X-SUR and obtains; That the fragment that SYN8-C1/2 increases is connected to the corresponding position of pCAMBIA1300X-SUR.

Because the difference of Mosyn8 deletion mutant and wild-type is very large, after complementation, the phenotype of deletion mutant is restored, and phenotype is identical with wild-type Guy11.The change of Δ Mosyn8 phenotype is caused by the disappearance of Mosyn8 gene.Choose complemented strain Mosyn8C and carry out follow-up test (remarks illustrate: the meaning that C represents supplementary, recovers).

Remarks illustrate: after complementation, the disappearance phenotype of mutant Δ Mosyn8 is restored, and complemented strain Mosyn8C (Mosyn8C obtains by after " SYN8-1 " complementation) speed of growth accelerates, and aerial hyphae is dense, regular edges is identical with the phenotype of wild-type Guy11.

Embodiment 3: mutation type surface analysis

3.1 mutant colonies forms

On CM substratum, the aerial hyphae of Δ Mosyn8 bacterium colony is compacted, poor growth, and edge is irregular; And the aerial hyphae of wild-type Guy11 and complementary type Mosyn8C is dense, bacterium colony is beige (Fig. 2).The disappearance of Mosyn8 gene have impact on colonial morphology and the speed of growth of Pyricularia oryzae.

3.2 mutant Δ Mosyn8 sporulation quantities rise

By inoculation on CM substratum, 16 h light, 28 DEG C of growths are after 10 days, and bacterium colony surface mycelia is washed off by sterilized water, and three layers of lens wiping paper filter, and constant volume, to 4 milliliters, is added up under microscope.The spore output of wild-type Guy11 is 91.0 ± 15.3 × 10 ⁵individual/ml, the bacterial strain Mosyn8C spore output of complementary type is 97.9 ± 12.7 × 10 ⁵individual/ml, and the sporulation quantity of deletion mutant body Δ Mosyn8 is 133.0 ± 25.8(table 2).Therefore, the disappearance of Mosyn8 improves the unit surface sporulation quantity of Pyricularia oryzae on CM flat board.The conidium size of mutant Δ Mosyn8, germination physiology and note fields rate compare with wild-type Guy11, change little (table 2), but the appressorium that Δ Mosyn8 is formed reduces (Fig. 3).

Table 2, Mosyn8 gene are in growth and infect the developmental effect of dependency structure

In table 2, ^acM agar plate is cultivated the bacterium colony of 10 days for measuring average growth rate.Data be from three times independently CM cultivate the Measurement and analysis of 7 days bacterium colonies, and to list in the mode of mean value and standard deviation.

^bcollect the conidium of cultivation 6 days bacterium colonies on CM, add sterile distilled water water to 4 ml, then analyze conidium output.

^{c, f}conidium and appressorium size data come from least twice independent experiment; Each experiment measuring is more than 100 samples.

^{d, e}conidia germination rate and note fields rate are inoculated in hydrophobic membrane surface 9 at conidial suspension and as a child added up.

^gnumerical value with same letter does not have significant difference (P<0.05).

3.3 mutant Δ Mosyn8 appressorium turgescences are analyzed

The disappearance of MoSYN8 result in the appressorium reduced, the rate (Fig. 4 A) but the appressorium that mutant shows less extraneous 1-5 M glycerine mediation is subsided.This shows that Δ Mosyn8 mutant appressorium has higher turgescence compared with wild-type, or the cell walls hole increased.When solute molecule is excluded from outside cell walls, the pressure of generation can cause subsiding of appressorium; If can be entered by cell walls hole, then can cause the plasmolysis of appressorium.Therefore, we are by the same ambient pressure of PEG furnishing of different molecular weight, and whether the cell walls hole of test appressorium changes.Compare with wild-type, the plasmolysis of Δ Mosyn8 mutant under the different PEG/ratio that subsides declines (Fig. 4 B) all to some extent, and after showing the disappearance of Mosyn8, Pyricularia oryzae shows finer and close cell walls.In addition, we also find when adding extraneous percolating solution, observe the optical phenomena (Fig. 5) being similar to " Newton's rings " in part Δ Mosyn8 mutant appressorium.

The disappearance of 3.4 Mosyn8 improves the susceptibility to cell wall degrading enzyme

Δ Mosyn8 mutant in CM liquid culture after 2 days mycelia release protoplastis speed slower than Guy11, but conidial suspension is cultivating 2 days containing 28 DEG C of 200rpm in 20% sucrose OCM substratum (adding the sucrose of 1M in CM substratum), again with 5 mg/ml cell wall degrading enzyme Glucanex process, the burst size of protoplastis is surveyed every 30 minutes, found that, the mycelia that the OCM through adding 20% sucrose cultivates produces than wild-type or the more protoplastis (Fig. 6) of complemented strain under same time.

3.5 height ooze can the growth of complementary Δ Mosyn8 mutant

In CM, add 0.5 M NaCl, 0.5 M KCl, 1 M sucrose and 1 M sorbyl alcohol etc., test and highly ooze the impact of environment on Δ Mosyn8 deletion mutant.Adding of high density NaCl or KCl plasma type height vadose solution matter is as good as the impact of Δ Mosyn8 mutant growth and wild type strain, but the carbohydrate such as sorbyl alcohol or sucrose is high oozes the growth that stablizer has recovered Δ Mosyn8 mutant to a great extent; Wherein the speed of growth of Δ Mosyn8 mutant on interpolation 1 M sorbyl alcohol CM is even also come soon (Fig. 7) than common CM.

