CN106868147B - Molecular detection primer for sigatoka bacteria and rapid detection method thereof - Google Patents

Molecular detection primer for sigatoka bacteria and rapid detection method thereof Download PDF

Info

Publication number
CN106868147B
CN106868147B CN201710130113.7A CN201710130113A CN106868147B CN 106868147 B CN106868147 B CN 106868147B CN 201710130113 A CN201710130113 A CN 201710130113A CN 106868147 B CN106868147 B CN 106868147B
Authority
CN
China
Prior art keywords
primer
sigatoka
bacteria
banana
detection
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201710130113.7A
Other languages
Chinese (zh)
Other versions
CN106868147A (en
Inventor
杜宜新
石妞妞
陈福如
阮宏椿
甘林
杨秀娟
代玉立
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Plant Protection of FAAS
Original Assignee
Institute of Plant Protection of FAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Plant Protection of FAAS filed Critical Institute of Plant Protection of FAAS
Priority to CN201710130113.7A priority Critical patent/CN106868147B/en
Publication of CN106868147A publication Critical patent/CN106868147A/en
Application granted granted Critical
Publication of CN106868147B publication Critical patent/CN106868147B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a molecular detection primer for sigatoka bacteria and a rapid detection method thereof, belonging to the field of crop disease detection and biotechnology. The specific primer comprises an upstream primer RMSF: 5'-AACCCTGCGTAACTGAGTCG-3', downstream primer RMSR: 5' -TTCAGCGGGTATCCCTACCT-3. The detection primer and the detection method can be used for the sigatoka bacteria: (Ramichloridium musae) The pure culture detection and identification can also detect banana plants; the detection primer has strong specificity and high sensitivity, and the detection method has good practicability and is simple, convenient and quick to operate; the invention can realize the early detection of the sigatoka, can effectively distinguish pathogenic bacteria causing the sigatoka, and has important significance for early warning, prevention and control of the sigatoka and prevention and control of the spread of diseases.

