CN106868147A - A kind of sigatoka bacterium molecule detection primer and its method for quick - Google Patents

A kind of sigatoka bacterium molecule detection primer and its method for quick Download PDF

Info

Publication number
CN106868147A
CN106868147A CN201710130113.7A CN201710130113A CN106868147A CN 106868147 A CN106868147 A CN 106868147A CN 201710130113 A CN201710130113 A CN 201710130113A CN 106868147 A CN106868147 A CN 106868147A
Authority
CN
China
Prior art keywords
primer
sigatoka
detection
pcr
bacterium
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710130113.7A
Other languages
Chinese (zh)
Other versions
CN106868147B (en
Inventor
杜宜新
石妞妞
陈福如
阮宏椿
甘林
杨秀娟
代玉立
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Plant Protection of FAAS
Original Assignee
Institute of Plant Protection of FAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Plant Protection of FAAS filed Critical Institute of Plant Protection of FAAS
Priority to CN201710130113.7A priority Critical patent/CN106868147B/en
Publication of CN106868147A publication Critical patent/CN106868147A/en
Application granted granted Critical
Publication of CN106868147B publication Critical patent/CN106868147B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a kind of sigatoka bacterium molecule detection primer and its method for quick, belong to corps diseases detection and biological technical field.The specific primer includes sense primer RMSF：5 ' AACCCTGCGTAACTGAGTCG 3 ', anti-sense primer RMSR：5’‑TTCAGCGGGTATCCCTACCT‑3.The detection primer and detection method invented can be used for sigatoka bacterium（Ramichloridium musae）The Testing and appraisal of pure culture, can also detect to banana plant；Detection primer high specificity of the present invention, sensitivity are high, and detection method practicality is good, simple and efficient to handle；The present invention can realize the early detection of sigatoka, moreover it is possible to effectively distinguish and cause the pathogen of sigatoka, early warning and prevention and control to sigatoka disease, and the diffusion of controlling disease spreads significant.