In order to further observe the reaction of Mosyn8 deletion mutant for different osmotic condition, the hypotonic and height of our microscopic examination mutant oozes mycelial growth situation (Fig. 8).Under the hypotonic condition of 1.5% water agar, the poor growth of Δ Mosyn8 mutant, and with a large amount of phenomenons of expanding; Conidial sprouting mycelia also has top or centre to expand the appearance of structure with this understanding.0.5 M NaCl effectively can suppress the enlargement of mycelia, but with Δ Mosyn8 mutant to add the observation on Growth on 0.5 M NaCl CM flat board consistent, sodium at high concentration salt ion effectively can not promote the growth of mutant mycelia.The interpolation of 1 M sorbyl alcohol then can reach mycelia and expand the effect such as the suppression of phenomenon and the raising of the speed of growth.Δ Mosyn8 mutant, when gene function obtains complementation, shows the phenotype consistent with wild type strain.

Embodiment 4:Mosyn8 is that rice blast bacterium pathogenicity is necessary:

In laboratory conditions, bacterial strain, punches after 7 days at CM grow on plates.Be seeded in by bacterium block with on the nursery paddy rice of 21 days on the nursery barley isolated blade of 8 days, the blade not connecing bacterium compares.Δ Mosyn8 mutant conidial suspension can only produce a small amount of scab (Fig. 9 A upper part and Fig. 9 B) in vitro barley leaves and rice leaf.Meanwhile, we also to analyze the plant tissue of Δ Mosyn8 mutant pathogenic.Δ Mosyn8 sudden change physical efficiency causes a small amount of scab abrading barley leaves, increases, but be obviously weaker than Guy11(Fig. 9 A lower part when not abrading).

CM substratum (Talbot et al., 1993)

Add ddH ₂o to 1000ml

1mol/L NaOH adjust pH to 6.5;

If join solid medium, in every 1L substratum, add 15g agar powder; 121 ° of C moist heat sterilization 20min.

1000×Vitamin solution（100ml）

1000×Trace elements（100ml）

Add ddH ₂o to 100ml.

Above three kinds of equal filtration sterilizations of reagent, 4 ° of C dark store.

Embodiment 5, the expression utilizing MoSyn8 albumen or modification, as target, screen antimycotic medicine:

The promotor of the downstream gene by MoSyn8 gene regulating and fluorescin GFP are built into fusion rotein carrier, be transferred in Pyricularia oryzae by the method for embodiment 2, then Transformation of Magnaporthe grisea daughter bacteria strain mass propgation in liquid perfect medium that the GFP under the promoter regulation of downstream gene expresses, some aliquots are divided into after collecting mycelia, add compound to be screened or drug candidate in every portion to continue to cultivate a few hours to a couple of days at perfect medium, get the green fluorescence expression of mycelia at the GFP of fluorescence microscopy Microscopic observation mycelia.If MoSyn8 albumen is suppressed by drug candidate and loses activity, then lose the ability of regulation and control of the promoter expression to downstream gene, GFP albumen is not expressed thus mycelia loses green fluorescence, illustrates that this candidate agent has the effect suppressing MoSyn8 albumen.The method with the drug candidate recycling embodiment 3 suppressing MoSyn8 protein function obtained, candidate agent is added in the spore liquid of inoculation, measure wild-type Pyricularia oryzae whether to weaken the pathogenic of paddy rice under this candidate agent existent condition, the anti-mycotic efficiency of further deterministic compound.When to be wild-type rice blast fungi isolates weaken paddy rice pathogenic measurement result, illustrate that drug candidate has obvious anti-mycotic efficiency, can as the source of antifungal drug; When measurement result is wild-type rice blast fungi isolates to the pathogenic not change of paddy rice or when strengthening, illustrates that candidate agent does not have anti-mycotic efficiency, can not antifungal drug be used as.

Embodiment 6, utilize the promotor of Mosyn8 as target, screen antimycotic medicine.

The promotor of Mosyn8 and fluorescin GFP are built into fusion rotein carrier, or the promotor of Mosyn8 is built into fusion rotein carrier together with fluorescin GFP and Mosyn8 albumen, be transferred in Pyricularia oryzae by the method for embodiment 2, then Transformation of Magnaporthe grisea daughter bacteria strain mass propgation in liquid perfect medium that the GFP under the promoter regulation of MoSyn8 expresses, some aliquots are divided into after collecting mycelia, add compound to be screened or drug candidate in every portion to continue to cultivate a few hours to a couple of days at perfect medium, get the green fluorescence expression of mycelia at the GFP of fluorescence microscopy Microscopic observation mycelia.If the combined thing of the promotor of Mosyn8 suppresses and loses activity, then GFP albumen is not expressed thus mycelia loses green fluorescence.Whether the method for the compound recycling embodiment 3 obtained, measure wild-type Pyricularia oryzae and weaken the pathogenic of paddy rice under this compound existent condition, the anti-mycotic efficiency of further deterministic compound.

Finally, it is also to be noted that what enumerate above is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be had.All distortion that those of ordinary skill in the art can directly derive from content disclosed by the invention or associate, all should think protection scope of the present invention.

Claims (2)

1. come from the purposes of the epiphyte pathogenic gene Mosyn8 of Pyricularia oryzae, it is characterized in that: gene M osyn8 is as the target for designing and screen antifungal drug; The nucleotides sequence of the nucleotide sequence of this gene M osyn8 or its complementary strand is classified as SEQ ID NO:1.

2. the purposes of the protein of gene M osyn8 coding, is characterized in that: protein is as design and the target screening antifungal drug; Described protein is the aminoacid sequence shown in SEQ ID NO:3.