Description

Molecular detection primer for sigatoka bacteria and rapid detection method thereof
Disclosure of Invention
Aiming at the banana leaf spot germ (A) in the prior artRamichloridium musae) The detection and identification are mainly based on the pathogenic morphological characteristics, the procedure is complicated, the death is long, the requirements on the identification experience are high, the accuracy is low, and the actual requirements of diagnosing the sigatoka are difficult to meet, and provides a sigatoka bacterium (A)Ramichloridium musae) Molecular detection primers and a rapid detection method thereof.
In order to realize the purpose, the invention adopts the following technical scheme:
the invention firstly provides a banana leaf spot germ: (Ramichloridium musae) The nucleotide sequence of the molecular detection primer is as follows:
an upstream primer RMSF: 5'-AACCCTGCGTAACTGAGTCG-3', respectively;
a downstream primer RMSR: 5'-TTCAGCGGGTATCCCTACCT-3' are provided.
The primers RMSF and RMSR are used for treating sigatoka bacteria (A)Ramichloridium musae) 383bp products are specifically amplified.
The invention also provides a banana leaf spot germ (A)Ramichloridium musae) The rapid detection method comprises the following steps:
(1) extracting DNA from banana plant tissues;
when the method is used for detecting pure cultures of pathogenic bacteria, the CTAB method is adopted to extract the genome DNA of the test strains; for detecting the existence of Musa paradisiaca in banana plant tissue (Ramichloridium musae) In the process, the DNA of the banana plant tissue genome is extracted by adopting a NaOH rapid cracking method.
(2) Performing PCR amplification by taking the extracted banana plant tissue DNA as a template: a PCR reaction system of 25. mu.L containing 2.5. mu.L of 10 XPCR buffer, 2.0. mu.L of dNTP mix at a concentration of 2.5mmol/L, 0.15. mu.L of Taq enzyme at a concentration of 5U/. mu.L, 10. mu.mol/L of each of RMSF and RMSR of 0.5. mu.L, 1. mu.L of DNA template, and ddH2O to the total volume of 25 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 45sec, annealing at 56 ℃ for 45sec, and extension at 72 ℃ for 45sec for 35 cycles; extending for 10min at 72 ℃;
(3) carrying out electrophoresis analysis on the PCR product obtained in the previous step on 1.0% agarose gel by using 0.5 xTBE buffer solution, wherein the voltage is 4-5V/cm; determination of amplification product sizeAs a result, if 383bp of product can be specifically amplified, the pathogen can be judged to be the sigatoka bacteria (A)Ramichloridium musae) Or the banana leaf spot bacteria exist in the banana plant tissue(Ramichoridium musae), otherwise said pathogen is not Phyllostachys banana (Ramichloridium musae) or the absence of Ramichloridium sp musae）。
The invention has the positive beneficial effects that:
(1) the accuracy is high: the invention designs the resistance to the sigatoka fungus according to the characteristics of high conservation of a fungus ribosome transcribed spacer region (rDNA-ITS) sequence in fungus species and interspecies variability of family genusRamichloridium musae) PCR primer with specific amplification effect. (ii) Banana leaf spot bacteria of different geographical originRamichloridium musae) Carrying the Musa parasdisiaca (A) and (B)Ramichloridium musae) The plant tissue and the healthy banana tissue are detected and verified, and only the banana leaf spot bacteria: (Ramichloridium musae) And an electrophoresis strip of 383bp can be specifically amplified in the banana tissue carrying the pathogen, which indicates that the primer designed by the invention is used for detecting the sigatoka bacteria: (Ramichloridium musae) The method is accurate and reliable;
(2) the specificity is strong: the primer pair designed by the invention is banana leaf spot germ: (Ramichloridium musae) Has strong specificity and can be used for distinguishing sigatoka bacteria: (Ramichloridium musae) Leaf spot of longbeak shell: (Ceratocytis paradoxa) Anthrax disease (B)Colletotrichum musae) Leaf spot of dark bisporous (A) ((B))Cordana musae) Curvularia leaf spot disease: (Curvularia lunata) Black spot disease ofPseudocercospora fijiensis) Yellow spot disease (1)Pseudocercospora musae) Waiting for the pathogenic bacteria of the banana leaf spot, thereby effectively distinguishing the diseases with similar symptom characteristics on the banana leaves;