Description

A kind of sigatoka bacterium molecule detection primer and its method for quick
The content of the invention
For in the prior art to sigatoka bacterium（Ramichloridium musae）Detection and identify main base In pathogen morpha feature, program is cumbersome, dead long, high to the identification skill requirement, degree of accuracy of consumption is low, it is difficult to meet sigatoka What is diagnosed is actually needed problem, there is provided a kind of sigatoka bacterium（Ramichloridium musae）Molecular detection primer and Its method for quick.
To achieve the above object, this invention takes following technical scheme：
Present invention firstly provides a kind of sigatoka bacterium（Ramichloridium musae）Molecular detection primer, its nucleosides Acid sequence is：
Sense primer RMSF：5’-AACCCTGCGTAACTGAGTCG-3’；
Anti-sense primer RMSR：5’-TTCAGCGGGTATCCCTACCT-3’.
The primer RMSF and RMSR is to sigatoka bacterium（Ramichloridium musae）Specific amplification goes out The product of 383bp.
Present invention also offers a kind of sigatoka bacterium（Ramichloridium musae）Method for quick, bag Include following steps：
(1) DNA is extracted from banana plant tissue；
For detecting during pathogen pure culture, strains tested genomic DNA is extracted using CTAB methods；For detecting banana Plant tissue whether there is sigatoka bacterium（Ramichloridium musae）When, extracted using NaOH rapid cleavages method Banana plant tissue gene group DNA.
(2) to extract banana plant tissue DNA as template enters performing PCR amplification：The μ L of PCR reaction systems 25, comprising 2.5 μ L 10 × PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, 10 Each 0.5 μ L of RMSF and RMSR, the μ L of DNA profiling 1, plus the ddH of μm ol/L2O is to cumulative volume up to 25 μ L；PCR reaction conditions are：94℃ Predegeneration 5min；94 DEG C of denaturation 45sec, 56 DEG C of annealing 45sec, 72 DEG C of extension 45sec, totally 35 circulations；72 DEG C of extensions 10min；
(3) with the electrophoretic analysis of 0.5 × tbe buffer liquid on 1.0% Ago-Gel, voltage is 4- to the PCR primer on obtained by step 5V/cm；Size according to amplified production judges testing result, if energy specific amplification goes out the product of 383bp, can determine that institute The pathogen stated is sigatoka bacterium（Ramichloridium musae）Or there is banana in described banana plant tissue Leaf spot fungi（Ramichloridium musae）, the non-sigatoka bacterium of otherwise described pathogen（Ramichloridium musae）Or do not exist sigatoka bacterium in described banana plant tissue（Ramichloridium musae）。
Positive beneficial effect of the invention is：
（1）Accuracy is high：The present invention is according to fungi ribosomes transcribed spacer（rDNA-ITS）Height of the sequence in fungi kind The design of the characteristics of degree conservative and section's category inter-species changeability is to sigatoka bacterium（Ramichloridium musae）With spy The PCR primers of different amplification effect.To the sigatoka bacterium of different geographic origins（Ramichloridium musae）、 Carry sigatoka bacterium（Ramichloridium musae）Plant tissue and health Banana Tissue carried out detection test Card, only sigatoka bacterium（Ramichloridium musae）Can specifically expand with the Banana Tissue for carrying the germ Increase the electrophoretic band for 383 bp, illustrate that the primer designed by the present invention is used to detect sigatoka bacterium （Ramichloridium musae）Accurately and reliably；
（2）High specificity：Primer pair sigatoka bacterium designed by the present invention（Ramichloridium musae）With very Strong specificity, can be used in distinguishing sigatoka bacterium（Ramichloridium musae）, beak shell leaf spot long （Ceratocytis paradoxa）, anthracnose（Colletotrichum musae）, dark double spore leaf spots（Cordana musae）, the curved mould leaf spot of spore（Curvularia lunata）, black spot（Pseudocercospora fijiensis）, it is yellow Pinta（Pseudocercospora musae）It is raw on Leaf of banana so as to effective district distribution etc. sigatoka pathogen The similar disease of symptom characteristic；
（3）Sensitivity is high：Special primer and ITS gene universal primers that the present invention will be designed（ITS1/ITS4）Join together into After the amplification of row nest-type PRC, to sigatoka bacterium（Ramichloridium musae）Detection sensitivity in DNA levels Can reach 1fg；
（4）Applicability is wide, practicality is good：Sigatoka bacterium of the invention（Ramichloridium musae）Detection side Method, can not only be detected to germ mycelium, and also susceptible banana plant tissue can be detected, be capable of achieving banana tikka Germ（Ramichloridium musae）Early detection, i.e., detected before the aobvious disease of disease, the outburst stream of controlling disease OK；
（5）It is easy to operate quick：The present invention can determine that knot after need to only carrying out DNA extractions, PCR amplifications and agarose electrophoresis Really, general whole detection process can be completed within a few hours, simple and efficient to handle.