(3) the sensitivity is high: the invention combines the designed specific primer and ITS gene universal primer (ITS 1/ITS 4) to carry out nested PCR amplificationThen, for Musa paradisiaca (C. banana.) (Ramichloridium musae) The detection sensitivity of (a) can reach 1fg at the DNA level;
(4) the applicability is wide, the practicality is good: the present invention relates to Musa paradisiaca (A)Ramichloridium musae) The detection method can not only detect the germ mycelium, but also detect the infected banana plant tissue, and can realize the detection of the banana leaf spot germ: (Ramichloridium musae) The early detection is carried out before the disease is obvious, and the outbreak of the disease is prevented and treated;
(5) the operation is simple, convenient and quick: the invention can judge the result only by carrying out DNA extraction, PCR amplification and agarose electrophoresis, generally the whole detection process can be completed within a few hours, and the operation is simple, convenient and quick.
Drawings
FIG. 1 shows the primer pair of Musa paradisiaca of the present invention: (Ramichloridium musae) Specific amplification electrophoretogram: wherein Lane M is 2000bp DNA Marker, Lane 2 and Lane 3 are Musa paradisiaca ((R))Ramichloridium musae) Lanes 4-10 are: leaf spot of Sclerotinia proboscleri (A. pecuroides) ((B))Ceratocytis paradoxa) Anthrax bacteria (b), anthrax bacteriaColletotrichum musae) Blastomyces fusciparum (A) and Blastomyces fusciparum (B)Cordana musae) Curvularia leaf spot bacteria (A), (B), (C)Curvularia lunata) Bacterial of blackspot disease: (A)Pseudocercospora fijiensis) Yellow spot bacterium (1)Pseudocercospora musae) And negative control.
FIG. 2 shows the primers of Musa paradisiaca of the present inventionRamichloridium musae) The sensitivity of detection amplification electropherogram: a: general PCR sensitivity detection, wherein the lane M is a 2000bp DNA Marker, and the lanes 2-12 are respectively: 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg, a negative control, a positive control; b is nested PCR sensitivity detection, wherein a Lane M is a 2000bp DNA Marker, and lanes 2-13 are respectively: 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg, 10fg, 1fg, 100ag, a negative control, a positive control;
FIG. 3 is an amplification electrophoresis chart of diseased banana leaf tissue and petiole tissue, wherein a lane M is 2000bp DNAmarker, and lanes 2-10 are naturally-diseased banana leaf tissue, naturally-diseased banana petiole tissue, artificially inoculated diseased banana leaf tissue, artificially inoculated diseased banana petiole tissue, healthy banana leaf petiole tissue, healthy banana peel tissue, positive control and negative control, respectively.
Detailed Description
In order to make the content of the present invention more comprehensible, the technical solutions of the present invention are further described below with reference to specific embodiments.
The test methods used in the following examples are all conventional methods unless otherwise specified.
Test materials, reagents, and the like used in the following examples are commercially available unless otherwise specified.
Example 1 design of molecular detection primers and MuscaRamichloridium musae) Establishment of specific molecule detection method
1. Leaf spot of banana bacterium (A)Ramichloridium musae) Extraction of genomic DNA:
extracting 4 banana leaf spot bacteria preserved in the laboratory by CTAB method (Ramichloridium musae) The genomic DNA of (1), the specific steps are as follows:
(1) adding 0.1 g of mycelium powder into 1.5 mL of a centrifuge tube, adding 900 μ L of 2% CTAB extract, shaking and mixing uniformly by using an oscillator, carrying out water bath at 60 ℃ for 60min, and centrifuging at 12000r/min for 15 min at room temperature;
(2) collecting supernatant 700 μ L, adding mixed solution of phenol, chloroform and isoamylol at equal volume (each volume ratio is 25:24: 1), gently shaking, and centrifuging at room temperature at 8000r/min for 10 min;