Brief description of the drawings
Fig. 1 is primer pair sigatoka bacterium of the present invention（Ramichloridium musae）Specific amplification electrophoretogram： Wherein swimming lane M is 2000bp DNA Marker, and swimming lane 2, swimming lane 3 are sigatoka bacterium（Ramichloridium musae）, Swimming lane 4-10 is respectively：Beak shell leaf spot fungi long（Ceratocytis paradoxa）, anthrax bacteria（Colletotrichum musae）, dark double spore leaf spot fungis（Cordana musae）, Curvularia disease（Curvularia lunata）, black spot Bacterium（Pseudocercospora fijiensis）, macula lutea germ（Pseudocercospora musae）, negative control.
Fig. 2 is primer sigatoka bacterium of the present invention（Ramichloridium musae）Sensitivity detection amplification electrophoresis Figure：A：Regular-PCR sensitivity technique, wherein swimming lane M are 2000bp DNA Marker, and swimming lane 2-12 is respectively：100ng、 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg, negative control, positive control；B is examined for nest-type PRC sensitivity Survey, wherein swimming lane M is 2000bp DNA Marker, swimming lane 2-13 is respectively：100ng、10ng、1ng、100pg、10pg、1pg、 100fg, 10fg, 1fg, 100ag, negative control, positive control；
Fig. 3 is Leaf of banana incidence tissue of the present invention and petiole tissue augmentation electrophoretogram, and wherein swimming lane M is 2000bp DNA Marker, swimming lane 2-10 are respectively the Leaf of banana tissue of natural occurrence, natural occurrence banana petiole tissue, artificial infection morbidity Leaf of banana tissue, artificial infection morbidity banana petiole tissue, healthy Leaf of banana tissue, healthy banana petiole tissue, strong Health Banana peel tissue, positive control, negative control.
Specific embodiment
In order that content of the present invention easily facilitates understanding, with reference to specific embodiment to of the present invention Technical scheme is described further.
Test method used in following embodiments is conventional method unless otherwise specified.
Test material used, reagent etc. in following embodiments, unless otherwise specified, commercially obtain.
The molecular detection primer of embodiment 1 is designed and sigatoka bacterium（Ramichloridium musae）Special molecular The foundation of detection method
1. sigatoka bacterium（Ramichloridium musae）The extraction of genomic DNA：
4 plants of sigatoka bacterium of this laboratory preservation are extracted using CTAB methods（Ramichloridium musae）Gene Group DNA, comprises the following steps that：
(1) 0.1 g hypha powders are taken in 1.5 mL centrifuge tubes, 900 μ L2%CTAB extract solutions are added, is vibrated using oscillator mixed It is even, 60 DEG C of water-bath 60min, under room temperature condition, 12000r/min is centrifuged 15 min；
(2) the μ L of supernatant 700, plus isometric phenol, chloroform, isoamyl alcohol mixed liquor are taken（Each volume ratio is 25:24:1）, gently shake It is dynamic, under room temperature condition, 8000 r/min centrifugations 10min；
(3) the μ L of supernatant 500 are taken, adds isometric chloroform to extract again once, under room temperature condition, 8000 r/min centrifugations 10min；
(4) the μ L of supernatant 350 are taken, the mol/L NaAc of 1/10 volume 3 and 2 times of volume absolute ethyl alcohols, -20 DEG C of precipitations 60 are added Min, under the conditions of 4 DEG C, 8000 r/min are centrifuged 5 min；
(5) abandoning supernatant, 700 μ L volumetric concentrations of addition be 70% ice ethanol, jog 10sec, under the conditions of 4 DEG C, 8000 r/ Min is centrifuged 10sec, dries, and adds 50 μ L TE buffer solutions, and -20 DEG C save backup.
2. sigatoka bacterium（Ramichloridium musae）ITS sequence is determined：
With fungi ribosomes internal gene transcribed spacers（rDNA-ITS）Universal primer TS1:5'-TCCGTAGGGAACCTGCGG-3' And ITS4:5'-TCCTCCGCTTATTGATATGC-3' is that primer pair extracts sigatoka bacterium（Ramichloridium musae）DNA enter performing PCR amplification, amplification reaction system and response procedures are：The μ L of PCR reaction systems 25, comprising 2.5 μ L 10 × PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L （Takara Dalian treasured bioengineering Co., Ltd）, each 0.5 μ L of TIS1 and ITS4 of 10 μm of ol/L, the μ L of DNA profiling 1, plus ddH2O is to cumulative volume up to 25 μ L；PCR reaction conditions are：94 DEG C of predegeneration 5min；94 DEG C of denaturation 1 min, 55 DEG C of annealing 45sec, 72 DEG C of 1 min of extension, totally 35 circulations；72 DEG C of extension 10min；Gained PCR primer send Dalian treasured bioengineering Co., Ltd to survey Sequence.
3. sigatoka bacterium（Ramichloridium musae）The design of special molecular detection primer：
According to sigatoka bacterium（Ramichloridium musae）Ribosomes the Internal Transcribed Spacer（rDNA-ITS）Sequence exists Fungi inter-species highly makes a variation and plants internal stability, and the 8 plants of sigatoka bacterium for obtaining will be sequenced with Clustal X softwares （Ramichloridium musae）ITS sequences and GenBank inRamichloridiumCategory ITS sequence not of the same race, Beak shell leaf spot fungi long（Ceratocytis paradoxa）ITS sequences, anthrax bacteria（Colletotrichum musae） ITS sequences, dark double spore leaf spot fungis（Cordana musae）ITS sequences, Curvularia disease（Curvularia lunata）ITS sequences, alternaria（Pseudocercospora fijiensis）ITS sequences, macula lutea germ （Pseudocercospora musae）ITS sequences carry out homology analysis and difference site is compared, and use Primer Primer5 Software for Design is to sigatoka bacterium（Ramichloridium musae）One couple of PCR primers with specific amplification effect (by Shanghai, Sheng Gong bioengineering Co., Ltd synthesizes), i.e. the sequence of special molecular detection primer is：
Sense primer RMSF：5’-AACCCTGCGTAACTGAGTCG-3’；
Anti-sense primer RMSR：5’-TTCAGCGGGTATCCCTACCT-3’
4. sigatoka bacterium（Ramichloridium musae）The foundation of rapid molecular detection method：
(1) DNA is extracted from banana plant:
When 1. being used to detect pathogen pure culture, strains tested genomic DNA is extracted using CTAB methods;
2. it is used to detect that banana plant tissue whether there is sigatoka bacterium（Ramichloridium musae）When, use NaOH rapid cleavages method extracts banana plant tissue gene group DNA, comprises the following steps that：
A. the g of plant tissue 0.1 to be detected is weighed, the μ L of 0.5 mol/L NaOH 30 are added, tissue is fully milled to paste；
B. pasty state tissue is transferred in 1.5 mL centrifuge tubes, 12000r/min is centrifuged 6 min, takes the μ l of supernatant 5
C. the mol/L Tris-HCl of 495 μ L 0.1 are added in supernatant（pH=8.0）, it is well mixed, 1.0 μ L are taken as PCR Template is expanded；
(2) to extract banana plant DNA as template enters performing PCR amplification：The μ L of PCR reaction systems 25, comprising 2.5 10 × PCR of μ L Buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, 10 μm of ol/L's Each 0.5 μ L of RMSF and RMSR, the μ L of DNA profiling 1, plus ddH2O is to cumulative volume up to 25 μ L；PCR reaction conditions are：94 DEG C of predegenerations 5min；94 DEG C of denaturation 45sec, 56 DEG C of annealing 45sec, 72 DEG C of extension 45sec, totally 35 circulations；72 DEG C of extension 10min；
(3) with the electrophoretic analysis of 0.5 × tbe buffer liquid on 1.0% Ago-Gel, voltage is 4- to the PCR primer on obtained by step 5V/cm；Size according to amplified production judges testing result, if energy specific amplification goes out the product of 383bp, can determine that institute The pathogen stated is sigatoka bacterium（Ramichloridium musae）, or in described banana plant there is banana tikka Germ（Ramichloridium musae）, the non-sigatoka bacterium of otherwise described pathogen（Ramichloridium musae）, or do not exist sigatoka bacterium in described banana plant（Ramichloridium musae）.
The sigatoka bacterium of embodiment 2（Ramichloridium musae）Specific amplification
1. 2 plants of sigatoka bacterium are extracted using CTAB methods（Ramichloridium musae）, beak shell leaf spot fungi long （Ceratocytis paradoxa）, anthrax bacteria（Colletotrichum musae）, dark double spore leaf spot fungis（Cordana musae）, Curvularia disease（Curvularia lunata）, alternaria（Pseudocercospora fijiensis）, macula lutea germ（Pseudocercospora musae）Genomic DNA.
2. to extract the DNA for examination bacterium as template enters performing PCR amplification：The μ L of PCR reaction systems 25, comprising 2.5 μ L 10 × PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, 10 μ Each 0.5 μ L of RMSF and RMSR of mol/L, the μ L of DNA profiling 1, plus ddH2O is to cumulative volume up to 25 μ L；PCR reaction conditions are：94℃ Predegeneration 5min；94 DEG C of denaturation 45sec, 56 DEG C of annealing 45sec, 72 DEG C of extension 45sec, totally 35 circulations；72 DEG C of extensions 10min；Electrophoresis detection amplified production.
3. specific amplification result
As shown in figure 1,2 plants of sigatoka bacterium（Ramichloridium musae）The bar of 383bp can be gone out with specific amplification Band, and beak shell leaf spot fungi long（Ceratocytis paradoxa）, anthrax bacteria（Colletotrichum musae）, it is dark double Spore leaf spot fungi（Cordana musae）, Curvularia disease（Curvularia lunata）, alternaria （Pseudocercospora fijiensis）, macula lutea germ（Pseudocercospora musae）With negative control without expansion Increase band, show that molecular detection primer of the invention can be by sigatoka bacterium（Ramichloridium musae）With other Pathogen makes a distinction, and with very strong specificity, detection method of the invention can be used for sigatoka bacterium （Ramichloridium musae）Specific amplification.
The primer pair sigatoka bacterium of the present invention of embodiment 3（Ramichloridium musae）Sensitivity detection
1. sigatoka bacterium is extracted using CTAB methods（Ramichloridium musae）Genomic DNA；
2. the sigatoka bacterium that will be extracted（Ramichloridium musae）Genomic DNA, through spectrophotometric determination After concentration, diluted with aseptic ultra-pure water, be configured to series concentration, it is standby；