(3) taking 500 mu L of supernatant, adding equal volume of chloroform, extracting once again, and centrifuging at 8000r/min for 10min at room temperature;
(4) taking 350 mu L of supernatant, adding 1/10 volume of 3 mol/L NaAc and 2 volume times of absolute ethyl alcohol, precipitating at-20 ℃ for 60min, and centrifuging at 8000r/min at 4 ℃ for 5 min;
(5) discarding the supernatant, adding 700 μ L70% glacial ethanol, shaking gently for 10sec, centrifuging at 4 deg.C and 8000r/min for 10sec, air drying, adding 50 μ L TE buffer, and storing at-20 deg.C.
2. Leaf spot of banana bacterium (A)Ramichloridium musae) ITS sequencing:
the method comprises extracting Musa paradisiaca (Sciadophylla) by using fungus ribosome gene transcription spacer region (rDNA-ITS) universal primers TS1:5'-TCCGTAGGGAACCTGCGG-3' and ITS4:5'-TCCTCCGCTTATTGATATGC-3' as primer pairsRamichloridium musae) The DNA is subjected to PCR amplification, and an amplification reaction system and a reaction program are as follows: a PCR reaction system of 25. mu.L containing 2.5. mu.L of 10 XPCR buffer, 2.0. mu.L of dNTP mix at a concentration of 2.5mmol/L, 0.15. mu.L of Taq enzyme (Takara Dalbao bioengineering Co., Ltd.) at a concentration of 5U/. mu.L, 0.5. mu.L each of TIS1 and ITS4 at a concentration of 10. mu.mol/L, 1. mu.L of DNA template, and ddH2O to the total volume of 25 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 1 min, annealing at 55 ℃ for 45sec, and extension at 72 ℃ for 1 min for 35 cycles; extending for 10min at 72 ℃; the obtained PCR product is sent to Dalianbao bioengineering Co.
3. Leaf spot of banana bacterium (A)Ramichloridium musae) Designing a specific molecule detection primer:
according to Musa paradisiaca (A), (B), (CRamichloridium musae) The sequence of the transcription spacer region (rDNA-ITS) in the ribose is highly varied and stable in the fungus species, 8 strains of the leaf spot pathogen (banana) (rDNA-ITS) obtained by sequencing are used by Clustal X softwareRamichloridium musae) ITS sequence and GenBankRamichloridiumITS sequences belonging to different species, Leptosphaeria rostrata (A)Ceratocytis paradoxa) ITS sequence, anthrax bacteria: (Colletotrichum musae) ITS sequence, Erysiphe cinerea (A. cinerea)Cordana musae) ITS sequence, Curvularia lunata BlumeCurvularia lunata) ITS sequence, Episra nigra (Pseudocercospora fijiensis) ITS sequence, macular bacterium: (Pseudocercospora musae) ITS sequences are subjected to homology analysis and difference site comparison, and Primer5 software is used for designing and treating Physalospora banana (R) ((R))Ramichloridium musae) A pair of PCR primers (synthesized by Shanghai Biotechnology, Ltd.) with specific amplification, i.e., a differential primerThe sequence of the son detection primer is as follows:
an upstream primer RMSF: 5'-AACCCTGCGTAACTGAGTCG-3', respectively;
a downstream primer RMSR: 5'-TTCAGCGGGTATCCCTACCT-3'
4. Leaf spot of banana bacterium (A)Ramichloridium musae) Establishment of a rapid molecular detection method:
(1) extraction of DNA from banana plants:
① when used for detecting pure culture of pathogenic bacteria, CTAB method is adopted to extract test strain genome DNA;
② used for detecting the existence of banana leaf spot germ in banana plant tissueRamichloridium musae) In the process, the method adopts a NaOH rapid cracking method to extract the banana plant tissue genome DNA, and comprises the following specific steps:
a. weighing 0.1 g of plant tissue to be detected, adding 30 mu L of 0.5 mol/L NaOH, and fully grinding the tissue into paste;
b. transferring the pasty tissue into 1.5 mL centrifuge tube, centrifuging at 12000r/min for 6 min, collecting supernatant 5 μ l
c. Adding 495 mu L of 0.1 mol/L Tris-HCl (pH = 8.0) into the supernatant, uniformly mixing, and taking 1.0 mu L as a PCR template for amplification;
(2) performing PCR amplification by taking the extracted banana plant DNA as a template: PCR reaction system 25. mu.L, containing 2.5. mu.L of 10 XPCR buffer, 2.0. mu.L of dNTP mix at a concentration of 2.5mmol/L, 0.15. mu.L of Taq enzyme at a concentration of 5U/. mu.L, 10. mu.mol/L of each of RMSF and RMSR 0.5. mu.L, 1. mu.L of DNA template, plus ddH2O to the total volume of 25 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 45sec, annealing at 56 ℃ for 45sec, and extension at 72 ℃ for 45sec for 35 cycles; extending for 10min at 72 ℃;