3. to prepare into series concentration DNA as template carries out standard PCR amplification：The μ L of PCR reaction systems 25, comprising 2.5 μ L 10 × PCR buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L, 10 Each 0.5 μ L of RMSF and RMSR, the μ L of DNA profiling 1, plus the ddH of μm ol/L2O is to cumulative volume up to 25 μ L；PCR reaction conditions are：94℃ Predegeneration 5min；94 DEG C of denaturation 45sec, 56 DEG C of annealing 45sec, 72 DEG C of extension 45sec, totally 35 circulations；72 DEG C of extensions 10min；Electrophoresis detection amplified production.
4. to prepare into series concentration DNA as template carries out nested PCR amplification：
（1）First round PCR is expanded：With fungi ribosomes internal gene transcribed spacers（rDNA-ITS）Universal primer TS1:5'- TCCGTAGGGAACCTGCGG-3' and ITS4:5'-TCCTCCGCTTATTG ATATGC-3' are outer primer to preparing into being Row concentration DNA carries out the amplification of first round PCR, and amplification reaction system and response procedures are：The μ L of PCR reaction systems 25, comprising 2.5 μ 10 × PCR of L buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq enzyme of 5U/ μ L （Takara Dalian treasured bioengineering Co., Ltd）, each 0.5 μ L of TIS1 and ITS4 of 10 μm of ol/L, the μ L of DNA profiling 1, plus ddH2O is to cumulative volume up to 25 μ L；PCR reaction conditions are：94 DEG C of predegeneration 5min；94 DEG C of denaturation 1 min, 55 DEG C of annealing 45sec, 72 DEG C of 1 min of extension, totally 35 circulations；72 DEG C of extension 10min；
（2）Second wheel PCR amplifications：Product with first round PCR amplifications carries out the second wheel as template by primer of RMSF/RMSR PCR is expanded, the μ L of PCR reaction systems 25, and comprising 2.5 μ 10 × PCR of L buffer, 2.0 μ L concentration are the dNTP of 2.5mmol/L Mixture, 0.15 μ L concentration for 5U/ μ L Taq enzyme, each 0.5 μ L of RMSF and RMSR of 10 μm of ol/L, the μ L of DNA profiling 1, plus ddH2O is to cumulative volume up to 25 μ L；PCR reaction conditions are：94 DEG C of predegeneration 5min；94 DEG C of denaturation 45sec, 56 DEG C of annealing 45sec, 72 DEG C of extension 45sec, totally 35 circulations；72 DEG C of extension 10min；Electrophoresis detection amplified production.
5. testing result
As shown in Fig. 2 with primer RMSF/RMSR of the present invention as primer carry out Standard PCR when, in 25 μ L reaction systems, 1pg's Sigatoka bacterium（Ramichloridium musae）DNA can obtain view strip band, and its detection sensitivity can reach 1pg （Fig. 2-A）；And further with fungi ribosomes internal gene transcribed spacers（rDNA-ITS）Universal primer TS1:5'- TCCGTAGGGAACCTGCGG-3' and ITS4:5'-TCCTCCGCTTATTGATATGC-3' is mould for the product of external primer amplification Plate, when being expanded as primer carries out the second wheel with primer RMSF/RMSR of the present invention, in 25 μ L reaction systems, the banana tikka of 1fg Germ（Ramichloridium musae）DNA can obtain view strip band, and its detection sensitivity can reach 1fg (Fig. 2-B).
Sigatoka bacterium in the morbidity banana plant of embodiment 4（Ramichloridium musae）Detection
1. banana plant tissue gene group DNA is extracted using NaOH rapid cleavages method.
2. to prepare into series concentration DNA as template carries out standard PCR amplification：The μ L of PCR reaction systems 25, comprising 2.5 μ 10 × PCR of L buffer, 2.0 μ L concentration are the dNTP Mixture of 2.5mmol/L, and 0.15 μ L concentration is the Taq of 5U/ μ L Enzyme, each 0.5 μ L of RMSF and RMSR of 10 μm of ol/L, the μ L of DNA profiling 1, plus ddH2O is to cumulative volume up to 25 μ L；PCR reaction conditions For：94 DEG C of predegeneration 5min；94 DEG C of denaturation 45sec, 56 DEG C of annealing 45sec, 72 DEG C of extension 45sec, totally 35 circulations；72 DEG C are prolonged Stretch 10min；Electrophoresis detection amplified production.
3. testing result
As shown in figure 3, the Leaf of banana tissue of natural occurrence, natural occurrence banana petiole tissue, the banana of artificial infection morbidity The view strip band of 383bp or so can be produced in leaf tissue, artificial infection morbidity banana petiole tissue, positive control, and is good for Health Leaf of banana tissue, the banana petiole tissue of health, Banana peel tissue, the negative control of health are taken out of without any It is existing, show that primer of the present invention and detection method can be additionally used in field sigatoka（Ramichloridium musae）Morbidity is planted The detection of strain.
SEQUENCE LISTING
<110>Inst. of Plant Protection, fujian Academy of Agricultural Science
<120>A kind of sigatoka bacterium molecule detection primer and its method for quick
<160>4
<170>PatentIn version 3.5
<210>1
<211>18
<212>DNA
<213>Artificial Sequence
<400>1
tccgtagggaacctgcgg 18
<210>2
<211>20
<212>DNA
<213>Artificial Sequence
<400>2
tcctccgcttattgatatgc 20
<210>3
<211> 20
<212>DNA
<213>Artificial Sequence
<400>3
aaccctgcgtaactgagtcg 20
<210>4
<211>20
<212>DNA
<213>Artificial Sequence
<400>4
ttcagcgggtatccctacct 20

Claims (3)

1. a kind of sigatoka bacterium molecule detection primer, it is characterised in that：The nucleotides sequence of primer is classified as：
Sense primer RMSF：5’-AACCCTGCGTAACTGAGTCG-3’；
Anti-sense primer RMSR：5’-TTCAGCGGGTATCCCTACCT-3’.
2. sigatoka bacterium molecule detection primer according to claim 1, it is characterised in that：The sense primer RMSF and Anti-sense primer RMSR goes out the product of 383bp to sigatoka bacterium specific amplification.
3. the method for quick of the sigatoka bacterium of primer described in a kind of utilization claim 1, it is characterised in that：Including with Lower step：
(1) DNA of Banana Tissue is extracted；
(2) DNA of the Banana Tissue to extract enters performing PCR and expands as template：PCR reaction system 25mL, comprising 2.5mL 10 × PCR buffer, 2.0mL concentration are the Taq enzyme of 5U/mL for dNTP Mixture, the 0.15mL concentration of 2.5mmol/L, RMSF and RMSR each 0.5mL, DNA profiling 1mL, plus the ddH of 10mmol/L2O to cumulative volume reach 25mL；PCR reaction conditions are：94 DEG C predegeneration 5min；94 DEG C of denaturation 45sec, 56 DEG C of annealing 45sec, 72 DEG C of extension 45sec, totally 35 circulations；72 DEG C of extensions 10min；
(3) with the electrophoretic analysis of 0.5 × tbe buffer liquid on 1.0% Ago-Gel, voltage is 4- to the PCR primer on obtained by step 5V/cm；Size according to amplified production judges testing result, if energy specific amplification goes out the product of 383bp, can determine that perfume (or spice) There is sigatoka bacterium in any of several broadleaf plants plant tissue.
CN201710130113.7A 2017-03-07 2017-03-07 Molecular detection primer for sigatoka bacteria and rapid detection method thereof Expired - Fee Related CN106868147B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710130113.7A CN106868147B (en) 2017-03-07 2017-03-07 Molecular detection primer for sigatoka bacteria and rapid detection method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710130113.7A CN106868147B (en) 2017-03-07 2017-03-07 Molecular detection primer for sigatoka bacteria and rapid detection method thereof