(3) carrying out electrophoresis analysis on the PCR product obtained in the previous step on 1.0% agarose gel by using 0.5 xTBE buffer solution, wherein the voltage is 4-5V/cm; judging the detection result according to the size of the amplified product, if 383bp of the product can be specifically amplified, judging that the pathogenic bacteria is the sigatoka bacteria: (Ramichloridium musae) Or said banana plant has banana leaf spot bacteria: (Ramichloridium musae) Otherwise said pathogenic bacteria are non-banana leavesLeaf spot bacteria (A)Ramichloridium musae) Or said banana plant does not contain sigatoka bacteria: (Ramichloridium musae）。
Example 2 Physalospora banana: (Ramichloridium musae) Specific amplification
1. 2 strains of sigatoka bacteria are extracted by a CTAB method (a)Ramichloridium musae) Leaf spot of Sclerotinia proboscleri (A. pecuroides) ((B))Ceratocytis paradoxa) Anthrax bacteria (b), anthrax bacteriaColletotrichum musae) Blastomyces fusciparum (A) and Blastomyces fusciparum (B)Cordana musae) Curvularia leaf spot bacteria (A), (B), (C)Curvularia lunata) Bacterial of blackspot disease: (A)Pseudocercospora fijiensis) Yellow spot bacterium (1)Pseudocercospora musae) The genomic DNA of (1).
2. And (3) performing PCR amplification by taking the DNA extracted from the test bacteria as a template: PCR reaction system 25. mu.L, containing 2.5. mu.L of 10 XPCR buffer, 2.0. mu.L of dNTP mix at a concentration of 2.5mmol/L, 0.15. mu.L of Taq enzyme at a concentration of 5U/. mu.L, 10. mu.mol/L of each of RMSF and RMSR 0.5. mu.L, 1. mu.L of DNA template, plus ddH2O to the total volume of 25 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 45sec, annealing at 56 ℃ for 45sec, and extension at 72 ℃ for 45sec for 35 cycles; extending for 10min at 72 ℃; and detecting the amplification product by electrophoresis.
3. Specific amplification results
As shown in FIG. 1, 2 strains of Musa paradisiaca ((R))Ramichloridium musae) Can specifically amplify a 383bp strip, and the disease can be seen from Leptosphaera bealeica: (Ceratocytis paradoxa) Anthrax bacteria (b), anthrax bacteriaColletotrichum musae) Blastomyces fusciparum (A) and Blastomyces fusciparum (B)Cordana musae) Curvularia leaf spot bacteria (A), (B), (C)Curvularia lunata) Bacterial of blackspot disease: (A)Pseudocercospora fijiensis) Yellow spot bacterium (1)Pseudocercospora musae) And negative control has no amplification band, which indicates that the molecular detection primer of the invention can detect the sigatoka bacteria (II)Ramichloridium musae) The method has strong specificity compared with other pathogenic bacteria, and can be used for the alternaria leaf spot bacteriaRamichloridium musae) Specific amplification of (3).
Example 3 thisPrimer pair of the invention Musa paradisiaca (A)Ramichloridium musae) Sensitive detection of
1. Extracting Musa paradisiaca by CTAB methodRamichloridium musae) The genomic DNA of (1);
2. extracting Musa parasdisiaca (L.) KuntzeRamichloridium musae) After the concentration of the genome DNA is measured by a spectrophotometer, the genome DNA is diluted by sterile ultrapure water to prepare a series of concentrations for later use;
3. and (3) performing conventional PCR amplification by using the prepared DNA with the series of concentrations as a template: PCR reaction system 25. mu.L, containing 2.5. mu.L of 10 XPCR buffer, 2.0. mu.L of dNTP mix at a concentration of 2.5mmol/L, 0.15. mu.L of Taq enzyme at a concentration of 5U/. mu.L, 10. mu.mol/L of each of RMSF and RMSR 0.5. mu.L, 1. mu.L of DNA template, plus ddH2O to the total volume of 25 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 45sec, annealing at 56 ℃ for 45sec, and extension at 72 ℃ for 45sec for 35 cycles; extending for 10min at 72 ℃; and detecting the amplification product by electrophoresis.
4. Performing nested PCR amplification by using the prepared DNA with the series of concentrations as a template:
(1) first round PCR amplification: the first round of PCR amplification is carried out on DNA with a series of concentrations prepared by taking fungus ribosome gene transcribed spacer region (rDNA-ITS) universal primers TS1:5'-TCCGTAGGGAACCTGCGG-3' and ITS4:5'-TCCTCCGCTTATTG ATATGC-3' as outer primer pairs, and the amplification reaction system and the reaction program are as follows: a PCR reaction system of 25. mu.L containing 2.5. mu.L of 10 XPCR buffer, 2.0. mu.L of dNTP mix at a concentration of 2.5mmol/L, 0.15. mu.L of Taq enzyme (Takara Dalbao bioengineering Co., Ltd.) at a concentration of 5U/. mu.L, 0.5. mu.L each of TIS1 and ITS4 at a concentration of 10. mu.mol/L, 1. mu.L of DNA template, and ddH2O to the total volume of 25 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 1 min, annealing at 55 ℃ for 45sec, and extension at 72 ℃ for 1 min for 35 cycles; extending for 10min at 72 ℃;
(2) second round of PCR amplification: using the product of the first round of PCR amplification as a template and RMSF/RMSR as a primer to perform the second round of PCR amplification, wherein the PCR reaction system is 25 mu L and comprises 2.5 mu L of 10 XPCR buffer, 2.0 mu L of dNTP mix with the concentration of 2.5mmol/L, 0.15 mu L of Taq enzyme with the concentration of 5U/mu L and 0.5 mu L of 10 mu mol/L each of RMSF and RMSR, and the DNA template1 μ L, plus ddH2O to the total volume of 25 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 45sec, annealing at 56 ℃ for 45sec, and extension at 72 ℃ for 45sec for 35 cycles; extending for 10min at 72 ℃; and detecting the amplification product by electrophoresis.
5. The result of the detection
As shown in FIG. 2, when the primer RMSF/RMSR of the present invention was used as a primer in a conventional PCR, 1pg of Byssaceae (A) was added to a 25. mu.L reaction systemRamichloridium musae) A visible band can be obtained from the DNA, and the detection sensitivity can reach 1pg (FIG. 2-A); furthermore, when the universal primers TS1:5'-TCCGTAGGGAACCTGCGG-3' and ITS4:5'-TCCTCCGCTTATTGATATGC-3' of the fungal ribosomal gene transcribed spacer region (rDNA-ITS) are used as the products of the external primer amplification as templates and the primer RMSF/RMSR of the invention is used as the primer to carry out the second amplification, 1fg of the leaf spot virus (R) of banana in a 25 mu L reaction systemRamichloridium musae) A visible band was obtained from the DNA, and the detection sensitivity was 1fg (FIG. 2-B).
Example 4 Musa paradisiaca in diseased Banana plants (C)Ramichloridium musae) Detection of (2)
1. And (3) extracting the banana plant tissue genome DNA by adopting a NaOH rapid cracking method.
2. And (3) performing conventional PCR amplification by using the prepared DNA with the series of concentrations as a template: PCR reaction system 25. mu.L, containing 2.5. mu.L of 10 XPCR buffer, 2.0. mu.L of dNTP mix at a concentration of 2.5mmol/L, 0.15. mu.L of Taq enzyme at a concentration of 5U/. mu.L, 10. mu.mol/L of each of RMSF and RMSR 0.5. mu.L, 1. mu.L of DNA template, plus ddH2O to the total volume of 25 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 45sec, annealing at 56 ℃ for 45sec, and extension at 72 ℃ for 45sec for 35 cycles; extending for 10min at 72 ℃; and detecting the amplification product by electrophoresis.
3. The result of the detection
As shown in FIG. 3, naturally occurring banana leaf tissue, naturally occurring banana leaf stalk tissue, artificially inoculated and occurring banana leaf stalk tissue and positive control can all generate about 383bp visible bands, while healthy banana leaf tissue, healthy banana leaf stalk tissue, healthy banana peel tissue, negative control and negative control can all generate about 383bp visible bandsNo any band appears in the control, which shows that the primer and the detection method can also be used for field sigatokaRamichloridium musae) And (5) detecting diseased plants.
SEQUENCE LISTING
<110> institute of plant protection of academy of agricultural sciences of Fujian province
<120> molecular detection primers for sigatoka bacteria and rapid detection method thereof
<160>4
<170>PatentIn version 3.5
<210>1
<211>18
<212>DNA
<213>Artificial Sequence
<400>1
tccgtagggaacctgcgg 18
<210>2
<211>20
<212>DNA
<213>Artificial Sequence
<400>2
tcctccgcttattgatatgc 20
<210>3
<211>20
<212>DNA
<213>Artificial Sequence
<400>3
aaccctgcgtaactgagtcg 20
<210>4
<211>20
<212>DNA
<213>Artificial Sequence
<400>4
ttcagcgggtatccctacct 20