Publications (2)

Publication Number Publication Date
CN106868147A true CN106868147A (en) 2017-06-20
CN106868147B CN106868147B (en) 2020-01-21

Family

ID=59169686

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710130113.7A Expired - Fee Related CN106868147B (en) 2017-03-07 2017-03-07 Molecular detection primer for sigatoka bacteria and rapid detection method thereof

Country Status (1)

Country Link
CN (1) CN106868147B (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107988328A (en) * 2018-01-25 2018-05-04 湖北省农业科学院中药材研究所 A kind of primer and its methods and applications for being used to detect coptis leaf spot pathogenic bacteria
CN114561483A (en) * 2020-11-27 2022-05-31 广东省农业科学院植物保护研究所 Dual detection kit for fusarium oxysporum f.sp.cubense and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106282386A (en) * 2016-10-17 2017-01-04 福建省农业科学院植物保护研究所 A kind of Glorosprium musarum Cookeet Mass molecular detection primer and detection method
CN106399529A (en) * 2016-10-17 2017-02-15 福建省农业科学院植物保护研究所 Molecular detection primer for banana cladosporium cucumerinum and detection method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106282386A (en) * 2016-10-17 2017-01-04 福建省农业科学院植物保护研究所 A kind of Glorosprium musarum Cookeet Mass molecular detection primer and detection method
CN106399529A (en) * 2016-10-17 2017-02-15 福建省农业科学院植物保护研究所 Molecular detection primer for banana cladosporium cucumerinum and detection method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
R.G.SHIVAS等: "Ramichloridium spp. on Musa in northern Queensland:introducing Ramichloridium ducassei sp.nov.on leaf streaks of Ducasse banana", 《AUSTRALASIAN PLANT PATHOLOGY》 *
ROLAND KIRSCHNER等: "New records of three Ramichloridium species on banana leaves in Panama and Taiwan", 《MYCOSCIENCE》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107988328A (en) * 2018-01-25 2018-05-04 湖北省农业科学院中药材研究所 A kind of primer and its methods and applications for being used to detect coptis leaf spot pathogenic bacteria
CN114561483A (en) * 2020-11-27 2022-05-31 广东省农业科学院植物保护研究所 Dual detection kit for fusarium oxysporum f.sp.cubense and application thereof

Also Published As

Publication number Publication date
CN106868147B (en) 2020-01-21

Similar Documents

Publication Publication Date Title
CN101974650B (en) Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit
CN105063219B (en) Guava anthrax bacteria specific PCR detection primer and its detection method
CN103509856B (en) Specific primer used for rapid detection of kiwi fruit soft rot pathogenic bacterium Botryosphaeria dothidea, and detection method of Botryosphaeria dothidea
CN102086471B (en) Kit and method for identifying and detecting Cordyceps sinensis
CN107090502B (en) A kind of duplex PCR detection method for cordyceps sinensis authenticity
CN104774955A (en) Botryosphaeria dothidea detection method
CN105256060B (en) A kind of roxburgh anoectochilus terminal bud anthrax bacteria PCR detection primer and its detection method
CN108893557A (en) A kind of method of three kinds of wheat rhizome portion diseases of quick detection
CN107815505A (en) A kind of Glorosprium musarum Cookeet Mass LAMP detection primer group and its detection method
CN106381341A (en) Phytophthora colocasiae nested PCR detection primer and application thereof
CN106868147A (en) A kind of sigatoka bacterium molecule detection primer and its method for quick
CN105112533B (en) PCR primer and its detection method for botrytis cinerea detection
CN101712989A (en) Method for quickly, qualitatively and quantitatively measuring Lactobacillus casei in probiotic dairy products
CN106282386A (en) A kind of Glorosprium musarum Cookeet Mass molecular detection primer and detection method
CN103045747A (en) Molecular detection primer for sweet potato black rot germs and application of molecular detection primer
CN105063226A (en) Specific PCR detection primers and detection method for Colletotrichum truncatum of vegetable soybeans
CN109943624A (en) A kind of method and its primer special and probe combinations based on RPA- Sidestream chromatography technology detection soybean phytophthora
CN105734132A (en) Agaricus bisporus Monilinia fructicola molecular detection primer and quick detection method
CN105586431B (en) A kind of asparagus stem wilt bacteria molecular detection primer and rapid detection method
CN106399529B (en) A kind of Phyllosticta musarum molecular detection primer and detection method
CN106434990B (en) A kind of clover phytophthora nested PCR detection method
CN105648107B (en) A kind of southern corn leaf blight molecular detection primer and rapid detection method
CN106498043A (en) A kind of banana crown rot bacterium molecule detection primer and detection method
CN106244721B (en) A kind of capsicum stain anthrax bacteria molecular detection primer and detection method
CN106244720B (en) A kind of anthracnose of peach bacterium molecule detection primer and detection method

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200121