Claims (2)

1. A molecular detection primer for sigatoka bacteria is characterized in that: the nucleotide sequence of the primer is as follows:
an upstream primer RMSF: 5'-AACCCTGCGTAACTGAGTCG-3', respectively;
a downstream primer RMSR: 5'-TTCAGCGGGTATCCCTACCT-3', respectively;
the primer can be used for rapidly detecting the sigatoka bacteria, and specifically comprises the following steps:
(1) extracting DNA of banana tissues;
(2) performing PCR amplification by taking the extracted DNA of the banana tissue as a template: PCR reaction system 25. mu.L, containing 2.5. mu.L of 10 XPCR buffer, 2.0. mu.L of dNTP mix at a concentration of 2.5mmol/L, 0.15. mu.L of Taq enzyme at a concentration of 5U/. mu.L, 10. mu.mol/L of each of RMSF and RMSR 0.5. mu.L, 1. mu.L of DNA template, plus ddH2O to the total volume of 25 mu L; the PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 45sec, annealing at 56 ℃ for 45sec, and extension at 72 ℃ for 45sec for 35 cycles; extending for 10min at 72 ℃;
(3) carrying out electrophoresis analysis on the PCR product obtained in the previous step on 1.0% agarose gel by using 0.5 xTBE buffer solution, wherein the voltage is 4-5V/cm; judging the detection result according to the size of the amplified product, and if 383bp products can be specifically amplified, judging that the banana leaf spot pathogen exists in the banana plant tissue.
2. The primer for molecular detection of Musa paradisiaca according to claim 1, wherein: the upstream primer RMSF and the downstream primer RMSR specifically amplify a 383bp product of the sigatoka bacteria.
CN201710130113.7A 2017-03-07 2017-03-07 Molecular detection primer for sigatoka bacteria and rapid detection method thereof Expired - Fee Related CN106868147B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710130113.7A CN106868147B (en) 2017-03-07 2017-03-07 Molecular detection primer for sigatoka bacteria and rapid detection method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710130113.7A CN106868147B (en) 2017-03-07 2017-03-07 Molecular detection primer for sigatoka bacteria and rapid detection method thereof

Publications (2)

Publication Number Publication Date
CN106868147A CN106868147A (en) 2017-06-20
CN106868147B true CN106868147B (en) 2020-01-21

Family

ID=59169686

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710130113.7A Expired - Fee Related CN106868147B (en) 2017-03-07 2017-03-07 Molecular detection primer for sigatoka bacteria and rapid detection method thereof

Country Status (1)

Country Link
CN (1) CN106868147B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107988328A (en) * 2018-01-25 2018-05-04 湖北省农业科学院中药材研究所 A kind of primer and its methods and applications for being used to detect coptis leaf spot pathogenic bacteria
CN114561483A (en) * 2020-11-27 2022-05-31 广东省农业科学院植物保护研究所 Dual detection kit for fusarium oxysporum f.sp.cubense and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106282386A (en) * 2016-10-17 2017-01-04 福建省农业科学院植物保护研究所 A kind of Glorosprium musarum Cookeet Mass molecular detection primer and detection method
CN106399529A (en) * 2016-10-17 2017-02-15 福建省农业科学院植物保护研究所 Molecular detection primer for banana cladosporium cucumerinum and detection method

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106282386A (en) * 2016-10-17 2017-01-04 福建省农业科学院植物保护研究所 A kind of Glorosprium musarum Cookeet Mass molecular detection primer and detection method
CN106399529A (en) * 2016-10-17 2017-02-15 福建省农业科学院植物保护研究所 Molecular detection primer for banana cladosporium cucumerinum and detection method

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
New records of three Ramichloridium species on banana leaves in Panama and Taiwan;Roland Kirschner等;《Mycoscience》;20131111;第55卷;260-267 *
Ramichloridium spp. on Musa in northern Queensland:introducing Ramichloridium ducassei sp.nov.on leaf streaks of Ducasse banana;R.G.Shivas等;《Australasian Plant Pathology》;20110131;第40卷(第1期);61-65 *

Also Published As

Publication number Publication date
CN106868147A (en) 2017-06-20

Similar Documents

Publication Publication Date Title
CN101974650B (en) Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit
CN108220474A (en) A kind of LAMP detection primer of Fusarium graminearum and its application
CN108676910A (en) A kind of LAMP detection primer of fusarium prolifertum and its application
CN110567951A (en) Apple stem groove virus visual detection system based on CRISPR-Cas12a technology and detection method thereof
CN111534621A (en) Primer and detection method for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of colletotrichum gloeosporioides
CN101974651B (en) Fluorescence quantitative polymerase chain reaction (PCR) detection method and detection kit for phytophthora capsici leonian
CN106868147B (en) Molecular detection primer for sigatoka bacteria and rapid detection method thereof
CN108220475A (en) Cherry ash arrhizus bacteria detection method and detection primer special based on RPA technologies
CN105648106B (en) A kind of Exserohilum turcicum molecular detection primer and rapid detection method
KR101615433B1 (en) SNP marker for identifying the antlered form Ganoderma lucidum, and identifying method using the same
CN110846433B (en) KASP marker related to drug resistance of wheat powdery mildew and application thereof
CN112322768A (en) Method for diagnosing hippophae rhamnoides branch wilt and rapidly detecting RPA (resilient root antigen) of pathogenic bacteria
CN110331223B (en) Molecular marker, primer pair, kit and method for identifying different cane shoots types
CN110699471A (en) Primer pair and kit for rapidly detecting mycoplasma and application thereof
CN104004842A (en) Multiplex PCR primer set and detection method for simultaneously detecting three pathogenic bacteria causing sepsis of aquatic animals
CN111321242A (en) Rapid molecular detection method and application of rubber tree anthracnose pathogen Siamese anthrax
CN105648107B (en) A kind of southern corn leaf blight molecular detection primer and rapid detection method
CN102994509A (en) Eriocheir sinensis EsSXL gene, amplification primer group thereof and amplification method
CN116287391A (en) RPA primer for detecting tobacco target spot disease, primer/probe combination and application thereof
CN112176080B (en) Nested PCR primer group, kit and detection method for specifically detecting purple sisal leaf roll disease phytoplasma
CN104328205A (en) Establishment of rapid detection method for grain sclerospora graminicola by LAMP
CN111334601B (en) Early diagnosis method for northern millet leaf blight
CN113025744A (en) Nested PCR (polymerase chain reaction) specific primer for loquat colletotrichum gloeosporioides as well as detection method and application thereof
CN112280890A (en) Primer and probe combination for detecting peronophythora litchi based on RPA-lateral flow chromatography technology and detection method thereof
Grundy et al. A molecular approach to explore the extent of the threatened fungus Hypocreopsis rhododendri within wood

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20200121